ID: 1013988143

View in Genome Browser
Species Human (GRCh38)
Location 6:116221502-116221524
Sequence CCAAATTCATGGAAAACTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 240}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013988143_1013988147 4 Left 1013988143 6:116221502-116221524 CCTTCAGTTTTCCATGAATTTGG 0: 1
1: 0
2: 1
3: 24
4: 240
Right 1013988147 6:116221529-116221551 TCATCTTTGGACGATGATTGAGG No data
1013988143_1013988148 5 Left 1013988143 6:116221502-116221524 CCTTCAGTTTTCCATGAATTTGG 0: 1
1: 0
2: 1
3: 24
4: 240
Right 1013988148 6:116221530-116221552 CATCTTTGGACGATGATTGAGGG No data
1013988143_1013988146 -9 Left 1013988143 6:116221502-116221524 CCTTCAGTTTTCCATGAATTTGG 0: 1
1: 0
2: 1
3: 24
4: 240
Right 1013988146 6:116221516-116221538 TGAATTTGGTTTCTCATCTTTGG 0: 1
1: 0
2: 1
3: 27
4: 330
1013988143_1013988149 20 Left 1013988143 6:116221502-116221524 CCTTCAGTTTTCCATGAATTTGG 0: 1
1: 0
2: 1
3: 24
4: 240
Right 1013988149 6:116221545-116221567 ATTGAGGGACTCTGAGTTGTAGG 0: 1
1: 0
2: 1
3: 8
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013988143 Original CRISPR CCAAATTCATGGAAAACTGA AGG (reversed) Intronic
901346987 1:8553825-8553847 GTAAATTCATGGAAATCAGATGG + Intronic
904716486 1:32471515-32471537 CCAAACTCCTAGAAAAGTGATGG - Exonic
906093155 1:43199954-43199976 CCAAATGCATGGAAACTTGTAGG + Intronic
906725035 1:48038056-48038078 AAAAATTCATGAAAAACTTATGG + Intergenic
907669709 1:56463723-56463745 CCAAGTTCATAGAAAAGTGGAGG - Intergenic
908350081 1:63278057-63278079 CCTCATTCATGGAAGACTGTTGG + Intergenic
910274993 1:85440079-85440101 CAAAATTTATGTAAAACTAAAGG - Intronic
910969864 1:92845370-92845392 ACAAATTTATGGGATACTGATGG + Intronic
911809891 1:102262737-102262759 CCTAATTCCTGAAAAAATGAAGG - Intergenic
913656100 1:120961616-120961638 CCACATTCATGACAAACAGAAGG - Intergenic
914520658 1:148412848-148412870 CCACATTCATGACAAACAGAAGG - Intergenic
917755266 1:178092906-178092928 CCACATTCAAGAAAAACTGTTGG + Intergenic
919078921 1:192846777-192846799 CAATATACATGAAAAACTGAGGG + Intergenic
920755238 1:208723853-208723875 CCATGTTCAAGGAAAACTAAGGG + Intergenic
920987795 1:210906869-210906891 TCAAATTCATGGATAGCTGGAGG + Intronic
921216310 1:212939845-212939867 ACAAATTAATGGCAAACTGATGG - Intergenic
923545379 1:234919584-234919606 CCAAATGCAAGGTAACCTGAGGG + Intergenic
923940119 1:238812983-238813005 CCAAAAACATGGAATACTAAGGG - Intergenic
924499199 1:244620717-244620739 CCACATTGATAGGAAACTGAGGG + Intronic
924790093 1:247238153-247238175 CCCTCTTGATGGAAAACTGATGG + Intergenic
1063710528 10:8473281-8473303 CCAGATTCATGAAACACTTAAGG - Intergenic
1067513675 10:46917389-46917411 TCAAAAACATGAAAAACTGAGGG + Intronic
1067648578 10:48134445-48134467 TCAAAAACATGAAAAACTGAGGG - Intergenic
1067991667 10:51220367-51220389 ACAAATTCATGGAAACCTAGTGG - Intronic
