ID: 1013988145

View in Genome Browser
Species Human (GRCh38)
Location 6:116221513-116221535
Sequence AAGATGAGAAACCAAATTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 493
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 451}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013988145_1013988147 -7 Left 1013988145 6:116221513-116221535 CCATGAATTTGGTTTCTCATCTT 0: 1
1: 0
2: 3
3: 38
4: 451
Right 1013988147 6:116221529-116221551 TCATCTTTGGACGATGATTGAGG No data
1013988145_1013988149 9 Left 1013988145 6:116221513-116221535 CCATGAATTTGGTTTCTCATCTT 0: 1
1: 0
2: 3
3: 38
4: 451
Right 1013988149 6:116221545-116221567 ATTGAGGGACTCTGAGTTGTAGG 0: 1
1: 0
2: 1
3: 8
4: 128
1013988145_1013988148 -6 Left 1013988145 6:116221513-116221535 CCATGAATTTGGTTTCTCATCTT 0: 1
1: 0
2: 3
3: 38
4: 451
Right 1013988148 6:116221530-116221552 CATCTTTGGACGATGATTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013988145 Original CRISPR AAGATGAGAAACCAAATTCA TGG (reversed) Intronic
900269629 1:1780510-1780532 GAGATGAGAAAACAAAACCAGGG + Intergenic
900429818 1:2596267-2596289 GAGATGACAACCCAACTTCAGGG + Intronic
900909034 1:5581256-5581278 AACATGAGGTACCAAATTCTTGG - Intergenic
903851348 1:26308305-26308327 CAGATGAGAAAACAAGCTCAGGG + Intronic
904639776 1:31916659-31916681 AAAATTAGAAACCACATTAATGG + Intronic
904846505 1:33422538-33422560 ATGATCAGAAACCAAATTTTTGG + Intronic
905152475 1:35941993-35942015 TAGATCAGGAAACAAATTCAGGG + Intronic
906764382 1:48413896-48413918 AGGATGAGAAAACACATTTATGG + Intronic
908127749 1:61048057-61048079 AAGATGAGGAAACAAAGACATGG - Intronic
909264493 1:73539202-73539224 AAAATAACAAATCAAATTCATGG - Intergenic
909291698 1:73890951-73890973 AAGAGGAGAAAGCCAATACAGGG + Intergenic
909616750 1:77618588-77618610 ATGATCAGAAAACAAATTCGAGG - Intronic
909936037 1:81551976-81551998 AAGATGAGAACAAAAACTCAGGG - Intronic
910164572 1:84311829-84311851 AATTTGAAAAACTAAATTCATGG - Intronic
910721582 1:90292644-90292666 CAGATGAGGAACCAAGCTCAGGG + Intergenic
910934614 1:92477215-92477237 AATCTGAGAAAACAAATTCTAGG + Intronic
912458655 1:109816985-109817007 CAGATGAGAAAACAAAGTCATGG + Intergenic
913540708 1:119818118-119818140 GAAATGAGAAACCAAAGTCATGG - Intergenic
914253050 1:145937664-145937686 AAGCTGACAACCCAAATACAGGG - Exonic
914884392 1:151573445-151573467 GAGATGAGAAACCAATTTAGAGG - Intronic
914945254 1:152059878-152059900 AAGAGCAGAAACCAAATCCCAGG - Intergenic
916064932 1:161128684-161128706 AGGATGAGAAACCCTATTCTAGG + Intronic
916650755 1:166832283-166832305 CAGATGAGAAATTATATTCATGG + Intergenic
917162127 1:172069475-172069497 AGGATTAGAAAACAATTTCAGGG - Intronic
918453670 1:184685430-184685452 AAACTGAGAGACCAATTTCAAGG + Intergenic
918719891 1:187839482-187839504 AAAAAGACAAAACAAATTCAAGG - Intergenic
919711154 1:200730103-200730125 CAGATGAGAAAGCTAAATCAGGG + Intergenic
920268968 1:204748857-204748879 ATGATCAGAAACCAAACCCAAGG - Intergenic
920734838 1:208523802-208523824 TAGAGGAGAAACCAGATTCATGG - Intergenic
920818907 1:209362068-209362090 CAGATGAGAATTCAGATTCAGGG + Intergenic
921429585 1:215049769-215049791 AAGATGTAAAAGCAACTTCATGG - Intronic
921647609 1:217636354-217636376 AAGAGGATTATCCAAATTCAAGG + Intronic
921654329 1:217716926-217716948 GAGATGAAAAATAAAATTCAGGG + Intronic
921869776 1:220127280-220127302 AAGATGAGAACTGAAAATCAGGG - Intronic
922017646 1:221667549-221667571 GAGACGTAAAACCAAATTCAGGG - Intergenic
922350158 1:224728684-224728706 AAATTGAGAGACCAAAGTCATGG + Intronic
922627779 1:227067148-227067170 AAGATGAGAAAGGATATTCCTGG + Intronic
923132776 1:231091939-231091961 CAGCTGAGAGACCACATTCAGGG - Intergenic
923402134 1:233625550-233625572 AAAATGATAACCCAAAATCAAGG - Intronic
923727100 1:236515910-236515932 GACAGGAGAATCCAAATTCAGGG - Intergenic
924393348 1:243588079-243588101 AAAATCACAAACCTAATTCAAGG + Intronic
924655043 1:245966782-245966804 AAGATGAGCAGGCACATTCAAGG + Intronic
1063357525 10:5414782-5414804 AAGGACAGAATCCAAATTCAAGG + Intronic
1063505654 10:6596508-6596530 AAGCAGAGAAACTAAATACATGG + Intergenic
1063679260 10:8171608-8171630 CAGATGAGAAAACAAACTCTAGG - Intergenic
1064188353 10:13183519-13183541 AAAATGAAAAGCCAGATTCACGG - Intronic
1064496258 10:15913657-15913679 AAGAAAAGAAAACAAATTAATGG - Intergenic
1064729107 10:18311148-18311170 AAGCAGATAAACCAATTTCAGGG - Intronic
1064864304 10:19861664-19861686 AAGATGAGAAAGAAATTGCAAGG - Intronic
1064893865 10:20211322-20211344 ATGATGAGAAAAAAAATACAAGG + Intronic
