ID: 1013992045

View in Genome Browser
Species Human (GRCh38)
Location 6:116265174-116265196
Sequence GTGGAAGGAGTGGCCCCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013992035_1013992045 15 Left 1013992035 6:116265136-116265158 CCACAGTGGCAGAGGAAATGCAG 0: 1
1: 7
2: 22
3: 63
4: 345
Right 1013992045 6:116265174-116265196 GTGGAAGGAGTGGCCCCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013992045 Original CRISPR GTGGAAGGAGTGGCCCCAGA TGG Intronic
No off target data available for this crispr