1070675545 10:78409162-78409184 CCAACTTCATGGAGGCCTGAAGG + Intergenic
1072412804 10:95219583-95219605 ACAAATTCAAGGAAAAAAGAAGG - Intronic
1074087753 10:110221545-110221567 CCAAGTTCATGCAAAAAAGAAGG + Intronic
1075251497 10:120879806-120879828 CTCAATTCAAGGACAACTGAAGG - Intronic
1075266864 10:121008380-121008402 CCTATTTCATGGAAAATTTATGG - Intergenic
1075329863 10:121566194-121566216 TCAAACTCAAGGAAAACTAAGGG + Intronic
1078353248 11:10612936-10612958 CCAATTTATTGGAAAAATGAAGG + Intronic
1078503554 11:11910043-11910065 ACACATTCCTGGAAAAATGAGGG - Intronic
1079368011 11:19826283-19826305 CTAAAATGATGGAAAATTGAGGG - Intronic
1079619787 11:22539778-22539800 ACAAATTCCTGGAAAACTCTAGG - Intergenic
1079879747 11:25911125-25911147 CCAAAATCAGGGAAAACGGTAGG - Intergenic
1079994616 11:27282405-27282427 CCAAACCCATGGAAAAATAACGG + Intergenic
1081214447 11:40377991-40378013 GCAAATTTATGAAAATCTGATGG + Intronic
1081254817 11:40879383-40879405 CCCAACTCATGGAAAGATGATGG + Intronic
1082838875 11:57672228-57672250 CAAAGTTCATGTAAAACTAAAGG - Exonic
1083119233 11:60494667-60494689 CCTAATTTATGCAAAACTGTTGG - Intronic
1086083336 11:82928528-82928550 CCAAATTGATGGAAAACTAAAGG - Intronic
1087589841 11:100173323-100173345 CCAAATTCAAGGAAGAGGGAAGG + Intronic
1098081776 12:66794065-66794087 CCAAATGCAAGGAAAATAGAAGG - Intronic
1099364689 12:81753783-81753805 ACAAAATCATGGACTACTGATGG - Intronic
1099388902 12:82053971-82053993 CCAAATTCATGGTTTACAGATGG + Intergenic
1099567524 12:84271362-84271384 CCACATGCATGAAAAACAGAAGG - Intergenic
1100883248 12:99041516-99041538 CTAAATGTATGGAAAACTGGGGG - Intronic
1101008071 12:100421045-100421067 CCAAATTTTTAGAAATCTGATGG + Exonic
1101389827 12:104290284-104290306 GCAAATTAATGGAAAATTAATGG + Intronic
1101548592 12:105740389-105740411 CCATGTTCATTCAAAACTGAAGG - Intergenic
1108164316 13:47676406-47676428 CCAAATAAATGGAAGAATGAAGG - Intergenic
1108821507 13:54356390-54356412 CCAAATCAAAGGAGAACTGAGGG - Intergenic
1109468709 13:62775919-62775941 CCAAATTCATGGTACAATTAAGG - Intergenic
1109487308 13:63043458-63043480 TCAAATTCTTGAAAAATTGATGG - Intergenic
1110274185 13:73625023-73625045 CCAAATACAAGGAAATCTGTGGG - Intergenic
1110688684 13:78405513-78405535 CTGAAGTCCTGGAAAACTGAAGG + Intergenic
1111088883 13:83415254-83415276 CCAAAAAGATGGAAAACTGAAGG + Intergenic
1111490564 13:88968388-88968410 ACATATTCCTGGAAGACTGATGG - Intergenic
1111672945 13:91350942-91350964 GCAAATCTATGCAAAACTGATGG + Intergenic
1111898779 13:94174752-94174774 CCAAAGTCACGGAAAACAGCAGG + Intronic
1111988344 13:95089089-95089111 GCAAATTTCTGGAAAAATGATGG + Intronic
1113296684 13:108966801-108966823 TTAAATTCATGGAAAGCTTATGG + Intronic
1114739182 14:25077486-25077508 TCAGCTTCATGGAAGACTGAAGG - Intergenic
1115316186 14:32027273-32027295 GCAAATCCATGGCAAATTGAAGG + Intergenic