1065525541 10:26616442-26616464 AAGATGTTAAAACAAGTTCAGGG - Intergenic
1066349666 10:34625610-34625632 AAGATGAAAAGTCAACTTCAAGG + Intronic
1066707365 10:38195411-38195433 AATATGAGAACCAAAATTCAAGG - Intergenic
1066982333 10:42429328-42429350 AATATGAGAACCAAAATGCAAGG + Intergenic
1067372122 10:45694554-45694576 AATATGAGAACCAAAATGCAAGG - Intergenic
1067387658 10:45831600-45831622 AATATGAGAACCAAAATGCAAGG + Intronic
1067418470 10:46125670-46125692 AATATGAGAACCAAAATGCAAGG - Intergenic
1067446617 10:46353012-46353034 AATATGAGAACCAAAATGCAAGG - Intergenic
1067503823 10:46832247-46832269 AATATGAGAACCAAAATGCAAGG - Intergenic
1067590766 10:47507755-47507777 AATATGAGAACCAAAATGCAAGG + Intronic
1067637885 10:48015854-48015876 AATATGAGAACCAAAATGCAAGG + Intergenic
1067875605 10:50004491-50004513 AATATGAGAACCAAAATGCAAGG - Intronic
1068720139 10:60236179-60236201 AAGAGGAGAAAGAAAATTCTTGG + Intronic
1069815737 10:71193087-71193109 AATAGGAGAAACAAAATTCATGG - Intergenic
1070134482 10:73680278-73680300 AATATGAGAACCAAAATGCAAGG + Intronic
1070302489 10:75214226-75214248 AAAATCAGAAATCACATTCAAGG - Intronic
1070383863 10:75906096-75906118 AAGATGAGAAAACAGAGGCAGGG - Intronic
1070504186 10:77098671-77098693 TAGGTGAGAAACCAAAGTAAAGG - Intronic
1071011572 10:80946536-80946558 ATGATCAGCAACCATATTCAAGG + Intergenic
1071119951 10:82265643-82265665 AAACTGAGAAACCATTTTCATGG + Intronic
1071607242 10:87004131-87004153 AATATGAGAACCAAAATGCAAGG - Intergenic
1071732325 10:88260672-88260694 ATGAGGAGAATACAAATTCAAGG - Intergenic
1073613730 10:104971424-104971446 AAGGTGAGAAAGCAGAGTCAAGG + Intronic
1073622478 10:105063603-105063625 AACATGTAAAAGCAAATTCAGGG - Intronic
1073730011 10:106276612-106276634 CAAGTGAGAAATCAAATTCAAGG + Intergenic
1073930491 10:108568523-108568545 TAGATGTGAAACCAAAACCAAGG - Intergenic
1074118776 10:110477837-110477859 AAGTTGAGAACTCAAATACAAGG + Intergenic
1075186966 10:120271029-120271051 AAAGTGAGAAACCAACCTCATGG - Intergenic
1075202173 10:120413435-120413457 AAGATGAGAAAATAAATTTGTGG + Intergenic
1076517222 10:131053226-131053248 AATCTGAAAAACCAAATTCCTGG + Intergenic
1078376387 11:10796871-10796893 AAGATGAGACACAAGATTTAAGG - Intergenic
1078612071 11:12829530-12829552 AAGAATAAAAAACAAATTCAAGG - Intronic
1078805371 11:14695096-14695118 AAAACGAGAAAACAAATTGATGG - Intronic
1079477930 11:20850745-20850767 AAGATGTGAAATCTAATTGATGG + Intronic
1079966827 11:26990321-26990343 AAGACCAGGAACCAAATTAAAGG - Intergenic
1080555821 11:33416260-33416282 AAGGTCTGAAACCAAATCCAAGG - Intergenic
1080589882 11:33713293-33713315 AAGATAAGAAACCACTTTCAGGG - Intronic
1081086261 11:38805158-38805180 AAGTTTGAAAACCAAATTCAAGG + Intergenic
1081824408 11:46034385-46034407 AAGAAGAGAAACCTTATTTAAGG - Intronic
1082757105 11:57088245-57088267 AAGATGAGCAAGCAAAGGCACGG + Intergenic
1082797418 11:57388121-57388143 GAGATGAGGAAACAAACTCATGG + Intronic
1084061380 11:66677666-66677688 AAAATGAGAAACCCAAATCCGGG + Exonic
1086074246 11:82833372-82833394 AGGATGAGAAAGGACATTCAGGG + Intronic
1086104276 11:83132550-83132572 AAGGTAAGAAAACATATTCAAGG + Intergenic
1086252354 11:84831619-84831641 ACCATCAGAAACCTAATTCAGGG - Intronic
1087274414 11:96146320-96146342 AAAATGAGAAACCATGCTCAGGG + Intronic
1087506446 11:99030033-99030055 GAGAGAAGAAACCACATTCATGG + Intronic
1088145813 11:106675970-106675992 GAAATGAGAACCAAAATTCAAGG + Intronic
1088847948 11:113683335-113683357 CAGATGAGAGACCAAAATCCAGG + Intergenic
1090514861 11:127413563-127413585 AACATTAGAAACCAAAACCAGGG - Intergenic
1090889771 11:130913631-130913653 AAGTTGAGAAAGAAAATTCTTGG - Intronic
1091476157 12:774978-775000 AAGATGACTAACCAATTTGATGG - Intronic
1092922104 12:13241732-13241754 AAGATAAGAAAACAGATTTATGG - Intergenic
1093305477 12:17512457-17512479 AATATGAGAAAGCAAAGTCCTGG + Intergenic
1094597668 12:31880016-31880038 AAGCTGAAAAACTAAATTCCAGG - Intergenic
1095168295 12:39001909-39001931 AAGAAAAGGAACCAAATGCAAGG - Intergenic
1095584871 12:43838441-43838463 AAGGTGAAAAACCAAATATATGG - Intronic
1095904258 12:47361184-47361206 GACATGAGAAACCATATTTATGG - Intergenic
1097686713 12:62697958-62697980 TAGATGAGAAAAAAAATGCAAGG + Intronic
1098990671 12:77061973-77061995 AAGAGGAGGAAATAAATTCATGG - Intronic
1099069834 12:78032024-78032046 ATCAGGAGAGACCAAATTCAAGG + Intronic
1099247088 12:80205143-80205165 AGCATGAGAAACCAACTTTATGG + Intergenic
