ID: 1013995666

View in Genome Browser
Species Human (GRCh38)
Location 6:116304775-116304797
Sequence CATTCTAGGCAGATGAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 0, 2: 6, 3: 78, 4: 333}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013995666_1013995670 8 Left 1013995666 6:116304775-116304797 CCAGCCCTCATCTGCCTAGAATG 0: 1
1: 0
2: 6
3: 78
4: 333
Right 1013995670 6:116304806-116304828 CTACCCCTTGCCTTTTCCTTAGG 0: 1
1: 0
2: 1
3: 22
4: 280
1013995666_1013995675 22 Left 1013995666 6:116304775-116304797 CCAGCCCTCATCTGCCTAGAATG 0: 1
1: 0
2: 6
3: 78
4: 333
Right 1013995675 6:116304820-116304842 TTCCTTAGGCTACTGTGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013995666 Original CRISPR CATTCTAGGCAGATGAGGGC TGG (reversed) Intronic
900196342 1:1377760-1377782 TATTATAGGCAGATGTGCGCTGG - Intergenic
900493944 1:2967684-2967706 CCTTTTAGGCAGGAGAGGGCAGG - Intergenic
900515462 1:3079892-3079914 CTTTCAAGGCACAAGAGGGCAGG - Intronic
901549986 1:9989007-9989029 AATTCTGGGCAGAAGAGGGTGGG + Intergenic
902613806 1:17612826-17612848 CATGCCAGGCAGCTGGGGGCCGG - Intronic
902958226 1:19941601-19941623 CATTCTAGGCACTGGCGGGCTGG - Intergenic
904005170 1:27359818-27359840 CACCCTCAGCAGATGAGGGCGGG + Intronic
904222554 1:28984322-28984344 AATTCTAGGCAGAAAAGGACGGG - Intronic
907459583 1:54597404-54597426 CATTGCAGCCAGGTGAGGGCAGG + Exonic
908571975 1:65420272-65420294 AATTCTGGGCCGGTGAGGGCTGG + Intergenic
908702730 1:66919965-66919987 AATTCTGGGCAGAAGAAGGCAGG + Intronic
909185667 1:72482218-72482240 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
909570590 1:77105437-77105459 AATTCTAGGCAGATAGGGGTGGG - Intronic
909775454 1:79479037-79479059 AATTCTAGGCAGAAAAGGGTGGG - Intergenic
910150303 1:84134354-84134376 AATTCTAGGCAGAAAAGGGCAGG - Intronic
910400216 1:86830853-86830875 AATTCTAGGCCGAGGTGGGCGGG + Intergenic
911205774 1:95090357-95090379 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
913097623 1:115534546-115534568 AATTCTAGGCAGAAAAGGGCAGG + Intergenic
916859452 1:168787118-168787140 CATTCTAGGAAAAGCAGGGCGGG + Intergenic
918562180 1:185881631-185881653 AATTCTAGGCAGAAAAGGGTAGG - Intronic
918792548 1:188847422-188847444 AATTCTAGGCAGACAGGGGCGGG - Intergenic
918907431 1:190515054-190515076 CAGTGTAGGCAGATGGGGCCTGG + Intergenic
918910510 1:190562629-190562651 AATTCTAGGCAGACAAGAGCAGG + Intergenic
919240782 1:194914037-194914059 AATTCTAGGCAGAAAAGGGTGGG + Intergenic
919314513 1:195954486-195954508 AATTCTATGCAGAAGAGGGAAGG + Intergenic
919577020 1:199322896-199322918 CATTCTTGGAAGGTGAGGGAGGG - Intergenic
920050090 1:203159167-203159189 CCATCCAGGCAGATGAGGGTGGG - Intronic
920091339 1:203455286-203455308 CCTCAGAGGCAGATGAGGGCTGG - Intergenic
921670207 1:217916582-217916604 CATTCTAAGTAGAAGAGGGATGG + Intergenic
921674964 1:217966607-217966629 AATTCTGGGCAGAGGAGGGTGGG - Intergenic
