ID: 1013974583

View in Genome Browser
Species Human (GRCh38)
Location 6:116062507-116062529
Sequence TGGGTTTGAATACATCTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013974583_1013974591 15 Left 1013974583 6:116062507-116062529 CCTGAGAGATGTATTCAAACCCA No data
Right 1013974591 6:116062545-116062567 TTTAGATTTTTGAATTGTCGGGG No data
1013974583_1013974590 14 Left 1013974583 6:116062507-116062529 CCTGAGAGATGTATTCAAACCCA No data
Right 1013974590 6:116062544-116062566 TTTTAGATTTTTGAATTGTCGGG No data
1013974583_1013974586 -9 Left 1013974583 6:116062507-116062529 CCTGAGAGATGTATTCAAACCCA No data
Right 1013974586 6:116062521-116062543 TCAAACCCAATTTGTAAGTGGGG No data
1013974583_1013974589 13 Left 1013974583 6:116062507-116062529 CCTGAGAGATGTATTCAAACCCA No data
Right 1013974589 6:116062543-116062565 GTTTTAGATTTTTGAATTGTCGG No data
1013974583_1013974585 -10 Left 1013974583 6:116062507-116062529 CCTGAGAGATGTATTCAAACCCA No data
Right 1013974585 6:116062520-116062542 TTCAAACCCAATTTGTAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013974583 Original CRISPR TGGGTTTGAATACATCTCTC AGG (reversed) Intergenic
No off target data available for this crispr