ID: 1013992035

View in Genome Browser
Species Human (GRCh38)
Location 6:116265136-116265158
Sequence CTGCATTTCCTCTGCCACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 438
Summary {0: 1, 1: 7, 2: 22, 3: 63, 4: 345}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013992035_1013992044 5 Left 1013992035 6:116265136-116265158 CCACAGTGGCAGAGGAAATGCAG 0: 1
1: 7
2: 22
3: 63
4: 345
Right 1013992044 6:116265164-116265186 GGGGTGGGGAGTGGAAGGAGTGG 0: 1
1: 1
2: 46
3: 534
4: 4215
1013992035_1013992040 -10 Left 1013992035 6:116265136-116265158 CCACAGTGGCAGAGGAAATGCAG 0: 1
1: 7
2: 22
3: 63
4: 345
Right 1013992040 6:116265149-116265171 GGAAATGCAGCTGCAGGGGTGGG No data
1013992035_1013992042 -4 Left 1013992035 6:116265136-116265158 CCACAGTGGCAGAGGAAATGCAG 0: 1
1: 7
2: 22
3: 63
4: 345
Right 1013992042 6:116265155-116265177 GCAGCTGCAGGGGTGGGGAGTGG 0: 1
1: 0
2: 23
3: 229
4: 1509
1013992035_1013992041 -9 Left 1013992035 6:116265136-116265158 CCACAGTGGCAGAGGAAATGCAG 0: 1
1: 7
2: 22
3: 63
4: 345
Right 1013992041 6:116265150-116265172 GAAATGCAGCTGCAGGGGTGGGG No data
1013992035_1013992043 0 Left 1013992035 6:116265136-116265158 CCACAGTGGCAGAGGAAATGCAG 0: 1
1: 7
2: 22
3: 63
4: 345
Right 1013992043 6:116265159-116265181 CTGCAGGGGTGGGGAGTGGAAGG No data
1013992035_1013992045 15 Left 1013992035 6:116265136-116265158 CCACAGTGGCAGAGGAAATGCAG 0: 1
1: 7
2: 22
3: 63
4: 345
Right 1013992045 6:116265174-116265196 GTGGAAGGAGTGGCCCCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013992035 Original CRISPR CTGCATTTCCTCTGCCACTG TGG (reversed) Intronic
900650891 1:3729656-3729678 TTGCTATGCCTCTGCCACTGAGG + Intronic
901171249 1:7259187-7259209 CTGCTTTCCCTCTTCCACTCCGG - Intronic
902447389 1:16475978-16476000 CTGCTCTTCCCGTGCCACTGTGG + Intergenic
903476480 1:23622754-23622776 CTTCCTTTCCTCTGCCACAGTGG + Intronic
903645846 1:24896111-24896133 TGGCATTTCATGTGCCACTGGGG - Intergenic
904212244 1:28893651-28893673 CTGCCCTCCCTCTGCCTCTGGGG - Intronic
904919766 1:33997936-33997958 GGGCATCTCCTCTGCCCCTGAGG + Intronic
905326596 1:37156815-37156837 CTGCTTTTCCCCTGCCACAGTGG - Intergenic
905849653 1:41264151-41264173 CTGACTTTCCACTGGCACTGTGG + Intergenic
906096059 1:43224787-43224809 CTCCATCTCCCCTGCCACTACGG + Intronic
907161494 1:52373512-52373534 CTGCATTTTGTGTACCACTGGGG - Intronic
907273481 1:53304322-53304344 CTGCCTTTCCTCCCCCACTTTGG - Intronic
907328453 1:53656117-53656139 CCTCTTTTCCTCTTCCACTGGGG - Intronic
908486466 1:64599042-64599064 CTGCCTTACCCCTGTCACTGAGG + Intronic
908669299 1:66528871-66528893 CCACATTTCCTCTGCCTCGGTGG + Intergenic
908818453 1:68057783-68057805 CTGCATTGCCTCCACCACTATGG + Intergenic
909485630 1:76170289-76170311 CTGCATTGTTTCTGCCACTGTGG - Intronic
910011676 1:82471582-82471604 CTGCATTTTGTCAGCCACTCTGG - Intergenic
911302259 1:96189427-96189449 CAGCATCTCCTCAGACACTGAGG + Intergenic
912139523 1:106705468-106705490 ATACATTTTCTCTGTCACTGAGG + Intergenic
912171509 1:107106122-107106144 CTGAATTTCCACTGTCCCTGAGG - Intergenic
913349646 1:117843055-117843077 CTGCATTACCTCTATCACTGTGG + Intergenic
915051975 1:153084596-153084618 CCACATTGCCTCTACCACTGTGG + Intergenic
915098932 1:153484725-153484747 CTGCATTCCTTCTCCCACTCAGG + Intergenic
915237528 1:154495542-154495564 CTCAGTTTCCTCTGCCCCTGAGG + Intronic
915633131 1:157167375-157167397 CTCCAATTACTGTGCCACTGAGG - Intergenic
916397975 1:164412744-164412766 CTGCAATAGCTCTGCCACTGAGG - Intergenic
917567768 1:176230233-176230255 CTGCATTGCCTCTCCCACTGTGG + Intergenic
918184027 1:182111533-182111555 CCAGATTTCCTCTGCCTCTGGGG - Intergenic
918500701 1:185192540-185192562 GTGCATTTCCTCAGCTACTCAGG - Intronic
918573088 1:186021905-186021927 TTCCATTTCCACAGCCACTGTGG - Intronic
919568418 1:199218254-199218276 CTCCATTTCCTCTGCCACTGTGG - Intergenic
919578194 1:199337519-199337541 CTGCCTTACCTCTACCACTGTGG + Intergenic
920787149 1:209052050-209052072 CTTCCTTTCCTCTGCCACTGTGG + Intergenic
920852602 1:209638632-209638654 CAGCATTTCATCTGCCACTGTGG + Exonic