1115391405 14:32858407-32858429 CTACACTCAAGGAAAACTGAGGG + Intergenic
1116056958 14:39875958-39875980 CCAGATTCATGGTAGACTTATGG + Intergenic
1116992526 14:51291348-51291370 CCAGATCCAGGGAAAGCTGAAGG + Intergenic
1117480849 14:56142946-56142968 TCATATTCATGGAAAAATTATGG + Intronic
1121570840 14:94945440-94945462 CCAAATTCTTGAATAAATGAGGG - Intergenic
1122312955 14:100808811-100808833 GGCAATTCATGGTAAACTGAGGG - Intergenic
1123497583 15:20843740-20843762 CCACAGTCATGGAAAAGTAATGG + Intronic
1125035229 15:35115950-35115972 TCAAATTCAGGAAAAACTGATGG + Intergenic
1125886545 15:43234033-43234055 GCAAATACATGGGAAACTCATGG - Intronic
1126976874 15:54192765-54192787 GCAAATACATTGAAGACTGAAGG - Intronic
1127152811 15:56095608-56095630 CCACATTCAGGGAAAACAGAAGG - Exonic
1127261245 15:57327933-57327955 CAACACTCATGGAAAACTAATGG + Intergenic
1127706436 15:61551779-61551801 CCAAAGCCATGCAAAACTCAAGG - Intergenic
1127750173 15:62030229-62030251 ACAAATTCAAGGAAAACAAAAGG + Intronic
1128802869 15:70508154-70508176 CCACATTCATGGAGAAGTGAGGG + Intergenic
1130985987 15:88845020-88845042 TCATAGTCATGGAAAAATGAGGG - Intronic
1131405795 15:92163444-92163466 CCAAATTCAGGGAACAGTGGTGG + Exonic
1139180062 16:64736543-64736565 CCACATTCATGGCATAGTGATGG - Intergenic
1140235546 16:73155435-73155457 CCACTTCCATGGAAAGCTGAGGG - Intergenic
1140312915 16:73866531-73866553 CCAAACTCTTTGAAAAGTGATGG - Intergenic
1145867099 17:28248339-28248361 CCAAATGCATGGAAAGGGGAGGG + Intergenic
1146067704 17:29649499-29649521 CCAGCTTCTTGGAAAGCTGAGGG - Intronic
1146131360 17:30279051-30279073 CCAAAATGCTGGAAAGCTGAAGG + Intronic
1149107819 17:52990466-52990488 CCAAATTAATGGCAAACACAAGG - Intergenic
1150116630 17:62556596-62556618 CGAAATGCTTGAAAAACTGAAGG - Intronic
1150500454 17:65645986-65646008 CCAAAGTACTTGAAAACTGAGGG - Intronic
1152052000 17:77986752-77986774 TCAAATTCATGTATAACAGATGG - Intergenic
1152972976 18:183337-183359 TCACATTCTTGGAAAACTGGGGG - Intronic
1153569767 18:6457622-6457644 TCAAATTCATATAAAATTGAAGG - Intergenic
1154051920 18:10969130-10969152 CCAAATTTATGGAATATGGAAGG - Intronic
1156496288 18:37527424-37527446 CCAACTTCTTGGAAAATGGAGGG - Intronic
1157092008 18:44647858-44647880 CCAAAATCATGGCTATCTGAAGG + Intergenic
1158298419 18:56025180-56025202 CCAGACTCATTCAAAACTGATGG - Intergenic
1158869702 18:61673659-61673681 CAAAACTCAGGGAAAACTCAAGG + Intergenic
1160065972 18:75574652-75574674 CCATTTTCATAGATAACTGAAGG - Intergenic
1163216352 19:15880160-15880182 CCAAAATCCTGGGAAACTGATGG + Intronic
927270512 2:21204664-21204686 CCTAAGTCCTGGACAACTGAAGG - Intergenic
928139818 2:28718600-28718622 CCAGGTTCATGGAAGACTGGGGG + Intergenic
929008070 2:37414691-37414713 CTAAATTCATTGAGAATTGAGGG + Intergenic
929863721 2:45700290-45700312 CCAAAGAAATGGAAAACTAAGGG + Intronic
