ID: 1013985702

View in Genome Browser
Species Human (GRCh38)
Location 6:116190767-116190789
Sequence GGAAAGAATCGTTCTGCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 96}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013985702 Original CRISPR GGAAAGAATCGTTCTGCTGA GGG Intronic
902775959 1:18675199-18675221 GGAAAGAAGGGGGCTGCTGAGGG - Intronic
903631035 1:24771302-24771324 GGAAAGAGTAGTTCTGCTAAGGG - Intronic
907261645 1:53222647-53222669 GGAGAGACTCCTTCTGCTTAAGG + Intergenic
911336575 1:96588405-96588427 GAGAATAATCTTTCTGCTGAAGG + Intergenic
914937359 1:151993160-151993182 GGAAAGGGTCTTCCTGCTGAGGG - Intronic
918372708 1:183877254-183877276 GTAAAGAATCTTACAGCTGAAGG - Intronic
921278667 1:213544226-213544248 CGAGAGAATCCTTCTGCTGCAGG + Intergenic
1064892327 10:20191500-20191522 GGAGAGAATAATTCTGATGAGGG - Intronic
1065793286 10:29281506-29281528 TGAATGAATCTTTATGCTGAAGG + Intergenic
1067398396 10:45946270-45946292 GAAAAGACTCTCTCTGCTGATGG + Intergenic
1074410058 10:113220526-113220548 GGAAAAAATCATTCTCCTGTTGG - Intergenic
1080812029 11:35714235-35714257 GAGCAGAATGGTTCTGCTGATGG + Intronic
1081289484 11:41307135-41307157 GGAGAGACTCCTTCTGCTGAAGG + Intronic
1081910293 11:46695907-46695929 GGAAGCACTCCTTCTGCTGAAGG - Intronic
1082701296 11:56434780-56434802 GGAAAGAGTCGCTCTGTTAATGG + Intergenic
1084796661 11:71510734-71510756 GGAAAGAATTTTTCTACTGGAGG - Intronic
1089417116 11:118301554-118301576 GGAAAGATTCACTCTGCTGGGGG - Intergenic
1092633938 12:10419065-10419087 GGGAAGAATTGTTCTGCTCCAGG + Exonic
1092633956 12:10419570-10419592 GGGAAGAATTGTTCTGCTCCAGG + Intronic
1092635000 12:10435016-10435038 GGGAAGAATTGTTCTGCTCCAGG + Intronic
1098458449 12:70703504-70703526 GCAAAGAATGGTTCTACTCATGG + Intronic
1100733401 12:97499005-97499027 GGTAAGGTTAGTTCTGCTGAAGG + Intergenic
1101224434 12:102673850-102673872 GGAGAGAATTGTTATGCTGATGG - Intergenic
1101827561 12:108232388-108232410 GGAAAGACTTGCTCTGCTGGGGG + Intronic
1108597661 13:51963411-51963433 GGAAATGATCATGCTGCTGATGG - Intronic
1113964652 13:114145864-114145886 GGAGAGACCCGTTCTGCTGAAGG - Intergenic
1116541912 14:46110064-46110086 GGAAAGAGTCATTCTGCTAAAGG + Intergenic
1120501535 14:85303360-85303382 GGAGAGACTCGTTTTGCTTATGG - Intergenic
1121011207 14:90521286-90521308 GGAAAAAATTGCTCTTCTGATGG + Intergenic
1129267089 15:74399582-74399604 GCAAAGAATAGTTCTCCTGTAGG - Intergenic
1129343176 15:74899432-74899454 GGAAAGAAAAGGTCTGCTAAAGG + Exonic
1130978272 15:88793869-88793891 AGAAAGTATCTTCCTGCTGAGGG + Intergenic
1133419584 16:5634767-5634789 GGACAGAATCTGTCTGCAGAAGG - Intergenic