920883327 1:209900300-209900322 CTGCATTTTAGCTGCTACTGTGG - Intergenic
921367992 1:214392906-214392928 CTGCTTTTCCACTCCCACAGTGG - Intronic
921800270 1:219395007-219395029 CTTCATCTACTCTACCACTGAGG + Intergenic
922512726 1:226183142-226183164 TTACATTTTCTCTTCCACTGTGG - Intronic
922749443 1:228063722-228063744 CTGCAATGCCCCTGGCACTGGGG - Intergenic
1064098708 10:12444349-12444371 CTGCGTTTCCTTGGCCTCTGAGG + Intronic
1066538468 10:36417722-36417744 CAGAATTTCCTCTTCCTCTGGGG - Intergenic
1066645525 10:37603907-37603929 CAGAATTTCCTCTTCCTCTGGGG - Intergenic
1068529149 10:58165032-58165054 CTGCATTTCCTGTGCTCCAGAGG + Intergenic
1068942370 10:62692255-62692277 CAGCATTGCTTCTGTCACTGAGG - Intergenic
1069012402 10:63388547-63388569 TTGTATTTGCTCTACCACTGGGG - Intronic
1069204994 10:65670354-65670376 CTGGATTTCCTCTTTCACTGCGG - Intergenic
1069334045 10:67327795-67327817 CTGCGTTGACTTTGCCACTGTGG - Intronic
1069649454 10:70034379-70034401 CTGCATTTCGGCAGCCACTGTGG + Intergenic
1069805916 10:71125035-71125057 CTGCATTGCCTCCACCACTGTGG - Intergenic
1069934565 10:71906305-71906327 CAGCATTTCCACTGTCCCTGTGG + Intergenic
1070422812 10:76253986-76254008 CTGCCTTTCCTCTGTCATTTGGG + Intronic
1071454757 10:85837344-85837366 CTGCCTTGCCTCTGCCACTATGG + Intronic
1071694838 10:87860969-87860991 TTCCATTTCCTTTTCCACTGTGG + Exonic
1071736261 10:88303889-88303911 CTGCATTACCTCCACCAATGTGG + Intronic
1072253445 10:93600036-93600058 CTGCATTTCCTCCGTCTCTTTGG - Intronic
1073390922 10:103175883-103175905 CTGCATTTCCTCTGGCTGAGAGG - Intronic
1074206818 10:111289964-111289986 CTGCATTGCCTTTGCCCCTAAGG - Intergenic
1074445556 10:113518549-113518571 CAGAATTCCCTCTGCCCCTGGGG - Intergenic
1078069930 11:8101774-8101796 CTCCTTTGCCTCTGCTACTGAGG + Exonic
1078417463 11:11177643-11177665 CTGCACTCCTGCTGCCACTGAGG + Intergenic
1080225054 11:29950613-29950635 CTGCATTGCCTCCACAACTGTGG + Intergenic
1081026395 11:38019798-38019820 CTGCATTGCCTCTGCCACTGTGG + Intergenic
1085231323 11:74973592-74973614 CGGCATTTCTTCTGCCCCAGTGG + Intronic
1085306877 11:75491352-75491374 TTATATTTCCTCTGCCACTTAGG - Intronic
1085737601 11:79052739-79052761 CAGCACTTCAGCTGCCACTGTGG + Intronic
1085856388 11:80181118-80181140 CTGTGTTGTCTCTGCCACTGTGG - Intergenic
1086549695 11:88041811-88041833 CTGACTTCCCTCTGCGACTGTGG + Intergenic
1086728747 11:90222658-90222680 CTGACTGTCCTCTGCCACTGCGG - Intronic
1087597689 11:100273689-100273711 CTGCATTGCCTCCGCCACTGTGG + Intronic
1087700758 11:101433905-101433927 ATGCATTTTCTTTACCACTGAGG + Intergenic
1088806478 11:113357985-113358007 CTGCGTTGCCTCTGCCATTGTGG - Intronic
1089146435 11:116332656-116332678 CTGCTTTTCCTCTCCCACTGGGG + Intergenic
1090162453 11:124510140-124510162 CTATGTTGCCTCTGCCACTGTGG - Intergenic
1090241853 11:125189203-125189225 CTGAGTTTCCTCTGCCAGTCTGG + Intronic
1090523537 11:127504544-127504566 CTTTATCTCCTCTGGCACTGTGG - Intergenic
1090684564 11:129100850-129100872 CTGCATTGCCCCTGCCACTGTGG + Intronic
1090972204 11:131653544-131653566 CTGCCTCTCCCCTGCCACAGTGG + Intronic
1091010278 11:131994983-131995005 GTGCATTTATGCTGCCACTGTGG + Intronic
1091529251 12:1339124-1339146 CTGAGCTGCCTCTGCCACTGCGG - Intronic
1092100561 12:5880527-5880549 CTGAATCTCCTCTGCCTCTATGG - Intronic
1092185708 12:6476961-6476983 CTTTATTTCCTGTGCCACAGTGG + Intergenic
1094159809 12:27378655-27378677 CTGCATTTCCACTGCCCAAGAGG - Intronic
1095334117 12:41006366-41006388 CTGTGTTGCCTCTGCCACTGTGG - Intronic
1095889838 12:47225333-47225355 CTGCATTGCTTCTTCCACTTTGG + Intronic
1096406366 12:51346973-51346995 CTGCATTTATGGTGCCACTGAGG - Intergenic
1096739011 12:53677918-53677940 GTGGACTTTCTCTGCCACTGAGG - Intergenic
1097080863 12:56429862-56429884 CTCCCTTTCCTCTCCCTCTGAGG + Intronic
1097455597 12:59795696-59795718 CTGCTTTTCCTTTCCCTCTGTGG - Intergenic
1098792896 12:74848361-74848383 CAGCATTTCCTCTGTGACTAAGG + Intergenic
1099622857 12:85026207-85026229 CTGCATTTCCTTTGCCTATATGG + Intronic
1099629117 12:85117306-85117328 TTGCATTTGCACTACCACTGTGG + Intronic