930370534 2:50495575-50495597 CCAAATCAATTGAAAACTGTTGG + Intronic
935050010 2:99517548-99517570 TCAAATTTATAAAAAACTGAGGG - Intergenic
935256001 2:101310112-101310134 CCATCTTCATGGAAAACTTACGG - Intergenic
937463683 2:122110953-122110975 CCAAATTCAATGCTAACTGAAGG - Intergenic
939063029 2:137447966-137447988 ACACATTCATAGGAAACTGAAGG + Intronic
939642257 2:144654770-144654792 CCAACTTCAAGCAAAACTGTTGG + Intergenic
940983613 2:160029989-160030011 CCATTTTCCTGGAAAACTCATGG + Intronic
941012542 2:160317547-160317569 CTAATTACATGGAAAACTGAAGG + Intronic
941103795 2:161328781-161328803 ACAAATTCATGAAAAAAGGAGGG + Intronic
942508016 2:176664477-176664499 CCAAAAACAAGGAAAACTCATGG - Intergenic
943536805 2:189162301-189162323 CCAAATTAATGAATAAATGAAGG + Intronic
944597542 2:201275141-201275163 TCAAATGTATAGAAAACTGAAGG - Intronic
944876785 2:203970503-203970525 CCAAATAATTGGAAAAATGATGG - Intergenic
945182756 2:207108507-207108529 ACAAATTCCTGGAAGGCTGAAGG - Intronic
946029101 2:216691049-216691071 GCAAGATCATGGAAAACTGAAGG - Intronic
947234716 2:227928324-227928346 CAATATTCATGGATGACTGAGGG + Intergenic
947928803 2:233945091-233945113 CAAAATTCAAGGAGAACAGAAGG - Intronic
948420735 2:237858878-237858900 GCAGCTGCATGGAAAACTGATGG - Intronic
1169410897 20:5369390-5369412 TCAAATCAATGGAAAAATGATGG + Intergenic
1172869204 20:38125461-38125483 CAAAAGTGATGGAAAAATGATGG - Intronic
1174944730 20:54972205-54972227 CCAAATTCTCGGAGAAGTGATGG + Intergenic
1175112305 20:56657278-56657300 CCAAATTGATGCCCAACTGAAGG + Intergenic
1178452074 21:32711112-32711134 ACAAATTCATGCATGACTGAAGG + Intronic
1178830828 21:36054958-36054980 CCAACTTGCTGGGAAACTGATGG - Intronic
1181138696 22:20787771-20787793 CCAAATTCCTGGATAACTCCAGG + Intronic
1182171787 22:28237649-28237671 CAAAATACATGAAAAAATGAGGG + Intronic
1182213563 22:28697114-28697136 CCAAAATCATAGAAAACTGTTGG + Intronic
949217791 3:1590991-1591013 CAAAATTAATGGAAAAATTAAGG + Intergenic
951307516 3:21083929-21083951 AGAAATTCATGGAAAAATGTGGG - Intergenic
955305448 3:57826613-57826635 CCAAACTGAGGGAAAACTGCTGG - Intronic
956781756 3:72608843-72608865 CCAAATACATGTATCACTGATGG + Intergenic
957660506 3:83145511-83145533 CTAACATCATGGAAAACTGAAGG - Intergenic
958452658 3:94293433-94293455 TAAAATTCATGGAAAAATAATGG - Intergenic
958888562 3:99756867-99756889 CCATATGCAGAGAAAACTGAAGG + Intronic
960840248 3:121950739-121950761 CCAAATCAATTAAAAACTGAAGG + Intergenic
961322915 3:126090660-126090682 CCAAAATCATGGTATTCTGAAGG + Intronic
962294517 3:134170070-134170092 TCATAGTCATGGAAAACAGAAGG + Intronic
964331142 3:155604681-155604703 CCATACTCATGGAAAACAAAAGG + Intronic
964363838 3:155927963-155927985 ATAAATACATGGATAACTGATGG - Intronic
966053355 3:175650075-175650097 CAAAATTGATAGAAATCTGAGGG - Intronic
966500344 3:180632690-180632712 ATGAATTCATGGAAAACAGATGG + Intronic