1135501313 16:22998390-22998412 GGGAAGATTCCTTCAGCTGAAGG - Intergenic
1136294355 16:29293219-29293241 GGAAAGAATCGATGTGGTGACGG - Intergenic
1138244277 16:55454830-55454852 GGAAAGAATCGTTTCACTGATGG + Intronic
1142100260 16:88267266-88267288 GGAAAGAATCGATGTGGTGACGG - Intergenic
1146152470 17:30486841-30486863 GGAAAGAATCATTCTGTTTTTGG + Intronic
1146932800 17:36790032-36790054 GAACAGAATCGTTCTGATCAAGG + Intergenic
1149184600 17:53982473-53982495 GGAATGGATAGTTTTGCTGAAGG - Intergenic
1151482434 17:74378303-74378325 AGAAAGAAACGTGCTGCTAAGGG - Intergenic
1157109042 18:44802310-44802332 GGAAAGAACCTTTGTGCAGATGG + Intronic
1165815326 19:38638552-38638574 GGAAAGAATGGTGTGGCTGAAGG - Intergenic
927891928 2:26756469-26756491 GGAGACAATTGTTCTTCTGATGG + Intergenic
928726140 2:34175954-34175976 GGAAAGAAAAGTTCTGAGGAAGG + Intergenic
928932327 2:36637234-36637256 GGAAAGACCCCTTCTGCTTAAGG + Intronic
929728034 2:44452899-44452921 GGGAAGAATGGTTCGGCTGCAGG + Intronic
930126320 2:47800228-47800250 GGAACAAATGGTTCTACTGAAGG + Exonic
932928828 2:76009480-76009502 GGAAAGAATACTGATGCTGAAGG - Intergenic
933195931 2:79390000-79390022 AGAAAGAATGGTTTTGCTGGTGG - Intronic
933293315 2:80461819-80461841 GGAAAATATCATTCTTCTGAGGG - Intronic
933903330 2:86864977-86864999 ACAAAGAGTCGTTCTGGTGAAGG + Intergenic
935777184 2:106483982-106484004 ACAAAGAGTCGTTCTGGTGAAGG - Intergenic
936889276 2:117350202-117350224 GGAAAGAATGGTTGCGATGAAGG + Intergenic
937133187 2:119528704-119528726 GGAGAGAGTCATTCTGTTGAGGG - Intergenic
938059765 2:128243563-128243585 GGAAAGAATCTCTCAGCTTAAGG + Intronic
939649726 2:144745747-144745769 GGAAAGTAGCTCTCTGCTGATGG - Intergenic
943526429 2:189022200-189022222 GGAAATTATCCTTCTGCAGATGG + Intergenic
947130913 2:226924062-226924084 GGAGAGACTCCTTCTGCTTAAGG - Intronic
1173190062 20:40869413-40869435 GGATGGAAGCATTCTGCTGATGG - Intergenic
1176257355 20:64159263-64159285 GGAATGAATCGGGTTGCTGAGGG - Intronic
1176367066 21:6039573-6039595 GGACAGAAGCCTTCAGCTGAAGG - Intergenic
1178909966 21:36666497-36666519 GGAGAGAAGCGTTCTGTTTAGGG + Intergenic
1179756452 21:43498973-43498995 GGACAGAAGCCTTCAGCTGAAGG + Intergenic
1180676787 22:17591964-17591986 GGAAAGAATGCTCCTGGTGATGG + Intergenic
1181903334 22:26173057-26173079 AGATAAAATAGTTCTGCTGAAGG - Intronic
1183766254 22:39878205-39878227 GGAAAGAATCTTTGAGCTGGAGG + Intronic
965379312 3:167967842-167967864 GGAGAGACTCCTTCTGCTTAAGG + Intergenic
970657727 4:18250274-18250296 GGAAAGAATCCTACTTTTGAAGG + Intergenic
970827205 4:20290210-20290232 GGAAAGAATCCTGATGCTGTGGG - Intronic
971954299 4:33396042-33396064 GGAGAGAATCCTTCTGCTTGAGG + Intergenic