1101309906 12:103567599-103567621 CTGCTTTTCCTCTGTCCCAGAGG - Intergenic
1101696843 12:107134890-107134912 TTGGGTCTCCTCTGCCACTGGGG + Intergenic
1101825780 12:108218943-108218965 ATGCATTTCCCCTTGCACTGGGG + Intronic
1102146160 12:110656484-110656506 CTGCATCTCCACTGCCATTATGG - Intronic
1102420365 12:112798682-112798704 GTGTTTTTCCTCTGTCACTGTGG + Intronic
1102863908 12:116359378-116359400 CTGCATTTCCTGTGTTACGGGGG + Intergenic
1102935871 12:116896647-116896669 CTGCACTTCCTTGGCCACAGAGG + Intergenic
1105809212 13:23979759-23979781 CTTCATTTCCTCGGCCAGGGCGG - Exonic
1105932197 13:25063009-25063031 CTGCTTGACCTCAGCCACTGAGG - Intergenic
1106841541 13:33689914-33689936 CAGCACTTCCTGAGCCACTGAGG - Intergenic
1107548629 13:41456166-41456188 CTGCATGCCCTCAGCCACTGTGG - Intergenic
1107568710 13:41633395-41633417 CTGCATGGCCATTGCCACTGCGG + Intronic
1109330115 13:60918719-60918741 CTGCAGTGTCTCTGCCTCTGTGG + Intergenic
1111526326 13:89476143-89476165 CTGTGTTGCCTGTGCCACTGTGG - Intergenic
1112837707 13:103536110-103536132 CAGCATTTCCTGTGGCACTGGGG - Intergenic
1112990747 13:105510779-105510801 CTGCATTTTTTCTGCAAATGAGG - Intergenic
1113604986 13:111598629-111598651 CTGCATGTCCTTTGCCACCAGGG - Intronic
1114534374 14:23413621-23413643 CTGCATTACCTTGGCCTCTGGGG + Intronic
1114750144 14:25194959-25194981 CTGCATTTTCTGTGACACTCAGG + Intergenic
1115784469 14:36808596-36808618 CTGTATTTGATCTTCCACTGAGG - Intronic
1115883519 14:37946159-37946181 CTATGTTGCCTCTGCCACTGTGG + Intronic
1117237167 14:53790358-53790380 CTGCCTTTCCTCTGCCTTTAGGG + Intergenic
1118383997 14:65240083-65240105 CTGCACTTGTTCTTCCACTGTGG + Intergenic
1118448747 14:65877364-65877386 CTGCATTGCCTCCGCCACTGTGG - Intergenic
1120812883 14:88822883-88822905 CTTCACCTCCTCTGACACTGTGG - Intergenic
1120858896 14:89236544-89236566 CAGCACCTCCTCTACCACTGAGG + Intronic
1122143080 14:99673987-99674009 CTGCCTCACCTCTCCCACTGTGG - Intronic
1122502539 14:102210872-102210894 CTGCACTTCCGCTTCCTCTGCGG - Intronic
1122859617 14:104576700-104576722 CTGCATTTTCACTGCCCCAGAGG + Intronic
1123131881 14:105994001-105994023 ACGCAATGCCTCTGCCACTGTGG - Intergenic
1123143787 14:106108571-106108593 CAGCCTTTTCTCTGCAACTGAGG - Intergenic
1123582115 15:21725131-21725153 ATGCAGTGCCTCTGCCACTGTGG - Intergenic
1123618765 15:22167727-22167749 ATGCAGTGCCTCTGCCACTGTGG - Intergenic
1125085483 15:35724753-35724775 CTGCATCTTCTCTGCCAGAGTGG + Intergenic
1125099049 15:35889185-35889207 CTCCATTTCCTCTGCCAGCAAGG + Intergenic
1126225033 15:46261097-46261119 CTGCCTTGCCTCAGCCAGTGTGG - Intergenic
1126956125 15:53935659-53935681 CTGCTTTTCCTCACCCTCTGTGG - Intergenic
1127188791 15:56507480-56507502 CTACCTTGCCTCTGCCACTGTGG + Intergenic
1127626745 15:60787396-60787418 CAACATTTCCCCTGCAACTGCGG + Intronic
1128457054 15:67836961-67836983 CTCCATTTCCTCTGCAAATCAGG + Intergenic
1128585289 15:68844032-68844054 CTTCATCTCCGCTGCCACCGTGG - Intronic
1128801329 15:70498953-70498975 CTGAATGTCCTCTCCCAGTGGGG + Intergenic
1128830381 15:70763220-70763242 CTGCTTTTCCTCTGCCAGTTCGG - Intronic
1129120724 15:73394815-73394837 TTGCCTTTCCTCTGACCCTGAGG - Intergenic
1129444698 15:75608756-75608778 CTGCATTTATTCTGCAACTGGGG + Intronic
1130234936 15:82124962-82124984 CTTCAGTACCTCTGCCACCGTGG - Intergenic
1130424060 15:83777197-83777219 CTGCACTGCCTCTGCCATTGTGG + Intronic
1130542275 15:84828889-84828911 CTGCATCTCCTGTGTTACTGTGG + Intronic
1131350363 15:91694075-91694097 TTCCATTTCCTCTCTCACTGGGG - Intergenic
1133089077 16:3389615-3389637 GTTAATCTCCTCTGCCACTGGGG + Intronic
1134244818 16:12531995-12532017 CTGCCTCTCCTCTGTCGCTGTGG - Intronic
1135251261 16:20902128-20902150 CTCCATTTCCACTGTGACTGAGG - Intronic
1137301905 16:47157392-47157414 CTGTATCTCCTGTGGCACTGTGG - Intronic
1137619364 16:49866538-49866560 CTGAATTTCCTCTGCTCCTCAGG - Intergenic
1138531412 16:57636328-57636350 ATGCCTTTCCTATGCCACTGGGG - Intronic
1139074805 16:63431390-63431412 GTGCATGACCTCTGCAACTGTGG - Intergenic
1139404108 16:66704785-66704807 CTTCATTTCATCTCTCACTGAGG + Intergenic