1099752330 12:86791853-86791875 AAGAGAAGAACCCAACTTCATGG + Intronic
1099775123 12:87116890-87116912 AAGAGGATAAAACTAATTCAGGG + Intergenic
1099966342 12:89450132-89450154 AAAATCAGAAACTAAATTCAAGG + Intronic
1100470232 12:94885450-94885472 AACCTGAGAAGCCAAATTGAAGG - Intergenic
1100790581 12:98125923-98125945 AAAATCAAAATCCAAATTCAAGG + Intergenic
1101226429 12:102692475-102692497 AAAAGGAGAAAACAAAATCAAGG - Intergenic
1101992381 12:109497523-109497545 AAGATGAAAAACTATATACATGG - Intronic
1102572601 12:113836184-113836206 GAGATGAGAAACCTGATTCTTGG + Intronic
1103172116 12:118830264-118830286 AAGCTGAGAGACCCAAGTCAAGG + Intergenic
1103250930 12:119499460-119499482 CAGATGAGAAAACAAACTAAGGG - Intronic
1105658291 13:22464578-22464600 AAAAGGAAAAACCAAATACAAGG - Intergenic
1105849931 13:24324106-24324128 AACATGACATACCAAAATCAGGG + Intergenic
1105950183 13:25223301-25223323 AGGCTGAGAAATCAAAATCAAGG + Intergenic
1107522915 13:41201220-41201242 AAGCTGAGAAATCAAGGTCAAGG - Intergenic
1108220179 13:48225520-48225542 AAGATGAGACTTCAAATTTATGG + Intergenic
1108270828 13:48757787-48757809 ATGCTGAGAAACCAAGCTCAAGG - Intergenic
1108439564 13:50436874-50436896 GAGATGAAAAACCATGTTCATGG - Intronic
1108517184 13:51214510-51214532 AAGATGAGGAAAAAATTTCAGGG + Intergenic
1108755769 13:53500238-53500260 AAGATCAGGAAGCATATTCATGG + Intergenic
1108982197 13:56529359-56529381 AAGTTGAGAAAACAATTTCTTGG + Intergenic
1109730665 13:66409197-66409219 AATATGAGAAAATAAATTCAGGG + Intronic
1109880295 13:68464848-68464870 AAGATGAAAAAACAAATTGATGG - Intergenic
1109980565 13:69900879-69900901 AAGTAGGGAAACCAAATGCAAGG - Intronic
1110026147 13:70542146-70542168 AACATTAGAAACCAAGTTCAGGG + Intergenic
1110398026 13:75054903-75054925 AAATTGAGGAACCAAAATCAAGG + Intergenic
1110428507 13:75396708-75396730 AAGATCAGAAAACAAATTTGGGG + Intronic
1110574967 13:77045173-77045195 AAGAAGATAAACCAAAATAATGG + Exonic
1111034186 13:82649269-82649291 AAGATGATCAACTGAATTCAAGG + Intergenic
1112699236 13:101986009-101986031 CAGATGAAAATCCAATTTCAAGG + Intronic
1112780283 13:102893240-102893262 GAACTGAGAAAACAAATTCAAGG - Intergenic
1113210046 13:107967408-107967430 AAAATGAGAAAGCAGATTAATGG + Intergenic
1113508852 13:110835659-110835681 AAAATGAGCAACCATATTGATGG + Intergenic
1113575335 13:111391175-111391197 AAGGTGAGAAACAAAAATCTTGG - Intergenic
1114610938 14:24039849-24039871 CAGAGGAGACACCAAATCCAGGG + Intergenic
1115195927 14:30799289-30799311 ATTAAGAGAAACCATATTCAAGG + Intergenic
1116512893 14:45768549-45768571 AATTTGAGAAACCATATGCAAGG - Intergenic
1116534056 14:46008347-46008369 AAGCTGAGTAACGAAATTAAGGG - Intergenic
1116543818 14:46136610-46136632 AAGAAGAGAAACAAAGTGCATGG + Intergenic
1117016358 14:51521812-51521834 AAGAAGAGAAACAAAATTTTAGG - Intronic
1117225446 14:53653789-53653811 AAGGTGAGAAACCCAATTCAGGG + Intergenic
1118025075 14:61760653-61760675 AGAAAGAGAAACAAAATTCAAGG + Intergenic
1118811052 14:69274085-69274107 CAGATGAGAAACCAGAGGCATGG - Intronic
1119944290 14:78675409-78675431 AAGAAGAGAAGCCAAGTGCATGG + Intronic
1120254100 14:82096382-82096404 AGGCTAAGAAACCAAATTCTAGG + Intergenic
1120792456 14:88597710-88597732 GAGATGAGAGAGCAAAATCACGG - Intronic
1122500378 14:102194146-102194168 CAGATGAGAAAACAAGTTTAGGG - Intronic
1122761507 14:104032108-104032130 AAGCAGAGAAAAAAAATTCATGG - Intronic
1123003650 14:105310786-105310808 AAAAGGAGAAACCAAATCAATGG + Exonic
1123026791 14:105428601-105428623 AAAATGAGGAACAAAGTTCAAGG - Intronic
1124895691 15:33775273-33775295 CAGATGAGAAACATAGTTCAGGG - Intronic
1125220865 15:37333434-37333456 TAAATGAGAAAAAAAATTCATGG - Intergenic
1125221624 15:37343502-37343524 AAAATGGGAAAGCATATTCATGG + Intergenic
1125439053 15:39681787-39681809 AAGCTTAGAAAAAAAATTCAGGG - Intronic
1126231553 15:46332810-46332832 AAGATGAAAAACTAAATTTCAGG + Intergenic
1126416577 15:48424049-48424071 TAAATGAAGAACCAAATTCAAGG - Intronic
1126851013 15:52796884-52796906 AAGGTGAATAACAAAATTCAAGG - Intergenic
1127517516 15:59710567-59710589 AACATTAGAGACCAGATTCAGGG - Intergenic
1128940119 15:71781300-71781322 AAAATGAAAAACTAAATACAAGG + Exonic
1129077738 15:73011623-73011645 AAGAAGAGAAACAAAGTTTAAGG + Intergenic
1129580721 15:76806693-76806715 AATAAGAGAAACCTAATTAAAGG - Intronic
1131617301 15:94029775-94029797 AACATGAGAAAAGGAATTCAGGG - Intergenic
1131835357 15:96384731-96384753 AAGATGAGAAGACCCATTCAAGG - Intergenic
1131986738 15:98050168-98050190 AAAATTATAAACCAAATTAATGG + Intergenic