921679970 1:218020109-218020131 AATTCTAGGCAGAAAAGGGCAGG + Intergenic
922808808 1:228404444-228404466 CTTTCTAGGCCCATGGGGGCAGG + Intronic
923143775 1:231183818-231183840 CATTTGAGGAAAATGAGGGCAGG + Intronic
923306535 1:232693917-232693939 AATTCTGGGCAGAAGAGAGCGGG + Intergenic
923397736 1:233583852-233583874 AATTCTAGGCAGGAAAGGGCAGG + Intergenic
923892883 1:238235324-238235346 AATTCTAGGTAGAAAAGGGCGGG - Intergenic
923911041 1:238444564-238444586 TATTCCAGGCAGAAAAGGGCAGG + Intergenic
923944327 1:238865313-238865335 GATTCTAGGCAGAAAAGGGTGGG - Intergenic
924818416 1:247463376-247463398 AATTCTAGGCAGAAAAGGGTGGG - Intergenic
1063374686 10:5547078-5547100 CCTTCTGGGCAGGTGCGGGCTGG + Intergenic
1065056925 10:21854692-21854714 GATTCAAGGCAGAAGAGAGCAGG + Intronic
1065979473 10:30878073-30878095 AATTCTAGGCAGACAGGGGCGGG + Intronic
1066281612 10:33923488-33923510 AATTCTAGGCAAAAGAGGGCGGG + Intergenic
1068321764 10:55427107-55427129 GATTCTGGGAAGATGAGGGCAGG - Intronic
1068681224 10:59822738-59822760 AATTCTAGGCAGAAAAGGGTAGG + Intronic
1068892630 10:62163606-62163628 CCTTCTAGGCAGATGATGCCTGG + Intergenic
1070470650 10:76775717-76775739 AATTCTGGGCAGATGAAGGAGGG - Intergenic
1071410978 10:85394979-85395001 CTTTCTAGGGAGAGAAGGGCAGG - Intergenic
1071428500 10:85583273-85583295 AATTCTAGGCAGAAAAGGGTGGG - Intergenic
1071687283 10:87772977-87772999 GATTCTTGGCAAATGAAGGCAGG - Intronic
1077502104 11:2914043-2914065 CCTTATATGCAAATGAGGGCTGG - Intronic
1077671907 11:4165396-4165418 CTTACTAGGCAGGTGATGGCAGG - Intergenic
1077778494 11:5298148-5298170 AATTTTAGGCAGAAAAGGGCGGG - Intronic
1078800228 11:14636295-14636317 CATTCTAAAAAGATGAGGACAGG - Intronic
1079033452 11:17002567-17002589 CATTTGAGGCTGATGGGGGCAGG - Intronic
1080846471 11:36031425-36031447 CATTCTAGGGGGATGAGGCAAGG + Intronic
1081332990 11:41826822-41826844 AATTCAAGGCAGAAAAGGGCAGG - Intergenic
1082645597 11:55720484-55720506 AATTCTAGGCAGACAAGGGCAGG - Intergenic
1084704915 11:70810540-70810562 CACTCGGGGCAGATGTGGGCAGG - Intronic
1085870832 11:80347344-80347366 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1085978641 11:81694020-81694042 CAGTGAAGGCAGCTGAGGGCGGG - Intergenic
1087823343 11:102736414-102736436 CATTCTAGGCAAAAGAAGCCAGG - Intergenic
1088715383 11:112544272-112544294 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1089634846 11:119805458-119805480 CATTCAAAGCAGAGGAGGACAGG - Intergenic
1090178685 11:124674147-124674169 CAATGTGGGCAGAGGAGGGCGGG - Exonic
1091332130 11:134737930-134737952 CATTCAAGGAAGATCAGGGCGGG - Intergenic
1091566133 12:1649474-1649496 CATCGTAGGCAGAGGAGGGAGGG - Intergenic
1092031770 12:5292418-5292440 AATCCAAGGAAGATGAGGGCTGG + Intergenic
1092680129 12:10969452-10969474 AATTCTAGACAGAAAAGGGCGGG - Intronic
1093268437 12:17027931-17027953 AATTCTAGACAGAAGAGGGCAGG + Intergenic