1140875352 16:79146551-79146573 CTTCATTTCCTCTCCCACACAGG + Intronic
1141196062 16:81862187-81862209 CAGTCTTTCCTCTGCCTCTGTGG - Intronic
1142397958 16:89843406-89843428 CTGCATTTCCACTCGGACTGTGG + Intronic
1142488259 17:260656-260678 CTGCCTCTCCTCTGCCAGAGAGG - Intronic
1142970297 17:3606756-3606778 ATGCATTCACTCTGCCTCTGAGG - Intergenic
1143653134 17:8276726-8276748 CGCCATTTCCACTGCCACTACGG - Intergenic
1143907840 17:10223749-10223771 CCAAACTTCCTCTGCCACTGTGG - Intergenic
1144851596 17:18246720-18246742 CTGCTTCTCCTCTGCCTCAGCGG + Exonic
1148557958 17:48589842-48589864 CTAAATTTCCGCTGGCACTGAGG + Intronic
1149257090 17:54838437-54838459 CTGTACTTCCTCTACCACAGGGG - Intergenic
1149518560 17:57300549-57300571 CAGCATTTCCTTTGACAATGAGG - Intronic
1150578689 17:66453065-66453087 TTCCATTTCCTAAGCCACTGTGG - Intronic
1150874752 17:68957699-68957721 CTGCATTTCTTCTCCCCATGTGG - Intergenic
1152038244 17:77886671-77886693 AGGCTCTTCCTCTGCCACTGTGG + Intergenic
1152323538 17:79622662-79622684 CTACATTCCCTCTTCCACTGAGG + Intergenic
1152446068 17:80344930-80344952 CAGCATTTCCTGTTTCACTGCGG + Exonic
1153094363 18:1383676-1383698 CTGCATTGCCTCCGCCAGTGTGG + Intergenic
1154019253 18:10648150-10648172 CTGTGTTGCCTCTGCCACTGTGG + Intergenic
1154060039 18:11051175-11051197 TTCCCTTTCATCTGCCACTGTGG + Intronic
1154184963 18:12175074-12175096 CTGTGTTGCCTCTGCCACTGTGG - Intergenic
1155281832 18:24248094-24248116 CTGCATTTCTCCTGCAACTAAGG - Intronic
1155318694 18:24597122-24597144 CAGCATATCTTCTGCCACTGTGG + Intergenic
1155402526 18:25454677-25454699 CTGTATTTCAAATGCCACTGGGG + Intergenic
1156076331 18:33283030-33283052 CTGCATTGCCTCTGCCACTGTGG + Intronic
1156807724 18:41206507-41206529 CTGCATTTCAGGTGCCAGTGTGG + Intergenic
1156896837 18:42256184-42256206 CTGCATTGCCTCTGTCACTGTGG - Intergenic
1157452812 18:47800967-47800989 CTGCATGCCCTCCTCCACTGTGG + Intergenic
1157703576 18:49781392-49781414 CTGCTTTTCCACTGCCTCTCAGG - Intergenic
1158109573 18:53926257-53926279 TTGCTTTTCCTCTGTCAGTGAGG - Intergenic
1158127431 18:54116939-54116961 CTGCATTACTCCTGCCTCTGTGG + Intergenic
1158579297 18:58667694-58667716 TTGCATTCCCTCCTCCACTGTGG + Intergenic
1159367357 18:67485735-67485757 CTGCATTTACTCTGCCTGTCAGG - Intergenic
1160233158 18:77064328-77064350 CTCTTCTTCCTCTGCCACTGAGG + Intronic
1161043643 19:2123112-2123134 CTGCATCTCCCCTGGGACTGGGG + Intronic
1161455192 19:4366434-4366456 CTGCCTTCCCTCTGACACAGAGG + Intronic
1161568447 19:5016628-5016650 CTGCATTTCGGGTGACACTGGGG + Intronic
1161819720 19:6522387-6522409 CTGGTTTTCCTCACCCACTGGGG - Intergenic
1162581037 19:11530471-11530493 CTGCAGTCCCTCAGCCTCTGTGG + Intergenic
1164628304 19:29744142-29744164 TCCCATTTCCTCTGCCACTGTGG - Intergenic
1164832240 19:31331664-31331686 CTGCATTCACTGTGTCACTGCGG + Intronic
1165068428 19:33241793-33241815 CAGGATTTCCTCTTGCACTGTGG - Intergenic
1165215622 19:34270140-34270162 CCTCATTTCCTGTGCAACTGCGG - Intronic
1166262755 19:41652709-41652731 CAGCACATCCTCAGCCACTGAGG + Intronic
1167260609 19:48455744-48455766 CAGCATTCCCCCTGGCACTGCGG + Exonic
1167950153 19:53019847-53019869 CTGCATTGTCTCTGCCACTGTGG + Intergenic
925359144 2:3265326-3265348 TTCCATTTCATCTGCCTCTGAGG - Intronic
925395937 2:3533786-3533808 CTGCATTGTCTCTGCCTCTTGGG - Intronic
925899795 2:8500591-8500613 CTTCTTTTCCTCTACAACTGAGG + Intergenic
926659605 2:15449646-15449668 TTGCATGTCTTCTGGCACTGTGG - Intronic
928360482 2:30658573-30658595 TTGCATTTCTCCAGCCACTGGGG - Intergenic
929265403 2:39913353-39913375 ATGCATTTCCATTGCCATTGAGG - Intergenic
930025227 2:47025459-47025481 CTGCATTTCTCCTGCCTCTGGGG + Intronic
930869126 2:56152011-56152033 CTGGCTTTCCTCTGCCAGTGAGG - Intergenic
931091985 2:58896150-58896172 CTGCAATTCATCTGCCAGGGTGG + Intergenic
931489110 2:62725383-62725405 ATGGGTTGCCTCTGCCACTGAGG - Intronic
932539750 2:72639441-72639463 CTGCATTGCCTCTGCCACTGTGG + Intronic
933321169 2:80777348-80777370 GTGTATCTCCTCTGGCACTGAGG + Intergenic
935187920 2:100751144-100751166 TTGCATCTCCCCTGCCACAGAGG - Intergenic