967387212 3:188923479-188923501 CTGAATTTATGGAACACTGATGG + Intergenic
967399749 3:189047927-189047949 CAACATTCATGGATAACTGAGGG - Intronic
967543546 3:190696879-190696901 CCAAGTCCAGGGAAAACTCAGGG - Intergenic
967765344 3:193272828-193272850 CCAGTTTTATGGGAAACTGATGG - Intronic
970970396 4:21976427-21976449 CCATCGTCTTGGAAAACTGAAGG + Intergenic
971175491 4:24278590-24278612 CAAAAATCATGAAAAACAGAAGG - Intergenic
972204974 4:36760622-36760644 CCAAATTCAAGAAAAACTTATGG - Intergenic
972640728 4:40922954-40922976 AAAAATTGATGGAGAACTGATGG - Intronic
972916699 4:43890421-43890443 CCAAACTAATGGAAAATTGAAGG + Intergenic
975269372 4:72411882-72411904 AGAAATTGAAGGAAAACTGATGG - Intronic
975360967 4:73471570-73471592 CCAAATTAAAGCCAAACTGAGGG - Intergenic
975970394 4:80027444-80027466 AAAATTTCAAGGAAAACTGAAGG - Intronic
977075935 4:92449330-92449352 CCAAATTCAAGGAAAAAGTAAGG - Intronic
980170396 4:129282491-129282513 GCAACATCATGGAAAAGTGAGGG + Intergenic
981079578 4:140625431-140625453 CAAACTGCATGGGAAACTGAGGG - Intronic
981913407 4:150008386-150008408 CCAAACTTATAGAAAACTTATGG + Intergenic
983426516 4:167590517-167590539 CAAAAATCATGAAAACCTGAAGG + Intergenic
983750446 4:171261855-171261877 GCAGATTCAATGAAAACTGATGG - Intergenic
984157320 4:176208319-176208341 GCAAATTCATGGATATCTAAAGG - Intergenic
984562287 4:181284631-181284653 TTAATTTTATGGAAAACTGAGGG + Intergenic
984579418 4:181494197-181494219 CAAAATTCATGGACCACTGATGG - Intergenic
985181244 4:187266048-187266070 CCAAAATTATTGAAATCTGAGGG + Intergenic
986516342 5:8567887-8567909 GAAAATACATGGAAAACTTAAGG - Intergenic
987681049 5:21136525-21136547 GCAAATAAATGGCAAACTGAAGG - Intergenic
988513115 5:31882400-31882422 CCAAATTCCTGTAAAACACAGGG + Intronic
990220032 5:53577890-53577912 CCAAATTCAAAGAAAACTGTAGG - Intronic
990489951 5:56294874-56294896 CCACATCCATGGCAAAATGAGGG - Intergenic
993238786 5:85351993-85352015 GCAAATTAATGGAAAAAGGAAGG - Intergenic
994331768 5:98514711-98514733 GCAAAATCATTGAGAACTGAAGG + Intergenic
994819532 5:104631855-104631877 AGAAATTGATGCAAAACTGAGGG - Intergenic
994931669 5:106195646-106195668 CCATGTTCATAGAAAACAGAAGG - Intergenic
995950643 5:117708510-117708532 TAAAATACTTGGAAAACTGATGG + Intergenic
996349303 5:122520675-122520697 CCAAAATCAAAGAAAACTAATGG - Intergenic
996650246 5:125867052-125867074 GTAAATACATGGAAAACTGATGG + Intergenic
996887343 5:128373073-128373095 CCACAATGATGAAAAACTGAAGG + Intronic
999093559 5:148958443-148958465 CCACATTAGTGGGAAACTGATGG - Intronic
1000257045 5:159549399-159549421 CCAAACTAATGAAAAACTGAAGG + Intergenic
1000373226 5:160556851-160556873 CAAAATTCTGGGAAAATTGATGG - Intergenic
1000618124 5:163452388-163452410 ACAAATTCATTGAATAATGATGG + Exonic
1000767605 5:165310967-165310989 TGAAATCCTTGGAAAACTGAGGG - Intergenic