1093401772 12:18754483-18754505 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
1093731291 12:22568458-22568480 AATTCTAGGCAGACAGGGGCGGG - Intergenic
1094160360 12:27383598-27383620 CATACCAGGCAGAAGTGGGCTGG - Intronic
1094818165 12:34206014-34206036 CACTCTAGCCAGAGCAGGGCGGG + Intergenic
1096170285 12:49463003-49463025 AATTCTAGGCAGAAAAGGGTGGG - Intronic
1096452002 12:51751052-51751074 CATTCAAGCCAGTTGAGGCCAGG + Intronic
1098694411 12:73534637-73534659 CTTTCTAGCCAGAAGAGAGCTGG - Intergenic
1098936837 12:76490226-76490248 AATTCTAGGCAGAAAACGGCAGG + Intronic
1099540828 12:83905155-83905177 AATTGTAGGCAGAAAAGGGCAGG - Intergenic
1099543803 12:83950724-83950746 AATTCTGGACAGAAGAGGGCGGG + Intergenic
1100293007 12:93235436-93235458 AATTCTAGGCAGAAAAGGGCAGG + Intergenic
1100594629 12:96061248-96061270 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1100757988 12:97773361-97773383 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1101000386 12:100352095-100352117 GAGTCTAGGAAGATGAGGCCTGG + Intergenic
1101148820 12:101866300-101866322 AATTCTAGGCAGACAGGGGCAGG + Intergenic
1101217399 12:102597600-102597622 AATTCTGGGAAGAAGAGGGCAGG - Intergenic
1101432771 12:104640818-104640840 AATTCTGGGCAGAAGAGGGTTGG + Intronic
1104060573 12:125264499-125264521 CATTCTGGGCAGATAGGGCCTGG + Intronic
1104219303 12:126766754-126766776 AATCCTAGGCAGACAAGGGCGGG + Intergenic
1104265780 12:127231445-127231467 AATTCTGGGCAGAAAAGGGCAGG + Intergenic
1105639683 13:22249648-22249670 AATTCTGGGCAGAAGAGGGTAGG + Intergenic
1106870182 13:34011164-34011186 AATTCTAGGGAGAAAAGGGCGGG + Intergenic
1107106446 13:36648299-36648321 CTTTAGAGGCAAATGAGGGCCGG + Intergenic
1107854092 13:44597644-44597666 AATTCTGGGAAGAAGAGGGCAGG - Intergenic
1108017028 13:46086683-46086705 GATCCTAGGCAGAAAAGGGCGGG - Intronic
1108285896 13:48907573-48907595 CATGCTAGGAAATTGAGGGCAGG - Intergenic
1108316505 13:49242355-49242377 AATTCTAGGCAGACAGGGGCAGG + Intergenic
1108487635 13:50942970-50942992 AATTCTGGGCAGAAGAGGGCCGG - Intronic
1108945203 13:56014586-56014608 AATTCTAGGCAGACAAGGGTAGG + Intergenic
1109593778 13:64522953-64522975 AATCCTAGGCAGACAAGGGCAGG - Intergenic
1109693824 13:65927607-65927629 AATTCTAGGCAGAAAAGTGCAGG - Intergenic
1109882983 13:68506596-68506618 AATTCTAGGCAGACAGGGGCAGG + Intergenic
1110155047 13:72306649-72306671 CATTGTAGGCAGGTAAAGGCAGG - Intergenic
1110755641 13:79171123-79171145 CAATTTAGGGAGATAAGGGCAGG + Intergenic
1111104718 13:83629934-83629956 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1111606474 13:90546061-90546083 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1113467856 13:110524757-110524779 GATTCTGGGCAGATAAGGGCAGG - Intronic
1113617182 13:111689225-111689247 CATTCTAGGCACCTGAGACCAGG - Intergenic
1113622712 13:111774496-111774518 CATTCTAGGCACCTGAGACCAGG - Intergenic