1133350207 16:5096248-5096270 AAGAAGAGTCACCAAAGTCAGGG - Intronic
1133379531 16:5318458-5318480 AACATGAGAAGGCAAATTCATGG - Intergenic
1133709602 16:8388730-8388752 AACATGGGAAACAACATTCAAGG + Intergenic
1134151932 16:11811947-11811969 AAGAAGAAGAATCAAATTCAGGG + Intergenic
1134324551 16:13195134-13195156 AATATTAGAAACCAAAATCTAGG - Intronic
1134769838 16:16798464-16798486 AAGATTAGGATTCAAATTCAAGG - Intergenic
1134894843 16:17875861-17875883 GAGATTATAAACCAAAATCAAGG - Intergenic
1137357730 16:47782721-47782743 AAGGTGAGAGAACAGATTCAAGG - Intergenic
1137521249 16:49197263-49197285 CAGATGAGAAAACAAAAGCACGG + Intergenic
1138044768 16:53710102-53710124 AGGATGAGGAACCAATTTAAAGG - Intronic
1138136128 16:54524422-54524444 AAGTTGAGTATCCATATTCATGG - Intergenic
1138185444 16:54973090-54973112 AAGATGCGAAAGCATATTCCTGG + Intergenic
1138845953 16:60566467-60566489 AAGATGAGAAACCCAATTCTTGG - Intergenic
1139022445 16:62767138-62767160 AATTTCAGAATCCAAATTCAGGG - Intergenic
1139693072 16:68653662-68653684 AAGAAAAGAAAAGAAATTCAGGG - Intronic
1139854451 16:69969371-69969393 AAGCTCAGAATCCAAATTCTTGG - Intergenic
1139883431 16:70192286-70192308 AAGCTCAGAATCCAAATTCTTGG - Intergenic
1140369079 16:74403233-74403255 AAGCTCAGAATCCAAATTCTTGG + Intergenic
1140493319 16:75360192-75360214 AATATTAGAAACCAAAATCTGGG - Intronic
1141223178 16:82090657-82090679 ATGATGACAAACCAAGTTGAAGG - Intronic
1142027611 16:87822966-87822988 AAAATGAGACCCCAAAGTCAAGG - Intergenic
1143128813 17:4663121-4663143 AGGCTGAGAAACCAAAGACATGG + Intergenic
1144072623 17:11688420-11688442 AAGATGAGGAGCCAGATTCAAGG + Intronic
1144618475 17:16798698-16798720 CAGATGAGAAAATAGATTCAGGG - Intronic
1144718866 17:17453932-17453954 ATGTTGAGAAGCCACATTCAAGG - Intergenic
1144894231 17:18516995-18517017 CAGATGAGAAAATAGATTCAGGG + Intergenic
1145138000 17:20427245-20427267 CAGATGAGAAAATAGATTCAGGG - Intergenic
1146547335 17:33750282-33750304 AGGATGAGGAACCAAAGTCCAGG - Intronic
1146779790 17:35659300-35659322 AAAATGAGAAACAAAGTTCAAGG + Intronic
1147001035 17:37362351-37362373 AAGATAAGAAAGCAACTTTAAGG - Intronic
1148222945 17:45877249-45877271 AAATTCAGACACCAAATTCAGGG - Intergenic
1149159665 17:53676685-53676707 AAGAAAAGAAAACAAATTTAGGG - Intergenic
1149871145 17:60182975-60182997 CAGATGAGAAAATAGATTCAGGG + Intronic
1149979335 17:61297142-61297164 AACATGGGAAAGGAAATTCAGGG + Intronic
1150377575 17:64694607-64694629 AAGCTGAGAAAGAAAACTCAGGG + Intergenic
1150777099 17:68089884-68089906 AAGCTGAGAAAGAAAACTCAGGG - Intergenic
1151346032 17:73501879-73501901 AAGAAGTGAAAACAAATTCAGGG + Intronic
1153732700 18:8030368-8030390 ATGTTGAGAAACCAGTTTCAGGG - Intronic
1153906306 18:9664657-9664679 TATATGAGTAATCAAATTCACGG - Intergenic
1154091525 18:11368360-11368382 GAAATCAGAAACCACATTCATGG - Intergenic
1155896771 18:31339417-31339439 AAAACCAGAAACCAAATTCATGG - Intronic
1157914453 18:51651207-51651229 AAGATGAGAAAGAACATTCTAGG + Intergenic
1158904258 18:61996637-61996659 ATGATGAAAAACCACATTGATGG + Intergenic
1159434695 18:68400526-68400548 AAGATGAGAAAAGGAATTAAAGG + Intergenic
1159860167 18:73639263-73639285 AATAAGAGAAACCACATCCAAGG - Intergenic
1160506606 18:79430681-79430703 CAAATGAAAAACAAAATTCATGG - Intronic
1161432607 19:4242125-4242147 AATGGGAGAAAACAAATTCAGGG + Intergenic
1162214036 19:9117418-9117440 AACATGAGAAAACATATTTAGGG - Intergenic
1164415098 19:28040303-28040325 AAGGAGAGAAAGCAAATACAAGG - Intergenic
1164519670 19:28969054-28969076 AAGGAGAGAAAGCAAATACAAGG - Intergenic
1164892250 19:31834381-31834403 AATGTCAGAAACCAATTTCAAGG + Intergenic
1168589021 19:57617415-57617437 AAGATGAGAAAGAAAAGGCAAGG + Intronic
925035668 2:683492-683514 GAGATGAGAAGCCAAAATCAGGG + Intergenic
925254385 2:2470447-2470469 AAAATTAGAAAACAGATTCAGGG - Intergenic
925946551 2:8869345-8869367 AGGATTAGAAAACAAATTCTGGG - Intronic
926121270 2:10242385-10242407 GAAATGAGAAAACAAATTGAGGG + Intergenic
926395421 2:12436673-12436695 AAGATTAGAAACCACATTAATGG - Intergenic
926468354 2:13219998-13220020 TAGATCAGAAACCGAAGTCATGG - Intergenic
926843571 2:17108579-17108601 AAGATTAGGATACAAATTCATGG - Intergenic
927100964 2:19787466-19787488 AAGATGCCAAAGGAAATTCATGG - Intergenic
927163645 2:20294691-20294713 AAGATGAGAATCCATCCTCAAGG + Intronic
928502832 2:31915152-31915174 AAAAAGAGAAACCACACTCAAGG + Intronic
928885677 2:36145447-36145469 AAGAGAAGAAATAAAATTCATGG + Intergenic