935888434 2:107649223-107649245 CTGCCTTACCTCCACCACTGTGG + Intergenic
936029474 2:109059654-109059676 CTGCCTCTCCTCTGGCACTGTGG + Intergenic
938133529 2:128736270-128736292 CTGCCTTTTCTCTGTCCCTGGGG + Intergenic
945791384 2:214309848-214309870 CTGCCTTGCCTCTACCACTGTGG - Intronic
945945163 2:215988512-215988534 CTGGTGTTCCACTGCCACTGGGG - Intronic
946475317 2:220001122-220001144 CTGCATTTTCACTGCCTCTGAGG + Intergenic
946959697 2:224971075-224971097 CTGGATTTCATCTTCCAGTGAGG + Intronic
947047538 2:226005278-226005300 CTGGAGTACCTCTGCCTCTGTGG + Intergenic
947784271 2:232801140-232801162 CTGTCTTTCCTCTGCCACCTTGG + Intronic
947877922 2:233480165-233480187 CTGCATGCCCTCTGCCACTGGGG - Intronic
948276094 2:236709870-236709892 CTGCACCTCCTCAGCCTCTGGGG - Intergenic
948767316 2:240229698-240229720 ATGCATTTCCTCTGCTCCAGTGG - Intergenic
948778627 2:240303394-240303416 CTCCCTTCCCTCTCCCACTGTGG + Intergenic
1168782706 20:507490-507512 TTGCATTTCCTGTCCCAATGTGG - Intronic
1169123450 20:3110934-3110956 CTGCAGTGCACCTGCCACTGGGG + Intronic
1169475644 20:5928894-5928916 CTGCATTTCATCTTCCACCCTGG + Intergenic
1173060334 20:39654293-39654315 TGGCATTTCCTCTGCCACAGGGG - Intergenic
1173538532 20:43833806-43833828 CTGAATTTCCCCTGCTCCTGAGG - Intergenic
1173949822 20:46982254-46982276 TGGAATTTCATCTGCCACTGTGG - Intronic
1177043813 21:16145651-16145673 CTGCACTGCCTTTGCCACCGTGG - Intergenic
1177693499 21:24540859-24540881 CTGCAGTGGCTCTGCCCCTGTGG + Intergenic
1179560552 21:42213462-42213484 CTGCAGTGGCTCTGCCCCTGTGG - Intronic
1179928105 21:44549762-44549784 CTGCACTTCCTCTGCCATTGGGG + Intronic
1179938063 21:44617428-44617450 CTGGACTTCCTCTGCCATTGGGG - Intronic
1180192717 21:46173762-46173784 CTGCTTTGCCTCCACCACTGTGG + Intronic
1181969646 22:26680519-26680541 CTGCATTGCCCCTGCCCTTGTGG - Intergenic
1181972577 22:26703239-26703261 CTGAATTTCCAGTCCCACTGTGG + Intergenic
1183091475 22:35525257-35525279 CTCCAGCTCCTCTGCCACAGTGG + Intergenic
1183244499 22:36683569-36683591 CTGCCTTTCCTCCCCCACTCAGG + Intronic
1184799962 22:46753132-46753154 CTCCATCCCCTCTGTCACTGTGG - Intergenic
1184928053 22:47658176-47658198 CTGCATCTCCTCTATCCCTGAGG - Intergenic
1185355362 22:50366181-50366203 CTAGTTTTGCTCTGCCACTGAGG + Intronic
949706791 3:6827665-6827687 CTGCCTTTCCTACGGCACTGTGG + Intronic
950075480 3:10183915-10183937 CTGTCTTTTCTCAGCCACTGTGG - Intronic
950923029 3:16714976-16714998 CTGCCTTGCCTCCTCCACTGTGG - Intergenic
951057684 3:18166630-18166652 GTGCATTTCATCTGCAAATGAGG + Intronic
951089426 3:18555057-18555079 CTACCTTTCCTCTGTCACTATGG - Intergenic
951706517 3:25549435-25549457 CTGTATTTCCTCTACCAATTTGG - Intronic
951822505 3:26827852-26827874 CAGCATTGCCTCTGCCACTGTGG + Intergenic
953056964 3:39395768-39395790 CTGGATTTCATCTGCTACTTGGG + Intronic
953871256 3:46629513-46629535 CTGTATTTTCTCTCCCTCTGCGG - Intergenic
954600342 3:51862808-51862830 GTGACCTTCCTCTGCCACTGTGG - Intronic
954678038 3:52326366-52326388 CTGCAGTTCCTCATCCCCTGAGG - Intronic
954855798 3:53642578-53642600 CTGCCTTTGCTCTGCCGGTGAGG + Intronic
954981755 3:54752230-54752252 CTGCATTTCCTGTGTGAATGGGG + Intronic
955213395 3:56962756-56962778 CTGATTTTTCTCTGCTACTGTGG - Intronic
956370144 3:68550235-68550257 CTGTCTTACCTATGCCACTGAGG + Intergenic
956728704 3:72177497-72177519 CCGCATGTCCTCTGCGGCTGGGG - Intergenic
958459067 3:94371183-94371205 CTTCCTCACCTCTGCCACTGTGG - Intergenic
958768893 3:98402752-98402774 CTGCATTTCCTCTACCACTGTGG + Intergenic
959041218 3:101424721-101424743 CCACATTGCCGCTGCCACTGTGG + Intronic
959462489 3:106644045-106644067 CAACCTTCCCTCTGCCACTGTGG + Intergenic
959561755 3:107790301-107790323 CTGTACTTCCTCTGACACTTGGG + Intronic
959678645 3:109066778-109066800 TGGGAATTCCTCTGCCACTGAGG - Intronic
962464844 3:135648748-135648770 CTGTGTTGCTTCTGCCACTGTGG - Intergenic
963749647 3:149163235-149163257 CTGCAGTTCCTCTCCCACCAAGG - Intronic
963913935 3:150840880-150840902 CTGCATTGCCTCCACCACTGTGG - Intergenic
964062090 3:152537398-152537420 GTGCATTGCCTCCACCACTGTGG - Intergenic