1114620720 14:24094537-24094559 CATCCTAGGCGGAGGCGGGCAGG + Intronic
1116716408 14:48431753-48431775 AATTCTAGGCAGACAGGGGCGGG - Intergenic
1117348710 14:54859615-54859637 GATTCTCAGCAGATGAGGGCAGG + Intronic
1118924997 14:70184172-70184194 CAGTCTATGAAGGTGAGGGCGGG - Intronic
1119562619 14:75603147-75603169 AATTCTAGGCAGAAAAGGGTGGG + Intronic
1120758566 14:88266365-88266387 TTTTCCAGGCAGATGAGGGTGGG - Intronic
1122471461 14:101969901-101969923 CATTCATGAAAGATGAGGGCTGG - Intronic
1122643278 14:103175050-103175072 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
1122861150 14:104582898-104582920 CATGCTCGGCAGGTGGGGGCGGG - Intronic
1123018638 14:105387300-105387322 CATTCTCGGCAGAGGAGGGCGGG - Intronic
1123428060 15:20188755-20188777 GCTTCCAGGCAGATGAAGGCAGG + Intergenic
1123765206 15:23471165-23471187 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1123992064 15:25690850-25690872 GATTCCAGTCAGATGACGGCGGG + Intronic
1125420605 15:39500599-39500621 CATTCAAGGCAAATGGTGGCTGG + Intergenic
1125750101 15:42022023-42022045 CATCCTTGGCAGAGGAGGGGAGG - Intronic
1126333796 15:47564656-47564678 AATTCTAGGGAGAAAAGGGCGGG + Intronic
1126654174 15:50957565-50957587 AATTCTAGGCAGAAAAGGGTGGG - Intronic
1127861585 15:62998236-62998258 CATGCTGGGCAGGTGGGGGCAGG + Intergenic
1129019663 15:72504782-72504804 CATTCTAGGCAGACAGGGGTGGG - Intronic
1129319834 15:74768330-74768352 CATCCTGGGTGGATGAGGGCAGG - Intergenic
1130247857 15:82269627-82269649 GAGGCTAGGGAGATGAGGGCAGG + Intronic
1130851952 15:87803515-87803537 CACTGAAGGGAGATGAGGGCAGG - Intergenic
1131695788 15:94876274-94876296 AATCCTAGGCAGATGGGAGCAGG - Intergenic
1131814744 15:96211037-96211059 AACTCTGGGCAGAAGAGGGCAGG + Intergenic
1131881483 15:96867393-96867415 AATTCTAGGCAGAAAAGGGTGGG + Intergenic
1131931554 15:97448584-97448606 AATTCTGGGCGGAAGAGGGCAGG + Intergenic
1132144806 15:99423351-99423373 CATTCCAGGCAGGTCTGGGCAGG - Intergenic
1132375955 15:101328290-101328312 CATCTTAAGAAGATGAGGGCAGG + Intronic
1133504040 16:6392915-6392937 CATTCATGGCAGAAGAGGGTGGG - Intronic
1135057105 16:19240688-19240710 GCTTCTGGGCAGAAGAGGGCTGG - Intronic
1135239740 16:20793704-20793726 TATTCCAGGCAGCTGAGGGCAGG + Intronic
1135887977 16:26329615-26329637 AATTCTAGGTAGAAGAGGGAGGG - Intergenic
1136116619 16:28098615-28098637 CATTCTGGGTGAATGAGGGCAGG + Exonic
1138852141 16:60641871-60641893 AATTCTAGGCAGAAAAGGGTGGG - Intergenic
1139753752 16:69126190-69126212 TATTCTAGGAAGATCAAGGCAGG + Intronic
1140183066 16:72739644-72739666 CATTTTTGGCAGATGAAAGCAGG + Intergenic
1140805773 16:78530703-78530725 AATTCTGGGCAGAAGAGGGCAGG - Intronic
1141683699 16:85558150-85558172 GATTCCAGGTAAATGAGGGCTGG + Intergenic
1141898433 16:86973835-86973857 CATTCTAGGCACAAGCAGGCTGG + Intergenic
1142301813 16:89263019-89263041 AATTCTAGGCAGACAGGGGCAGG - Intergenic