929388035 2:41434565-41434587 CAGATCAGAAATCAAAATCAAGG + Intergenic
929437788 2:41941347-41941369 TAAATGACAATCCAAATTCAAGG + Intronic
930244226 2:48967016-48967038 ACGATGAGACAACAAATTCTTGG + Intronic
930538269 2:52671127-52671149 AAGCTGAGAAACAAAATTAAGGG - Intergenic
930998313 2:57749544-57749566 AGGATCAGAAACCAAATTCGAGG - Intergenic
932032161 2:68200554-68200576 AAGATGAGGAAACAAACCCAAGG + Intronic
932514283 2:72328767-72328789 CAGATGAGAAATGAAATCCAGGG - Intronic
933488484 2:82952856-82952878 AGGATGAGAAGCAAAATTCAAGG - Intergenic
934016949 2:87898288-87898310 AGTCTGAGAAACCAAATTCTAGG - Intergenic
936828302 2:116608460-116608482 AAAATGATAAACCGACTTCAGGG - Intergenic
937175017 2:119922034-119922056 AAGATGAGAAAAGAAAGTCAAGG + Intronic
937827118 2:126379237-126379259 AAGATGAGAGACAAAATCAAAGG + Intergenic
938143893 2:128818413-128818435 AGGATGAGAAACCAACTTTCTGG - Intergenic
938297920 2:130189966-130189988 AAAATCAGAAACCCAATTCCAGG + Intronic
938458845 2:131484702-131484724 AAAATCAGAAACCCAATTCCAGG - Intronic
939005884 2:136786018-136786040 AAAATCAGAAAACAAACTCAAGG + Intronic
939107532 2:137966617-137966639 AAGAAAAGAAACCAAAATCAAGG - Intronic
939132384 2:138252377-138252399 AAGATCACAAACAAAAGTCATGG - Intergenic
939182931 2:138825135-138825157 AAGATGTAAAACCATATTCATGG + Intergenic
939651230 2:144764995-144765017 GAGATTAGAAACCAGATACAAGG + Intergenic
940180246 2:150923877-150923899 AAGGTGAGAAAGGAAACTCAAGG + Intergenic
940597763 2:155816624-155816646 AAAATGAGAAAAATAATTCAAGG + Intergenic
941427223 2:165363285-165363307 AAAATGAGGATCCATATTCAGGG - Intronic
941473802 2:165923342-165923364 AAGAGCAGAAACCAACTTAAAGG - Intronic
942869505 2:180717836-180717858 AAGCTGAGAACCCAAACTCTGGG + Intergenic
943339331 2:186659730-186659752 AAAATGATAAACTAAATTTAGGG - Intronic
944022316 2:195121078-195121100 AAGATGTGGAAATAAATTCATGG + Intergenic
944569713 2:201031706-201031728 AAAATTAAAAACCACATTCATGG + Intronic
944933249 2:204542251-204542273 AAAATGAGCAACCAAAAGCAAGG - Intergenic
945901491 2:215542393-215542415 AAGTTGAGAAACCAACTAAAAGG + Intergenic
946779663 2:223180102-223180124 AAGAACAGACACCAAATTTATGG + Intronic
947436564 2:230078057-230078079 AAGATCAGAAACCAAACGCTGGG - Intergenic
947747053 2:232513225-232513247 AAGAGGAGAAACCAGAGACACGG - Intergenic
948777115 2:240295260-240295282 CAGATGTGAAACACAATTCAAGG - Intergenic
948790408 2:240373871-240373893 AAGATGAGGAATCAAAAACAAGG + Intergenic
1168783465 20:515187-515209 AATATGAGGAACAAAATTTATGG + Intronic
1168922351 20:1550766-1550788 CAGATGAGGAACCTAACTCAGGG - Intronic
1169740092 20:8882956-8882978 AAGACTTAAAACCAAATTCAGGG + Exonic
1169929331 20:10815622-10815644 AAGAAGAAAAGCCAATTTCATGG + Intergenic
1170258641 20:14376889-14376911 TAGATAAGAAAACAGATTCAGGG - Intronic
1174551313 20:51363644-51363666 TAAATGTGAAACCACATTCAGGG + Intergenic
1174767335 20:53266358-53266380 AAAATGAGAAAACAATTTCTGGG - Intronic
1177431880 21:20999790-20999812 AAGAGCAGAAACCAACTTCTGGG - Intronic
1177750667 21:25279713-25279735 AAGATGAGAAATGAAATTCTAGG - Intergenic
1177948481 21:27503026-27503048 AAGATGGGAAAGCATATGCACGG - Intergenic
1181844155 22:25692897-25692919 GATCTGAGAAACCAAGTTCAGGG - Intronic
1182878578 22:33713618-33713640 AAGAAGAGTAAACAAATACATGG - Intronic
1183867018 22:40712055-40712077 ATGTAGAGAAATCAAATTCAAGG + Intergenic
1185168238 22:49275415-49275437 GAGATGAGAAGCCAAATTACAGG - Intergenic
949262916 3:2123180-2123202 AAGATTAGAAATCATATGCAAGG - Intronic
949371800 3:3343316-3343338 AAAATCAGAAAAAAAATTCATGG + Intergenic
949656576 3:6227455-6227477 AAGATGGCAAACCAAAATGAGGG + Intergenic
950552077 3:13672416-13672438 AAGATCACACAGCAAATTCATGG - Intergenic
950573399 3:13816015-13816037 GTGATGAGAAACCAAATGCCTGG - Intergenic
950969054 3:17168319-17168341 AAAATGAGAGTCCAAACTCATGG + Intronic
951877552 3:27443525-27443547 GAGATGGGAAACAAAATTCCAGG - Intronic
952067711 3:29592135-29592157 AAGATGAAAAGTCAAAATCAAGG + Intronic
952389624 3:32869058-32869080 AAAATGATAAGCCAAGTTCAAGG - Intronic
953159791 3:40407772-40407794 AAGGTCAGAACCCAAATCCAAGG + Intronic
953407125 3:42665046-42665068 AAGATGAGGAAGCAAATTAGGGG - Exonic
953547187 3:43872290-43872312 AAGAGGAGCAACGAAATACAGGG - Intergenic
954083333 3:48225093-48225115 AAGATGAGAAAACAGAGTCCCGG - Intronic
954395403 3:50290787-50290809 GAGATGAAAAACCAAAGCCAAGG + Intronic
956219762 3:66889720-66889742 ATGATGAGAAACCAACATTAAGG - Intergenic
