ID: 1013988147

View in Genome Browser
Species Human (GRCh38)
Location 6:116221529-116221551
Sequence TCATCTTTGGACGATGATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013988145_1013988147 -7 Left 1013988145 6:116221513-116221535 CCATGAATTTGGTTTCTCATCTT 0: 1
1: 0
2: 3
3: 38
4: 451
Right 1013988147 6:116221529-116221551 TCATCTTTGGACGATGATTGAGG No data
1013988143_1013988147 4 Left 1013988143 6:116221502-116221524 CCTTCAGTTTTCCATGAATTTGG 0: 1
1: 0
2: 1
3: 24
4: 240
Right 1013988147 6:116221529-116221551 TCATCTTTGGACGATGATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013988147 Original CRISPR TCATCTTTGGACGATGATTG AGG Intronic
No off target data available for this crispr