1203117834 16_KI270728v1_random:1509484-1509506 GCTTCCAGGCAGATGAAGGCAGG - Intergenic
1143326690 17:6103632-6103654 CACTCTATGCATATGAGAGCAGG - Intronic
1143358323 17:6347510-6347532 AATTCTGAGAAGATGAGGGCTGG - Intergenic
1144865131 17:18330756-18330778 CAGTCAAAGCAGATGAGGTCAGG + Intronic
1146278541 17:31530527-31530549 CACTCTGGGCAGGTGGGGGCCGG - Intronic
1146650350 17:34602543-34602565 CATTCTTGACAGGTGAGAGCAGG + Intronic
1147230122 17:39011651-39011673 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
1147426289 17:40347407-40347429 CACTGTAGGCAGAACAGGGCTGG - Intronic
1147515492 17:41113944-41113966 AATTCTAGGCAGAAAAGGGTAGG + Intergenic
1148537716 17:48454840-48454862 AATTCTCGGCAGAAAAGGGCAGG + Intergenic
1149980733 17:61309301-61309323 CATTCTAGGGTAATAAGGGCTGG + Intronic
1151600391 17:75102569-75102591 GATTCTGAGCAAATGAGGGCAGG + Intronic
1153703163 18:7717112-7717134 AATTCTAGGCAGAAAAGGGATGG + Intronic
1155017976 18:21864120-21864142 AATTCTAGGCAGACAAGGGTGGG - Intronic
1156036578 18:32771971-32771993 GCATCTAGGCAGAGGAGGGCAGG + Intronic
1156400705 18:36736852-36736874 AATTCTAGGCAGAAAAGGGTGGG - Intronic
1156946970 18:42844832-42844854 AATTCTAGGCAGATAGGGGCAGG - Intronic
1157792509 18:50545465-50545487 AATTCTAGGCAGAAAAGTGCAGG + Intergenic
1158014432 18:52766855-52766877 AATTCTAGGCAGAAAAGGGTCGG - Intronic
1158159581 18:54465704-54465726 AATTCTGGACAGAAGAGGGCAGG - Intergenic
1158239602 18:55361684-55361706 CATTACAGGCAGATGTGGGAGGG + Intronic
1158537498 18:58321401-58321423 CATCCATGGCAGATGAGGACAGG + Intronic
1158968479 18:62644340-62644362 AATTCTAGGCAGAAAAGGGTGGG + Intergenic
1159030584 18:63226395-63226417 AATTCTGGGCAGAAGAGGGTGGG - Intronic
1159666066 18:71162035-71162057 AATTCTAGGCAGAAGAGGGCAGG + Intergenic
1159777551 18:72620704-72620726 AATTCTAGGCAGACGAGGGTAGG - Intronic
1160339771 18:78079713-78079735 CATTCAAGGGAGATGACGGCAGG - Intergenic
1160467493 18:79093731-79093753 AATTCTAAGCAGATGGGGGAGGG - Intronic
1162106151 19:8371044-8371066 CTTTCTGGGCAGATGGAGGCTGG + Exonic
1164640313 19:29820204-29820226 CATCCTAGGCAGGTGAGGGTGGG + Intronic
1165171100 19:33892096-33892118 CATACTAGGCAGCTGAGAGGTGG - Intergenic
1165300800 19:34967533-34967555 AATTCTGGGCAGAAGAGGCCAGG + Intergenic
1167015454 19:46838338-46838360 CCTCCTAGGCAGCTGAGGGAAGG + Exonic
1168401490 19:56088207-56088229 CACTCCACGCAGATGTGGGCCGG + Exonic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
925495470 2:4444000-4444022 TCTTCTAGGCAGATGAGAACTGG + Intergenic
925823002 2:7819044-7819066 CAGTGTAGTCACATGAGGGCAGG - Intergenic
926221263 2:10937138-10937160 CTTTCTGGGCAGAGGGGGGCAGG - Intergenic
926542953 2:14204266-14204288 AATTCTAGGCAGAAAAGAGCAGG + Intergenic
926604768 2:14886428-14886450 TATGCAAGGCAGATGAGGGAAGG - Intergenic
926610403 2:14941071-14941093 CATTCTAAAAGGATGAGGGCAGG + Intergenic