1001373680 5:171233408-171233430 CCAAAGGCATCGAAAACTTACGG + Intronic
1003622272 6:7711320-7711342 ACAAATTCATGAATAACAGAAGG + Intergenic
1004892567 6:20115587-20115609 TCAAATTACAGGAAAACTGAAGG + Intronic
1005046429 6:21647274-21647296 TCAAGTTCATGGAAGAGTGAGGG - Intergenic
1007901903 6:45421180-45421202 TTAAATTCATGGAAAACGGCTGG + Intronic
1008491280 6:52089673-52089695 CTGAATTCCTGGAAAACTGTGGG + Intergenic
1010314372 6:74429031-74429053 GAAAATTCATAGAAAAATGAAGG - Intergenic
1011515996 6:88154108-88154130 CAAAATATATGAAAAACTGAAGG - Intronic
1013288796 6:108702490-108702512 CCAAATTCTAGGAAAACTGTAGG + Intergenic
1013934756 6:115580801-115580823 CTTAATCCATGGCAAACTGACGG + Intergenic
1013988143 6:116221502-116221524 CCAAATTCATGGAAAACTGAAGG - Intronic
1014750692 6:125252779-125252801 ACAAATTCATGGGATACTTACGG - Intronic
1014876301 6:126664602-126664624 CCAGATTCATGAAAAAATAAGGG + Intergenic
1015572830 6:134639432-134639454 CCAAATCAATGGAAGTCTGAAGG + Intergenic
1015604196 6:134938476-134938498 CCAAAGGCAGGAAAAACTGAAGG + Intronic
1015951366 6:138556662-138556684 ACAAATTCATGGAAAACCAGAGG + Intronic
1016801383 6:148172795-148172817 CCAATGTAATGGAAAACTCAGGG + Intergenic
1017857773 6:158366201-158366223 CCAACTTCAAGAAAGACTGACGG - Intronic
1018487120 6:164252240-164252262 CCAAATTCAAGAAAAAGTGAAGG + Intergenic
1018653608 6:166011192-166011214 CCAAAATACTGCAAAACTGAGGG + Intergenic
1018721136 6:166573326-166573348 GCAAACTCAGGGAAAACAGAGGG + Intronic
1021180050 7:17495557-17495579 TCAAATTCCTGTAAAACTCAGGG - Intergenic
1022076800 7:26979287-26979309 GCAATTTGATGGAAAACAGATGG - Intronic
1023008472 7:35902130-35902152 CATAATTCCTGGATAACTGAAGG + Intronic
1023016163 7:35970550-35970572 CATAATTCCTGGATAACTGAAGG + Intergenic
1024883875 7:54119568-54119590 GTAAATTCATGCAAAGCTGAAGG + Intergenic
1027635096 7:80661933-80661955 CCAAATTCATGGCAAATAAAGGG + Intronic
1028045545 7:86113583-86113605 TCAAATTCATTGACAAATGACGG + Intergenic
1028387174 7:90269099-90269121 AGAAATTCAGGGAAAACAGAAGG + Intronic
1028442350 7:90878602-90878624 ACAAATCCATGTTAAACTGAAGG - Intronic
1030279894 7:107762490-107762512 CCTCAATGATGGAAAACTGAAGG - Intergenic
1031568290 7:123326727-123326749 ACAAATTGATGAAAAACTTAAGG + Intergenic
1031575977 7:123416412-123416434 CCAAATTGATACAAAACTGAAGG - Intergenic
1032046361 7:128612434-128612456 CAAAATGCTTGAAAAACTGAAGG - Intergenic
1032064127 7:128751813-128751835 CCAAATTCTTAAACAACTGAAGG + Intronic
1032136838 7:129287089-129287111 CCAAATTCATAAAAAACTGTTGG + Intronic
1033018762 7:137699823-137699845 CCACAGTCTTGCAAAACTGATGG + Intronic
1033233413 7:139619501-139619523 CCAATTTCCTGGAAATCTGTGGG + Intronic
1033407772 7:141087251-141087273 CTAATTTCAAGGAAAACTGTTGG - Intronic
1033515704 7:142103553-142103575 CCTAACACATGGAAAACTCAGGG - Intronic
1036573014 8:9998326-9998348 CCACATCCTAGGAAAACTGATGG - Intergenic