956796715 3:72724561-72724583 AAGTTTAGAAACCCAACTCAAGG - Intergenic
957148023 3:76448808-76448830 CAGATGAGAACTCAACTTCAGGG + Intronic
957368075 3:79252518-79252540 AAGCCGAAAAACCAAAATCAAGG - Intronic
957487389 3:80880727-80880749 AGGATGATAAACAAAATTTAGGG - Intergenic
957898849 3:86461933-86461955 AAGAAGAGAAAACAATTTGAAGG - Intergenic
957980677 3:87505870-87505892 AAATTGTGAAATCAAATTCAAGG - Intergenic
958076817 3:88690966-88690988 AAGATGAGAAACAAAAAAAATGG + Intergenic
958472542 3:94539059-94539081 AAGATGAGAAATCAGACACAGGG - Intergenic
958565284 3:95802409-95802431 AAGATTAGAAGCCAAATAAAAGG + Intergenic
958824915 3:99018437-99018459 CAGAAGAGAAACCAAAGTCCAGG - Intergenic
958835932 3:99145032-99145054 AAGATGAGATAGCCAATTTATGG - Intergenic
961013759 3:123451644-123451666 AAGATGAGAAAACAGACTTAGGG + Intergenic
961580021 3:127873331-127873353 ATTATGAAAACCCAAATTCAGGG + Intergenic
962455582 3:135562694-135562716 ACAATGAGAAACCTAATACAGGG + Intergenic
963245561 3:143056980-143057002 AAGATGACTATCCAAATTAAGGG + Exonic
963316501 3:143764533-143764555 AAGAAAAGATACAAAATTCAGGG - Intronic
964431425 3:156610897-156610919 AAGATGTTAACCCAAAGTCAGGG + Intergenic
965157423 3:165081873-165081895 AGAAGGAGAAAACAAATTCAGGG + Intergenic
965913472 3:173811593-173811615 AAGAAGAGAAAAGAAATGCAGGG + Intronic
966292534 3:178376805-178376827 CAGCTGAGAAAGCAAACTCAGGG + Intergenic
966402114 3:179558281-179558303 AAGATGAGATGCTAAATTCTCGG - Intergenic
966558879 3:181296202-181296224 CAGATGAGCAAACAGATTCAAGG + Intergenic
967379508 3:188841658-188841680 TAGTTAAGAAAACAAATTCAGGG - Intronic
968684566 4:1948853-1948875 AAAATGAGAAAAAAAATGCATGG - Intronic
969904105 4:10377132-10377154 AAGATGAAAACCCAAAGTGAAGG - Intergenic
970786235 4:19799898-19799920 AAAATCAGAAATGAAATTCATGG - Intergenic
970941364 4:21637803-21637825 AAGATGAGAAAACAAAATTTTGG + Intronic
971073901 4:23126210-23126232 AAAATGAACAGCCAAATTCAGGG - Intergenic
971766655 4:30840911-30840933 AATATGAGAAAGCAAACTCTTGG - Intronic
973080007 4:45979331-45979353 AAGAAAAGAAAAAAAATTCAGGG + Intergenic
973220894 4:47725136-47725158 TAAATGATAAACCAAGTTCATGG + Intronic
973231090 4:47839250-47839272 GAGATAAGAAAGCAGATTCAGGG + Intergenic
974813698 4:66979144-66979166 CAGATGAAAAGCCAAATTGAGGG + Intergenic
975168981 4:71211955-71211977 AAGATTTACAACCAAATTCACGG + Intronic
976196726 4:82539314-82539336 AAGATGAGAAGCAAAAATAAGGG + Intronic
976390900 4:84502538-84502560 AAGAATAGCCACCAAATTCAAGG + Intergenic
976717770 4:88141245-88141267 GACATGAGGAACCAAAATCACGG + Intronic
977040415 4:92009832-92009854 AAGATTATAAACCTAATTCAGGG - Intergenic
977353883 4:95920973-95920995 AACATTAGAAACCTAATTAAAGG - Intergenic
977824817 4:101518296-101518318 AAGATGATAAACCAAGAACAAGG + Intronic
978475718 4:109127679-109127701 AAGAAGAAAAACCAAACTCGAGG + Intronic
978800143 4:112748307-112748329 CAAATGAAAAATCAAATTCAGGG + Intergenic
979333548 4:119443063-119443085 AACATGATAAACCATATTGATGG - Intergenic
980726835 4:136773031-136773053 AAGATTAACAACCACATTCAAGG + Intergenic
980729038 4:136803810-136803832 GAGATAAGAAACTAAATTCTTGG + Intergenic
981724508 4:147833342-147833364 CAGGAGAGAAACCAAGTTCAGGG - Intronic
982316969 4:154041836-154041858 AGTATGAGAAAGCAAGTTCAAGG + Intergenic
982706311 4:158713678-158713700 AACTTTAGAAACCAAATTCTGGG - Intronic
982830997 4:160060174-160060196 AAGAAGAGAATCAAAATACATGG - Intergenic
983461203 4:168027647-168027669 AAGCTAAGAAAACAAATTCCTGG - Intergenic
986326824 5:6682096-6682118 AAGCCTAGAAGCCAAATTCAAGG + Intergenic
987462429 5:18228584-18228606 AAGATGAAGAATCAATTTCAGGG + Intergenic
988293598 5:29324710-29324732 AAAAAGACAAAACAAATTCATGG + Intergenic
988385035 5:30552186-30552208 AAAATTAGAAAGCAAATACAAGG + Intergenic
989087917 5:37695421-37695443 AATGTGAGAAACCAAAGGCATGG - Intronic
989654937 5:43736538-43736560 ATGATGAGAAGCCAAATAAAAGG + Intergenic
989992901 5:50789193-50789215 AAGATCATAAAACAAAATCAAGG - Intronic
990089993 5:52032051-52032073 CAGATGAGAAAACAAAAGCATGG - Intronic
990164651 5:52981310-52981332 AAGAACAGAAACCAAATTGCAGG + Intergenic
990222778 5:53611969-53611991 ATGATCAGAAAGCAAATTGAAGG - Intronic
990761423 5:59134044-59134066 AAGAAGAGAAACCATGTACAAGG - Intronic
990778482 5:59331133-59331155 AATATTATAAACTAAATTCATGG - Intronic
991466582 5:66919747-66919769 AATATTAGAGACCAAAATCAGGG - Intronic
993713191 5:91248380-91248402 AACATAAGAAACCCAATGCAAGG + Intergenic
994054201 5:95397559-95397581 GAGATGAGAAAATAAATTCCTGG + Intronic