928027173 2:27749774-27749796 CATTCTAGGCCAATGAGAGGGGG + Intergenic
928813046 2:35253299-35253321 AATTCTAGGCAGAAAAGGGTGGG + Intergenic
929877517 2:45808971-45808993 GATTCTGGGCAGATTAGAGCCGG - Intronic
929906926 2:46054660-46054682 AATTCGGGGCAGAAGAGGGCAGG + Intronic
930527221 2:52545328-52545350 AATTCTAGGCAGAAAAGGGCGGG + Intergenic
931462897 2:62463666-62463688 AATTCTAGGCAGAAAAGAGCGGG + Intergenic
931567200 2:63627408-63627430 AATTCTAGGCAGAAAAGGGCGGG + Intronic
931938893 2:67230560-67230582 AATTCTAGGCAGAAAAGGGTAGG + Intergenic
933981548 2:87554870-87554892 CATTCTCTGAAGATGGGGGCAGG - Intergenic
934717529 2:96552232-96552254 CGTGCCAGGCAGATGAGGCCGGG - Exonic
935426980 2:102929892-102929914 CGTTCTAGGCAGAAGGGGGGAGG - Intergenic
935736923 2:106113709-106113731 CTTTCTGGGCACCTGAGGGCAGG + Intronic
936312288 2:111395946-111395968 CATTCTCTGAAGATGGGGGCAGG + Intergenic
936657571 2:114506041-114506063 AATTCTGGGCAGAAGAAGGCAGG + Intronic
936858352 2:116987044-116987066 AATTCTGGGCAGACAAGGGCGGG + Intergenic
937840342 2:126518741-126518763 AATTCTAGGCAGAAAAAGGCAGG + Intergenic
937891253 2:126940596-126940618 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
937908832 2:127065554-127065576 CACTGTTGGCAGTTGAGGGCAGG - Intronic
938787830 2:134648506-134648528 AATTCTGGGCAGAAGAGGGTGGG - Intronic
938828053 2:135026247-135026269 TAATCTAGGCAGATGAGGAGAGG - Intronic
940173182 2:150850353-150850375 AATCCTAGGCAGATGGGGGTGGG - Intergenic
940173275 2:150851311-150851333 GATTTTAGGCAAATGACGGCTGG - Intergenic
940418985 2:153456241-153456263 CACTCTAGGCAGAAAAGGGCGGG - Intergenic
941427647 2:165368459-165368481 AATTCTGGGCAGAAGAGGACGGG - Intronic
941978411 2:171430699-171430721 AATCCTAGGCAGATGGGGGTGGG + Intronic
943474838 2:188341136-188341158 AATTCTAGGCAGAAAAGGTCAGG - Intronic
944067455 2:195633951-195633973 AATTCTAGGCAGAAAAGGGCAGG - Intronic
944199443 2:197090585-197090607 AATTCTAGGCAGAAAAGGGCAGG + Intronic
946094165 2:217258091-217258113 CTTTATAGGCAGAAAAGGGCTGG - Intergenic
946216009 2:218184092-218184114 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
948735024 2:239997851-239997873 CATTCTTAGCAGCTGACGGCTGG + Intronic
1169633199 20:7656994-7657016 CATTCTAGGGAGAGGGGGGAGGG + Intergenic
1171151251 20:22828122-22828144 CATTCCAAGGAGATGAGGGAGGG - Intergenic
1174266431 20:49335547-49335569 CATTCCAGGGAGCTGCGGGCAGG + Intergenic
1176455773 21:6908725-6908747 CATTCTAGGCAAGCCAGGGCAGG - Intergenic
1176695551 21:9972797-9972819 AATTCTGGGCAAAAGAGGGCAGG - Intergenic
1176833946 21:13773773-13773795 CATTCTAGGCAAGCCAGGGCAGG - Intergenic
1177124621 21:17181204-17181226 AATTCTGGGTAGAAGAGGGCAGG + Intergenic
1177555065 21:22678702-22678724 AATTCTAGACAGAAAAGGGCAGG + Intergenic
1177703782 21:24674185-24674207 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