1037749201 8:21669127-21669149 CCTCATTCAGGAAAAACTGATGG - Intergenic
1041554928 8:59142479-59142501 CCAACTTCATGGAAAAAGGTTGG + Intergenic
1041649018 8:60282695-60282717 CCAAATATATGGAAAACTACTGG + Intergenic
1042163492 8:65922050-65922072 CCTAAGTCCTTGAAAACTGAAGG + Intergenic
1043233053 8:77826589-77826611 CCAAATTCTGGGAAAGGTGATGG - Intergenic
1043843534 8:85137477-85137499 CCAAAATCGTGGAAAATTGGAGG + Exonic
1046196543 8:110871338-110871360 AGAAATCCATGGAAAATTGAAGG + Intergenic
1047239316 8:123072233-123072255 ACAAATACATTGAGAACTGATGG - Intronic
1048863224 8:138739294-138739316 CCAAATGCATTCCAAACTGAAGG + Intronic
1049881748 8:145069325-145069347 CCAAACCCATGAAAAACAGATGG - Intergenic
1050036100 9:1437731-1437753 CTGAGTTCATGGAAAACTGTGGG + Intergenic
1051405586 9:16734631-16734653 CCAAACTAACTGAAAACTGAAGG - Intronic
1051467676 9:17399041-17399063 GCAAATATATGGAAAACTAATGG - Intronic
1055599430 9:77900411-77900433 CCATTTTCATGGAAAACTGTGGG + Intronic
1056876404 9:90337189-90337211 CAAAAATCATGGAATACTTAAGG + Intergenic
1058295820 9:103305169-103305191 GTAAACTCATGGAAAACTCATGG + Intergenic
1058338086 9:103858381-103858403 ATAAATTCATGGAAAAGAGATGG - Intergenic
1059858382 9:118427896-118427918 CCATTTTCATGGATATCTGAAGG - Intergenic
1060867340 9:127010773-127010795 CCCAAGTCATGTAAAACTAAAGG - Intronic
1186524532 X:10236303-10236325 GCAAATTCATGGCAAACAGTTGG + Exonic
1187252777 X:17613911-17613933 TCAATTTCATGGGGAACTGATGG - Intronic
1188680510 X:32997841-32997863 GCAAATATATGGGAAACTGATGG - Intronic
1188808695 X:34624215-34624237 ACAAATTCAAAGCAAACTGAGGG + Intergenic
1192545298 X:72007894-72007916 CCAAAGCCAGGAAAAACTGATGG - Intergenic
1193423852 X:81316730-81316752 CCAAATACTGGGAAACCTGAAGG - Intergenic
1193538462 X:82741567-82741589 CCAAAATCATGGTATTCTGAAGG - Intergenic
1193749347 X:85323713-85323735 CCAAATTCAAGCTGAACTGAAGG - Intronic
1193936765 X:87632547-87632569 CCAAAATGATGAAAAACTTAAGG + Intronic
1194924819 X:99811455-99811477 CCAACTTCTTTGAAAACAGATGG + Intergenic
1195018859 X:100805997-100806019 CCAAAGACATGGAACACTGCAGG + Intergenic
1195325382 X:103754156-103754178 GCTTATTCTTGGAAAACTGAGGG + Intergenic
1195676292 X:107509527-107509549 AAAAATTCAGGCAAAACTGAAGG - Intergenic
1195735579 X:108009457-108009479 CCAAAGTCATTGATAAATGAAGG + Intergenic
1197320335 X:125021353-125021375 CCACATTCATAGAAAACTGCAGG - Intergenic
1200485213 Y:3760986-3761008 ACAAATGCATATAAAACTGATGG - Intergenic
1200919847 Y:8603557-8603579 CCAAATTCATGATAAATTCAAGG - Intergenic
1200920464 Y:8608531-8608553 CCAAATTCAAGGTAAATTCAAGG - Intergenic
1200980618 Y:9260346-9260368 CCAAATTCAAGGTAAATTCAAGG - Intergenic
1201567817 Y:15384934-15384956 CTAAATTCATGGAATAATCAAGG + Intergenic
1202130153 Y:21601976-21601998 CCAAATTCCTGGTAAATTCAAGG + Intergenic