ID: 1013974587

View in Genome Browser
Species Human (GRCh38)
Location 6:116062526-116062548
Sequence TAAAACCCCACTTACAAATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013974587_1013974589 -6 Left 1013974587 6:116062526-116062548 CCCAATTTGTAAGTGGGGTTTTA No data
Right 1013974589 6:116062543-116062565 GTTTTAGATTTTTGAATTGTCGG No data
1013974587_1013974591 -4 Left 1013974587 6:116062526-116062548 CCCAATTTGTAAGTGGGGTTTTA No data
Right 1013974591 6:116062545-116062567 TTTAGATTTTTGAATTGTCGGGG No data
1013974587_1013974590 -5 Left 1013974587 6:116062526-116062548 CCCAATTTGTAAGTGGGGTTTTA No data
Right 1013974590 6:116062544-116062566 TTTTAGATTTTTGAATTGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013974587 Original CRISPR TAAAACCCCACTTACAAATT GGG (reversed) Intergenic
No off target data available for this crispr