ID: 1013974937

View in Genome Browser
Species Human (GRCh38)
Location 6:116066198-116066220
Sequence GCTGCCAGCAAATAAAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013974931_1013974937 10 Left 1013974931 6:116066165-116066187 CCCACCCTTAATCTGTTCGGCAT No data
Right 1013974937 6:116066198-116066220 GCTGCCAGCAAATAAAAAGCAGG No data
1013974933_1013974937 6 Left 1013974933 6:116066169-116066191 CCCTTAATCTGTTCGGCATCACC No data
Right 1013974937 6:116066198-116066220 GCTGCCAGCAAATAAAAAGCAGG No data
1013974934_1013974937 5 Left 1013974934 6:116066170-116066192 CCTTAATCTGTTCGGCATCACCT No data
Right 1013974937 6:116066198-116066220 GCTGCCAGCAAATAAAAAGCAGG No data
1013974932_1013974937 9 Left 1013974932 6:116066166-116066188 CCACCCTTAATCTGTTCGGCATC No data
Right 1013974937 6:116066198-116066220 GCTGCCAGCAAATAAAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013974937 Original CRISPR GCTGCCAGCAAATAAAAAGC AGG Intergenic
No off target data available for this crispr