966289976 3:178343841-178343863 CTGCATTGCCTCCACCACTGTGG + Intergenic
966726896 3:183116341-183116363 CTGCTTTTCCCCTGCCCGTGCGG + Intergenic
967188683 3:186966863-186966885 TTGCGTTTCCTCTGCAACTCGGG + Intronic
967544881 3:190713712-190713734 CTTCATTTCCTCTATCTCTGAGG + Intergenic
968718251 4:2177972-2177994 CTGCCTTTCCTCTGATTCTGTGG + Intronic
969051020 4:4373062-4373084 CAGTATTCCCTCTGCTACTGTGG - Intronic
970735119 4:19157014-19157036 CTTCATGGCCACTGCCACTGTGG - Intergenic
970808269 4:20061275-20061297 CTGCATTTCCTCTGCAGCTCAGG - Intergenic
970846313 4:20542472-20542494 CTGTATTTCCTCTGCGATTTAGG + Exonic
972124147 4:35741825-35741847 CTGCAATGTCGCTGCCACTGTGG + Intergenic
972412961 4:38811273-38811295 CTGGACTTTCTTTGCCACTGTGG + Intronic
972706702 4:41551792-41551814 TTGTATCTACTCTGCCACTGTGG - Intronic
974274989 4:59707781-59707803 CAGCATTCCCTTTTCCACTGGGG - Intergenic
974606282 4:64156442-64156464 TTTCAGTTCCTCTGCCCCTGTGG + Intergenic
975999806 4:80360279-80360301 CTGCATTGCCTCTGTCACTGTGG - Intronic
976983172 4:91257771-91257793 CTGCATATCCTTTTCCACAGAGG - Intronic
978555672 4:109977713-109977735 CTGTAATCCCTCTGCCACTCAGG + Intronic
980148117 4:129014867-129014889 ATGAGTTGCCTCTGCCACTGTGG - Intronic
981355797 4:143787613-143787635 CTGCTTTTCCTCAACAACTGAGG - Intergenic
981367333 4:143918270-143918292 CTGCTTTTCCTCAACAACTGAGG - Intergenic
981377119 4:144028504-144028526 CTGCTTTTCCTCAACAACTGAGG - Intergenic
981758040 4:148162524-148162546 CTGAGTTTCCTCTTCCCCTGAGG - Intronic
983302254 4:165941795-165941817 CTGCATTTCATAGGCCACTAGGG + Intronic
983640894 4:169943069-169943091 CTGCTTTTCAACTGCCATTGTGG - Intergenic
983858514 4:172675420-172675442 CTGCATTGCCTCTGCCACTGTGG - Intronic
985067340 4:186135466-186135488 CTGTATTTCCTCTGCAGCTATGG - Intronic
986667095 5:10113647-10113669 CTCCCTTTCCTCTGCTGCTGGGG - Intergenic
986673283 5:10162126-10162148 CTGCCTTTCCACAGCCAGTGGGG + Intergenic
987756284 5:22100802-22100824 CTGAATTTCATATACCACTGGGG + Intronic
988200918 5:28067068-28067090 CTGCATTGCCTCCACCACTGTGG + Intergenic
988865031 5:35324892-35324914 CTGCGTTGCCTCTGCCATTGTGG + Intergenic
989323608 5:40165212-40165234 CTGCCTTTCCTGTGGAACTGGGG + Intergenic
989552908 5:42756836-42756858 CTCCCTTTCCGCTGCCTCTGGGG - Exonic
990781780 5:59372719-59372741 CTGCATTGCCTCTGCCACTCTGG + Intronic
991577792 5:68122753-68122775 CTGCATTGCCTTTGCCTCTGTGG + Intergenic
992412758 5:76523009-76523031 TTGCATTTCCTCTCCTTCTGAGG - Intronic
994358927 5:98827968-98827990 GTGTGTTGCCTCTGCCACTGTGG + Intergenic
995394557 5:111673523-111673545 CTGCTCTTTCTCAGCCACTGTGG - Intronic
995588241 5:113671539-113671561 CTATATGTGCTCTGCCACTGCGG + Intergenic
996637177 5:125707136-125707158 ATACATTTCCTCTGGCAGTGAGG + Intergenic
997791915 5:136769403-136769425 CTGCTTTACCTCTGCAACTGCGG + Intergenic
998755906 5:145379361-145379383 CTGCATTGCCTCTGCCATTGTGG - Intergenic
999740204 5:154544154-154544176 CAGCAAGTCCTCTGCCAGTGTGG + Intergenic
999932225 5:156446138-156446160 CTGCATTTCCTGGGGCTCTGTGG - Intronic
1001131275 5:169065664-169065686 CTGCTATTCCCATGCCACTGTGG + Intronic
1001297967 5:170512042-170512064 TTCCATTTCATCTGACACTGTGG + Intronic
1002922895 6:1585718-1585740 GTGCATTTCCTTGGCCACCGTGG + Intergenic
1003004722 6:2370051-2370073 CTGCTCTTGCTCTGCCCCTGAGG - Intergenic
1003218716 6:4137293-4137315 CTGCATTTCCATTACCTCTGAGG - Intergenic
1003301961 6:4892224-4892246 CGGCTTTTCCGCTGCCACTTCGG - Exonic
1003523506 6:6879136-6879158 CTGCATTTCCTGTGCCTCTCTGG - Intergenic
1003682350 6:8268623-8268645 CTGCCCTTCCTCTGTCACTGTGG - Intergenic
1004252764 6:14035332-14035354 CTCCATTTGGTCTGCCACTTGGG + Intergenic
1004398382 6:15266445-15266467 CTCCATATCCTCTCCCGCTGGGG + Intronic
1004510199 6:16278652-16278674 CCACATCTCCTCTGCCACAGAGG + Intronic
1004870382 6:19898255-19898277 CTGCATTTCTTCTGCTCCTGAGG - Intergenic
1005182981 6:23127460-23127482 CTGCATTTCCCTTTCAACTGCGG + Intergenic
1005434750 6:25796941-25796963 CTGCCTTCTCTCTGCCACTGTGG + Intronic