1177968408 21:27758724-27758746 AATTCTAGGCAGACAGGGGCAGG + Intergenic
1178223628 21:30689397-30689419 CATTCTGGGCAGAAGAGGGCAGG + Intergenic
1179189240 21:39108841-39108863 CCTCCCTGGCAGATGAGGGCAGG + Intergenic
1183617512 22:38954501-38954523 GCTTCTAGGCTGAGGAGGGCGGG + Intronic
1183788077 22:40043357-40043379 CATTTCAGCCAGAGGAGGGCAGG - Exonic
949227462 3:1711545-1711567 GATTCTAGGCAGACAAGGGCAGG - Intergenic
949956708 3:9275060-9275082 AACTCTGGGCAGAAGAGGGCAGG - Intronic
950978857 3:17280313-17280335 AATTCTGGACAGAAGAGGGCAGG + Intronic
951082437 3:18467851-18467873 ACTTCTAGGCTGATGTGGGCTGG + Intergenic
951098089 3:18654957-18654979 CATTTTAGTCACAGGAGGGCAGG - Intergenic
951251096 3:20395215-20395237 AATTCTGGGAAGAAGAGGGCAGG + Intergenic
951768888 3:26232409-26232431 CATTAGAGGAAGATGAGGGTGGG - Intergenic
951931697 3:27974270-27974292 AATTCTAGGCAGAAAAGGGAGGG - Intergenic
952181401 3:30920396-30920418 AATTCTAGGCAGACAGGGGCAGG + Intergenic
952470782 3:33649121-33649143 CATTCTAGGCAGAAGAAGCAAGG - Intronic
954563594 3:51579401-51579423 AATTCTGGGCAGAAGAGGGCAGG - Intronic
954711541 3:52507461-52507483 CATTCCAGGCAGAGGAGAGCAGG - Intronic
957027115 3:75194375-75194397 CATTCAAGGCACATTATGGCAGG - Intergenic
957414184 3:79879017-79879039 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
958467387 3:94474022-94474044 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
958493803 3:94815617-94815639 CACTTGAGGCAGCTGAGGGCAGG - Intergenic
958990610 3:100839777-100839799 CATTCATGGCAGATGAGGTGTGG - Intronic
958996617 3:100913001-100913023 CAGTCTAGGCAGAGGCGGGCAGG + Intronic
959212735 3:103409746-103409768 CATTCTAGGCAGAAAGAGGCAGG + Intergenic
961157632 3:124693691-124693713 CAATTTAGGGAGATGAGGCCTGG - Intronic
963409669 3:144911514-144911536 AATTCTGGGCAGAAGAGGGTGGG + Intergenic
963410618 3:144922389-144922411 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
963858378 3:150280383-150280405 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
964790464 3:160449804-160449826 CCTTCGGGGCAGAGGAGGGCGGG - Exonic
965530464 3:169765518-169765540 CATTCTAAGGAGAAGGGGGCAGG - Intergenic
966059182 3:175734256-175734278 AAATCTAGGCAGAGGTGGGCTGG + Intronic
968005255 3:195238275-195238297 CTTACCAGGCAGATGGGGGCTGG - Intronic
968133110 3:196203668-196203690 CATTCTGGGCAGGGGAGGGAGGG + Intronic
969317866 4:6392938-6392960 CATATAAGGCAGATGAGGGGTGG - Intronic
970131599 4:12877152-12877174 AATTCTAGGCAGAAAAAGGCAGG - Intergenic
971427422 4:26530226-26530248 AGTTCTGGGCAGACGAGGGCAGG + Intergenic
972066488 4:34952830-34952852 AATTCTAGGCAGACAAGGGCAGG + Intergenic
973022504 4:45220792-45220814 AATTCTAGGCAGACAGGGGCAGG - Intergenic
973840051 4:54852220-54852242 CAGGCAAGGCAGAGGAGGGCGGG - Intergenic
974763950 4:66316143-66316165 TTTTCTAGGCAGAGTAGGGCAGG + Intergenic
975947430 4:79724320-79724342 AATTCTATGCAGAAAAGGGCGGG - Intergenic