979788353 4:124745981-124746003 GTAAAGCATATTTCTGCTGAAGG + Intergenic
980490162 4:133514399-133514421 GAAAAGAATGGTTCCTCTGATGG - Intergenic
981318448 4:143364600-143364622 GGAAAAAGCCGTTCTGCTGAAGG - Intronic
982033431 4:151323872-151323894 AGAATGAAGCTTTCTGCTGAAGG + Intronic
984107251 4:175563852-175563874 TGAAGGAATCGTTCTGCAGTGGG + Intergenic
984112957 4:175643089-175643111 GGGAAGAATCGGTCTGATTATGG - Intronic
996326381 5:122279281-122279303 GGAAGGAATCCTTGTGATGATGG + Intergenic
998021276 5:138773363-138773385 GGAAAGAACTGGTCTTCTGAGGG + Intronic
1002060076 5:176620772-176620794 GGACAGAATTGTGCTGCTGGTGG + Exonic
1003333229 6:5146742-5146764 GGAAAGAACCCTTTTGCAGAAGG - Intronic
1012127382 6:95447832-95447854 AGAAAGAAGCATTCTGCTGTTGG + Intergenic
1013985702 6:116190767-116190789 GGAAAGAATCGTTCTGCTGAGGG + Intronic
1014770760 6:125455693-125455715 TGAAAGAATTGGACTGCTGATGG + Intergenic
1015619815 6:135119467-135119489 GATAAGACTCGTTCTGTTGAGGG + Intergenic
1016776115 6:147906504-147906526 GAAAAGAATCCATCTGGTGACGG + Intergenic
1020434608 7:8149144-8149166 GGAAATAATGGTTCATCTGATGG - Intronic
1020577147 7:9947491-9947513 GGAGAGACTCCTTCTGCTGGGGG + Intergenic
1025068426 7:55877743-55877765 GGGAAGAACTGTTCTGCTGCAGG - Intergenic
1030156870 7:106464466-106464488 GGAAAGGATTGTGCTGGTGAGGG + Intergenic
1032805981 7:135354706-135354728 TAAAAGAATAGTTCTGGTGAAGG - Intergenic
1035253893 7:157614036-157614058 GGAAAGCATCGTTCTGCAGCAGG + Exonic
1036587438 8:10137353-10137375 GGAAAGAACCTTTCAGATGATGG - Intronic
1036956602 8:13194429-13194451 GTAAAGAATGCTTTTGCTGATGG + Intronic
1041736229 8:61113679-61113701 GGAAAGGATGGCTCTGCTTACGG + Intronic
1043225951 8:77730410-77730432 GGAAAGTATAGTTCTGCAAAGGG - Intergenic
1045370616 8:101518656-101518678 GGAGTGAATCGTTCTGTTGAAGG - Intronic
1048711082 8:137211401-137211423 GTAAATAAGGGTTCTGCTGATGG + Intergenic
1058803039 9:108563399-108563421 GGAAAGGATGGTTTTGCTGAAGG - Intergenic
1060402083 9:123355099-123355121 GGAGAGAATCCTCTTGCTGAAGG - Intergenic
1187027558 X:15451800-15451822 CAAAAGAATCTTTCTTCTGATGG - Intronic
1188651308 X:32634389-32634411 GGAGAGAATCCTTCTGCTTCAGG - Intronic
1192137532 X:68618289-68618311 GGAAAGAAATATTGTGCTGATGG - Intergenic
1192622994 X:72698574-72698596 GCAAAGAATCGTTCTGTTTTGGG - Intronic
1192927098 X:75766864-75766886 GGAAAGACTCTTTCTGCTTGAGG + Intergenic
1193356869 X:80529915-80529937 GGAAAATATGGTGCTGCTGATGG + Intergenic
1195451730 X:105021514-105021536 GGGAAGAATTGCACTGCTGATGG - Intronic
1196888673 X:120271496-120271518 GGAAAAAATGGGTTTGCTGATGG - Intronic
1197210098 X:123821204-123821226 GGAAAGAATGGTCTTTCTGAGGG + Intergenic