1006114327 6:31767217-31767239 CTGGACTTCCTCTTCCACTTTGG - Exonic
1006253086 6:32807277-32807299 TTGCATTGCCTCTGCCACTGTGG - Intergenic
1007271299 6:40639341-40639363 ATGCTTTTCTTCTGCCTCTGAGG + Intergenic
1007356846 6:41326237-41326259 CGTCATCGCCTCTGCCACTGTGG + Intergenic
1007644928 6:43372479-43372501 CTGCACTGCCTTCGCCACTGGGG - Intergenic
1007681927 6:43640013-43640035 CAGCATCTCCTCTGCCTGTGAGG - Exonic
1009596857 6:65746564-65746586 CTGCTTTGCCTCTGACACTGTGG + Intergenic
1012339682 6:98104606-98104628 CTGCCTGGCCTCTGCCACTGTGG - Intergenic
1012382872 6:98641071-98641093 CCTCATTTTGTCTGCCACTGGGG - Intergenic
1012488027 6:99743809-99743831 CTGCCTTCCCTCTGCCTCTTTGG + Intergenic
1012964109 6:105655182-105655204 CTGCATGTACTCTGACACTTGGG + Intergenic
1013805859 6:113995090-113995112 CTGCATGGCTTCTGCCACTCAGG - Intronic
1013992035 6:116265136-116265158 CTGCATTTCCTCTGCCACTGTGG - Intronic
1014183477 6:118409075-118409097 CTGCCTTGCCTCTGCCACTGTGG + Intergenic
1015201968 6:130592873-130592895 TTGCTTTTCTTCTTCCACTGGGG - Intergenic
1015246910 6:131085179-131085201 CTGCATTGCTTCTGCAACTGCGG + Intergenic
1017653264 6:156602080-156602102 CTGCATTGCATCTGACCCTGTGG + Intergenic
1018524599 6:164694796-164694818 CTGCAGTTCCTCAGCCACTCCGG + Intergenic
1019838209 7:3412232-3412254 CCCCATTTCCTCAGCCACTCAGG + Intronic
1019910394 7:4096936-4096958 CTGACTCTCCACTGCCACTGTGG - Intronic
1021351099 7:19595439-19595461 CAGCATTGTTTCTGCCACTGTGG - Intergenic
1021567051 7:22026279-22026301 ATCCATTTCCCCTCCCACTGAGG - Intergenic
1023000335 7:35801500-35801522 CGGCATTTCCTGTGCCGCGGCGG + Intronic
1024318470 7:48043052-48043074 CTGACTGTCCTCTGCCACTGTGG - Intronic
1024427182 7:49239848-49239870 CTGTGTTGCCTCTGCCACTGTGG - Intergenic
1024817537 7:53288310-53288332 CTGCTTTTCCTCACCCTCTGTGG + Intergenic
1025756653 7:64350999-64351021 CTGCTTTGCTCCTGCCACTGAGG - Exonic
1027627430 7:80563649-80563671 CTGCCTTGCATCTGCCACTGTGG - Intronic
1027859769 7:83562654-83562676 CCAAATTTCCTCTGCCACAGAGG - Intronic
1028083097 7:86601128-86601150 CTGCCTTGCCTCTGCTACTGTGG + Intergenic
1028652877 7:93170433-93170455 CGGCATTCCAGCTGCCACTGGGG + Intergenic
1028857947 7:95613211-95613233 CTGCTTTGCCTCTGCTACTCCGG + Intergenic
1028871684 7:95777202-95777224 TTGCTTTTCTTCTGCCACTCTGG - Intronic
1030809224 7:113955260-113955282 CTGCCTTGCCTCCACCACTGTGG - Intronic
1031895614 7:127345543-127345565 CAGCATTTCCTAGGCCCCTGAGG + Intergenic
1033248537 7:139738993-139739015 GGGCATTTATTCTGCCACTGTGG - Intronic
1033391939 7:140936897-140936919 CTGCTTTTCATGGGCCACTGAGG + Intergenic
1033612967 7:142983983-142984005 CTGCATTGCCTCTGTCACTGTGG - Intergenic
1036296656 8:7543164-7543186 CAGCATTTTCTCTTCTACTGAGG + Intergenic
1036325910 8:7777855-7777877 CAGCATTTTCTCTTCTACTGAGG - Intergenic
1036845672 8:12168416-12168438 CTGCATGTCCTTTGCCTTTGAGG + Intergenic
1036867040 8:12410735-12410757 CTGCATGTCCTTTGCCTTTGAGG + Intergenic
1037823921 8:22149433-22149455 CTGCCTTGCCACTGCCAGTGGGG - Intronic
1038995716 8:32920765-32920787 CTGCATTTCCCCTACCTCTCTGG - Intergenic
1039557188 8:38484930-38484952 CTTCTTTTTCTCTGCCACTATGG - Intergenic
1040372124 8:46787691-46787713 CTGCTTTGCTCCTGCCACTGAGG - Intergenic
1040380743 8:46869142-46869164 CTGCTTTGCTCCTGCCACTGAGG + Intergenic
1040789269 8:51205989-51206011 CTGCCTTTCTTCTGGCACAGGGG - Intergenic
1044513736 8:93114300-93114322 CTGGATTTCCTCTTCCAGTTTGG + Intergenic
1044839459 8:96325597-96325619 CTCCATTCCCACTGCCTCTGCGG + Intronic
1045672793 8:104575315-104575337 CTGCATTGCCTCCACCACTGTGG + Intronic
1047293676 8:123552240-123552262 CTGTGCTTCCTCTGCCCCTGGGG + Intergenic
1047784273 8:128138548-128138570 CTCCATCTCCCCTGCCTCTGTGG - Intergenic
1049365142 8:142233446-142233468 CTCCTTTCCCTCTGACACTGAGG - Intronic
1049617272 8:143581138-143581160 CTGCAGCTCCTGTACCACTGGGG + Exonic
1049650298 8:143763692-143763714 CTGCATCTGCTCTGCTTCTGGGG - Intergenic
1049960379 9:732554-732576 CTGCATTTCATCTTCCACCCTGG - Exonic
1050087259 9:1978933-1978955 GTGATTTTCCTCTGCAACTGGGG + Intergenic