995012982 5:107278383-107278405 ATGATAAGAAACCATATCCATGG + Intergenic
995378435 5:111504675-111504697 AAGATGAGAGAGCAGATTTATGG - Intronic
995897239 5:117028807-117028829 ATGATGAGAGACAATATTCAAGG - Intergenic
997558910 5:134827254-134827276 AAGAAAAGAAAAAAAATTCAAGG - Intronic
998792870 5:145784253-145784275 AAGAAAAGAAAAAAAATTCATGG + Intronic
999228937 5:150050144-150050166 AAGATGAGCAATCAGCTTCAGGG - Intronic
1000048697 5:157543427-157543449 ATGATGAGAAACCATAGGCACGG - Intronic
1000081506 5:157852018-157852040 AATATGTGATACCAAATTCATGG - Intronic
1000177167 5:158768217-158768239 GAGAGGAGAAACCAAATTCCAGG + Intronic
1000780920 5:165479757-165479779 AAAGTAAAAAACCAAATTCATGG - Intergenic
1001026539 5:168229180-168229202 CAGATGAGAAAACAGACTCAGGG + Intronic
1001419063 5:171573333-171573355 GAGATGAGAAAACAAAGGCATGG + Intergenic
1001939858 5:175732794-175732816 AAGAAAAGAAAACAGATTCAGGG + Intergenic
1002353974 5:178608563-178608585 AGAATAAGACACCAAATTCAGGG + Intronic
1002663698 5:180807779-180807801 AAGATGATGAAACACATTCAGGG + Intronic
1003784902 6:9474640-9474662 ATCATGATAAAGCAAATTCAAGG - Intergenic
1007570062 6:42883278-42883300 AAAATGAGAAACCAAAGTAAAGG - Intronic
1007849048 6:44786039-44786061 AAGATGAAAAACAAAATGGAGGG - Intergenic
1008255973 6:49300160-49300182 AAGATGAGACAACAAAGACATGG - Intergenic
1009346610 6:62619889-62619911 CAGATGAGGAACCAAGTTTAAGG - Intergenic
1009501835 6:64423551-64423573 ATGTTAAGAAACCAAATTCTTGG + Intronic
1010096196 6:72049117-72049139 AAGATCAGAATTCAAGTTCAGGG + Intronic
1010133415 6:72522665-72522687 AAGATGAGAAAACAATGTCGTGG + Intergenic
1010505344 6:76650902-76650924 AAGATAAAAAATCAAGTTCATGG - Intergenic
1011907959 6:92396081-92396103 AATATTAGAAACCAAAATCTAGG + Intergenic
1013988145 6:116221513-116221535 AAGATGAGAAACCAAATTCATGG - Intronic
1014005087 6:116408794-116408816 AAGATGAACACCAAAATTCAAGG - Intronic
1014069837 6:117168511-117168533 AAGATGTGTACCTAAATTCATGG - Intergenic
1014094310 6:117443483-117443505 AAGATTAGAAACCAGATTATAGG - Intronic
1014341785 6:120217826-120217848 AAGAATAGAAAGCAAATACATGG + Intergenic
1015381212 6:132571331-132571353 ATGTTCAGAAAACAAATTCATGG - Exonic
1015631291 6:135234430-135234452 AAGATGAGAAACCTGAAACAAGG + Intergenic
1016268963 6:142266129-142266151 AGGATAAGAAAACAAATTCCTGG - Intergenic
1016409065 6:143762810-143762832 ACAATGAGAAACAAAAATCAAGG - Intronic
1018208492 6:161457655-161457677 AAGGTCAGAAAGCAAAATCAAGG + Intronic
1018625394 6:165772690-165772712 TAGCTGAGAAAACAAATTTAGGG + Intronic
1019062788 6:169268442-169268464 AAGAAGAGAAAGCAAATGGATGG + Intergenic
1021963915 7:25898936-25898958 AATAGGAGAATCCAAATTCAAGG - Intergenic
1023557314 7:41436741-41436763 AAGATGAGAATCCAACCACACGG + Intergenic
1024070495 7:45780628-45780650 AACATGATAAACCATATTGATGG + Intergenic
1024591792 7:50892808-50892830 AACATGAGAAACCAAGATTAAGG + Intergenic
1024693606 7:51831301-51831323 AAGCAGAGAAACAAAATTGATGG + Intergenic
1025098909 7:56119228-56119250 AACATGATAAACCATATTGATGG - Intergenic
1025535903 7:61947698-61947720 CACATGAGAAAGCAATTTCATGG - Intergenic
1025724696 7:64045915-64045937 AAGACGAGAATCCTCATTCAGGG + Intronic
1025989809 7:66488678-66488700 AACATGATAAACCATATTAATGG - Intergenic
1026680913 7:72465993-72466015 AAGATGAGAAACAGGATCCAAGG + Intergenic
1027563772 7:79765466-79765488 AGCATGACAAACCAAATTGATGG - Intergenic
1027661782 7:80996377-80996399 AAAGTGAGAAAAAAAATTCAAGG + Intergenic
1028509274 7:91605069-91605091 AAGATGAGAAAACAAAAAGAAGG + Intergenic
1028978738 7:96943288-96943310 AAGTTGAGAAGCCACATTAATGG - Intergenic
1029180583 7:98698604-98698626 CAGATGAGAGACCAAAACCAAGG + Intergenic
1029969646 7:104776739-104776761 AAAATAGGAAACCAAATACAGGG - Intronic
1030521214 7:110600366-110600388 AAGATAAGACAATAAATTCATGG + Intergenic
1030917620 7:115336459-115336481 CAAATAAGAAACCACATTCAGGG - Intergenic
1031034357 7:116771633-116771655 AAAAAGAGAAAGCAAATTAAAGG + Exonic
1031856774 7:126932379-126932401 TAGCTGACAAACTAAATTCAAGG + Intronic
1032047900 7:128624926-128624948 AACATGACAAACCATATTGATGG + Intergenic
1033023724 7:137753187-137753209 AAGATGAGAAAGGAAAAGCAAGG + Intronic
1033413442 7:141141278-141141300 AAGATGAAAAAAAAAATTGATGG - Intronic
1033435110 7:141326300-141326322 AATAAAAGAAACAAAATTCATGG + Intronic
1033593145 7:142831465-142831487 AAGAAGGAAAATCAAATTCAAGG + Intergenic
1034220106 7:149437532-149437554 AAGTTTAGAAACAAATTTCAGGG - Intronic
1034915844 7:155038205-155038227 AAAATTAGAAAACAAATGCAGGG - Intergenic
1035289258 7:157827259-157827281 AAGATGAAAACCCAAATGCAGGG - Intronic
1035838891 8:2788851-2788873 AAGACGAGGAACCAGACTCAAGG + Intergenic
1036455796 8:8906003-8906025 AAGAAGAGAAACCAATTCAAAGG - Intergenic
1038207441 8:25480243-25480265 AAGATGAGGAAAAAAATTTACGG - Intronic
1038301427 8:26353785-26353807 AAGATGAGAAAGCAAATTTAAGG + Intronic
1038577173 8:28715280-28715302 ACGATGACCAACTAAATTCATGG - Intronic
1038586871 8:28797657-28797679 AAAATAAGAAACCAAAATGAGGG + Intronic
1038723737 8:30060718-30060740 AAGAAGAGAAACCAAATTTGTGG + Intergenic
1038892230 8:31738637-31738659 AACAACAGAAACCAAAATCAAGG + Intronic
1038954551 8:32453127-32453149 AACTTGGGAAACCAAAGTCACGG - Intronic
1039276879 8:35942481-35942503 AAAATGATAAACCAATTTTAAGG + Intergenic
1040740875 8:50573273-50573295 AAGTTAATAAACAAAATTCAGGG + Intronic
1040998744 8:53428378-53428400 AAGAGGAGAAACCAGATGCATGG + Intergenic
1041399126 8:57422583-57422605 AAAATGACAAAGCAAATGCAGGG + Intergenic
1041498816 8:58517485-58517507 AAGTTGAGAAGCCAAATTCTAGG - Intergenic
1042488192 8:69369629-69369651 AAGATGTGAAACCAATCTGAAGG - Intergenic
1043380245 8:79694900-79694922 AGGATGAGAAACTAAATTCCTGG + Intergenic
1045482498 8:102603321-102603343 GAGAAGAGAAGGCAAATTCAGGG - Intergenic
1045702704 8:104885074-104885096 AAGTGGAGAAACCATATGCAGGG - Intronic
1046159053 8:110335072-110335094 AAGCTGAAAATCCAAAATCAAGG + Intergenic
1048443970 8:134479526-134479548 GAGATGAGAAACAAAAGACATGG + Intronic
1049028841 8:140017491-140017513 AAGATGCAAAACTAATTTCATGG - Intronic
1051397678 9:16643319-16643341 AAAATGAGGTACCAAATTCTGGG + Intronic
1052196156 9:25717247-25717269 ATGAGGAGACACCAAATTTAGGG + Intergenic
1052925341 9:34010894-34010916 TAGAAGATAAACCAAAGTCAGGG + Intronic
1054788193 9:69229809-69229831 AAGATGAGAAAGCAAATAAAGGG - Intronic
1054945218 9:70788707-70788729 TAGATGAGAAAGCAAGCTCAGGG - Intronic
1056556224 9:87690866-87690888 AAGATGATACACCACAATCAGGG - Intronic
1058379282 9:104361024-104361046 AAGGTGAGAAAGAAAATTCAAGG - Intergenic
1058487166 9:105453131-105453153 AACAAGAGAGACCAAATTCCAGG - Intronic
1059759604 9:117325511-117325533 AAAAGGAGATTCCAAATTCAGGG - Intronic
1059794821 9:117682546-117682568 GAGGTAAAAAACCAAATTCAGGG - Intergenic
1059843969 9:118250459-118250481 TAAATCAGAAACCAATTTCATGG - Intergenic
1061284105 9:129612575-129612597 AAGATGAGGAAACAAATGCAAGG + Intronic
1062210477 9:135360923-135360945 AAGCTCAGAAAGAAAATTCAGGG + Intergenic
1186281899 X:8002266-8002288 AAGATGAGAAATCAGACTGAAGG - Intergenic
1186435704 X:9541516-9541538 GAGATGAGAAACAAAAAACAGGG + Intronic
1187148731 X:16662084-16662106 GAGATCTGAAGCCAAATTCAAGG + Intronic
1187735390 X:22297991-22298013 ATGAAGAGAAAGCAGATTCAGGG + Intergenic
1188820046 X:34764161-34764183 AAGATGAGAGATGAAACTCAAGG - Intergenic
1188940020 X:36225930-36225952 AAGAGAAGAAACCAATTCCAGGG + Intergenic
1188948344 X:36336404-36336426 AGGAGGTGAAACCAAATGCAAGG - Intronic
1189355020 X:40304123-40304145 AATATCAGAAACCAGATACATGG - Intergenic
1189859352 X:45257302-45257324 AAGTTGAAAAACGCAATTCAAGG + Intergenic
1191879104 X:65826870-65826892 AAGATGAGAAGCCAGATTTATGG - Intergenic
1192040658 X:67617704-67617726 AAGATGAGAAAATAGAGTCAGGG + Intronic
1192332644 X:70190159-70190181 AAGATGAAAAAGCAATTCCATGG + Intronic
1192461806 X:71323451-71323473 AAGATGAGACTCCAGATTAACGG + Intergenic
1193677585 X:84475169-84475191 AATATGAGAAAAAATATTCAGGG - Intronic
1194010225 X:88552991-88553013 AAAATGTGAAACCCAATCCAAGG - Intergenic
1194344063 X:92740838-92740860 AAGATGAGTATCCAAATAGAGGG - Intergenic
1194610016 X:96031833-96031855 AAGATGAGCAAACTAACTCATGG + Intergenic
1195262313 X:103144624-103144646 AAGATGAAAGTCCAAAATCAGGG - Intergenic
1196998615 X:121413067-121413089 AAAATGAGAAACCAATACCAAGG - Intergenic
1197451409 X:126623243-126623265 AAGAAAAGAAAAGAAATTCAGGG - Intergenic
1198921409 X:141732440-141732462 AGGAGGAGAAACCAGATCCATGG + Intergenic
1199127534 X:144140257-144140279 AGTCTGAGAAACCAAATTCTAGG + Intergenic
1199976195 X:152896265-152896287 AAGATGCCAAGCCAAATCCATGG + Intergenic
1200652410 Y:5857494-5857516 AAGATGAGTATCCAAATAGAGGG - Intergenic
1200975030 Y:9201388-9201410 AAGATGAGAAACAAAATGTGAGG - Intergenic
1201423432 Y:13824109-13824131 AATATAAGAAACCCATTTCATGG - Intergenic
1202136122 Y:21664956-21664978 AAGATGAGAAACAAAATGTGAGG + Intergenic