1050265285 9:3883165-3883187 GAGCATTTCCTATGCCACAGTGG - Intronic
1051064109 9:13081170-13081192 CTGCATTGCCTTTGCCTTTGTGG - Intergenic
1051429722 9:16969547-16969569 CTGCATTTCTACTCCCACTAGGG - Intergenic
1051539131 9:18194721-18194743 CTGCTTCTCCTCTGCCATTTTGG - Intergenic
1051591880 9:18784482-18784504 CTGGATTTCCTATGCCATTGTGG + Intronic
1052282636 9:26750664-26750686 CTGCATTGCCACGGCAACTGGGG - Intergenic
1052514537 9:29462900-29462922 CTGCCTTGCCTCCACCACTGTGG + Intergenic
1052534240 9:29727064-29727086 TTGCATTGCCTCTGCCACTGTGG + Intergenic
1055096895 9:72423192-72423214 CTGCATTTCTTCTGCAAATAGGG - Intergenic
1056045557 9:82711980-82712002 CTGCTTGGCCTCTGCTACTGTGG + Intergenic
1056404261 9:86259150-86259172 TTGTTTTTCCTCTGCCACTTGGG - Intronic
1056907336 9:90665240-90665262 CCGCCTTGCCTCTGTCACTGTGG - Intergenic
1057327069 9:94075086-94075108 CTGCAGTTCCTCTGCCAGGGTGG - Intronic
1057790547 9:98121951-98121973 CTCCATTTACTCAGTCACTGGGG - Exonic
1060076302 9:120593419-120593441 CTGCATGTCCTCAAACACTGCGG - Intergenic
1060795081 9:126507752-126507774 CTGCTTTTCCTCTCCTACTGTGG - Intergenic
1061877221 9:133550310-133550332 CTGCCTTTCAGCTGGCACTGTGG + Intronic
1062102751 9:134737132-134737154 CTGCAGAGCCTCTGCCCCTGTGG + Intronic
1062174962 9:135156524-135156546 CAGCATTTTCTCCTCCACTGCGG + Intergenic
1062731495 9:138112667-138112689 CTGCAGCTCCTCTGCCACCCAGG - Intronic
1203457561 Un_GL000220v1:4898-4920 CTGAGTTTCCTCTCCCACTAAGG + Intergenic
1186685876 X:11923472-11923494 CTGCATTGCCTCTGACACTGTGG + Intergenic
1186715179 X:12244150-12244172 CTGCATTTCTTCTTCCAAAGAGG + Intronic
1187230233 X:17414861-17414883 CTTTCTTTCCTCTGCCTCTGTGG - Intronic
1188567731 X:31545686-31545708 CTGCATGTCTTCAGCAACTGTGG - Intronic
1188743737 X:33816971-33816993 CTGCCTTGCTTGTGCCACTGTGG - Intergenic
1189778156 X:44488527-44488549 CTGCGTTTCTTCAGTCACTGAGG - Intergenic
1190304864 X:49076206-49076228 GTGTTTTTGCTCTGCCACTGGGG + Intronic
1190506362 X:51130151-51130173 CTGCATTGCCTCCACCACTGTGG - Intergenic
1191610067 X:63102555-63102577 CTGCTTTGCCTCTGCCATGGTGG + Intergenic
1191642427 X:63441805-63441827 CTGCATTGCCTTCACCACTGTGG + Intergenic
1191722781 X:64248624-64248646 CCTCCTTTCCTCTGCCAGTGTGG - Intergenic
1191743586 X:64463023-64463045 CTGCCTTGCCTCTGCCGCTGTGG - Intergenic
1191843491 X:65529490-65529512 CAGCATTTCCTCTGGGGCTGTGG - Intronic
1192011551 X:67278262-67278284 CTGTTTTGCCTCTGCCACTGTGG + Intergenic
1192150893 X:68711817-68711839 CTCCATTTCCTCAGCACCTGTGG - Intronic
1192926604 X:75760362-75760384 CTGCCTAGCCTCTGCCACTGTGG + Intergenic
1193076600 X:77362499-77362521 CTGCACTTCCTCTTCCCCTAGGG + Intergenic
1193439575 X:81522649-81522671 CTTCATTTTTTTTGCCACTGAGG + Intergenic
1193610899 X:83630812-83630834 ATGCATTGCCTCCACCACTGTGG - Intergenic
1193613993 X:83666529-83666551 CTGCATTGCCTCTGCCACTGTGG - Intergenic
1193895476 X:87110091-87110113 CTGCTTTTCCTCGGTCTCTGTGG - Intergenic
1194549224 X:95274789-95274811 CTGTGTTGCCTCTGCCACTGTGG + Intergenic
1194925698 X:99820402-99820424 CTGCATTGCCTCCAACACTGTGG + Intergenic
1195231081 X:102848707-102848729 CTGCAGTTATTCTTCCACTGAGG + Intergenic
1195567788 X:106363106-106363128 CTGCATTGCCTTCACCACTGTGG - Intergenic
1195886109 X:109639332-109639354 CCCCATTTCCTCTGCCTCAGAGG - Intronic
1197076776 X:122363185-122363207 CTGCCTTGCCTCTGCCACTGTGG - Intergenic
1198030207 X:132747292-132747314 CTGAATCTCCTCTGTAACTGAGG + Intronic
1198283907 X:135171281-135171303 CTGCTTCTCCTCAGACACTGTGG + Exonic
1199642091 X:149872157-149872179 CTGCATTGCCTCCGCCACTGTGG + Intergenic
1199949621 X:152698024-152698046 ATGTAATTCCTCTGCCACTATGG - Intergenic
1199975469 X:152892679-152892701 CTGCATTTCCTCTTCCCAGGTGG + Intergenic
1200243980 X:154513014-154513036 CTGGATCTCCCCTGCCACTTGGG + Intronic
1200848025 Y:7851525-7851547 CTGCTTTGTCTTTGCCACTGAGG + Intergenic
1200922867 Y:8628701-8628723 CTGCATGTCCTCTGTCTTTGTGG + Intergenic
1200936485 Y:8742815-8742837 CTGCATGTCCTTTCTCACTGTGG - Intergenic