977338757 4:95730420-95730442 AATTCTAGGCATAAAAGGGCAGG - Intergenic
977781396 4:100985703-100985725 AATTCTAGGCAGAAAAGGGCAGG + Intergenic
977827549 4:101551698-101551720 AATTCTGGGCAGAAGAGGGCAGG + Intronic
978593833 4:110355775-110355797 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
979184315 4:117770130-117770152 AATTCTAAGCAGAAAAGGGCAGG + Intergenic
979946759 4:126842862-126842884 AATTCTAGGCAGATAGGGGCAGG + Intergenic
979976722 4:127206184-127206206 CTTTTTAGGCAAATGAGGGAGGG - Intergenic
980368177 4:131833045-131833067 AATTCTGGGCAAAAGAGGGCAGG - Intergenic
982786678 4:159544392-159544414 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
982798536 4:159673797-159673819 AATTCTGGGCAGAAGAGGGTGGG + Intergenic
983462700 4:168047432-168047454 AATTCCAGGCAGAAAAGGGCAGG - Intergenic
983697927 4:170554989-170555011 AATTCTAGGCAGACAGGGGCAGG - Intergenic
983987233 4:174073868-174073890 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
985048960 4:185970692-185970714 AATTCTAGGCAGAAGAGGGCAGG - Intergenic
985693262 5:1325312-1325334 GCCCCTAGGCAGATGAGGGCTGG - Intronic
986682501 5:10246784-10246806 CCATCTAGGCAGATGAGGGGTGG + Intronic
986729240 5:10623163-10623185 CACTCCAGGCACATGAGGCCAGG - Intronic
987117845 5:14740302-14740324 CATTTTAGGCAGAACAGAGCAGG - Intronic
987188463 5:15449418-15449440 CATTGTAGGCAGTTGAGGTTAGG - Intergenic
988350861 5:30106028-30106050 AATTCTGGGCTGAAGAGGGCAGG + Intergenic
990140303 5:52695491-52695513 AATTCTAGCCTGATGACGGCTGG + Intergenic
990293402 5:54378139-54378161 AATTCTAGGCAGACAGGGGCAGG + Intergenic
991257846 5:64634704-64634726 CATTCTGGGAATATGAGTGCTGG - Intergenic
991631624 5:68661899-68661921 CAGTGGAGGCAGATGATGGCTGG + Intergenic
992229978 5:74654575-74654597 CTTTCTAGGCAGATGAGGGAAGG + Intronic
992796187 5:80256521-80256543 TTTTCTTGGCAGATGAGGGAAGG - Intergenic
994188135 5:96838174-96838196 AATTCTGGGCAGAAGAGGGCAGG - Intronic
994830479 5:104775222-104775244 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
996101565 5:119450323-119450345 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
996502207 5:124229958-124229980 AATTCTGGGCAGAAGAGGGCGGG + Intergenic
998644040 5:144042525-144042547 AATTCTGGGCAGAAGAGGGAGGG - Intergenic
999851177 5:155541365-155541387 AATTCTAGGCAGAAGAGGACGGG + Intergenic
1000109512 5:158094496-158094518 CATTCCAGGCAGATAAAAGCAGG - Intergenic
1000845915 5:166280261-166280283 AATTCTAGGCAGAAAAGGGTAGG + Intergenic
1001969633 5:175944112-175944134 AATTCCAGGCAGAAAAGGGCAGG - Intronic
1002247801 5:177899641-177899663 AATTCCAGGCAGAAAAGGGCAGG + Intergenic
1004495192 6:16156307-16156329 AATTCTGGGCAGAAGAGGTCGGG - Intergenic
1004513671 6:16303437-16303459 CATTCTGGCCAGAGCAGGGCTGG - Exonic
1006638107 6:35474668-35474690 CATGATGGGCAGGTGAGGGCAGG - Exonic
1006947958 6:37798085-37798107 TTTTCTAAGCAGATGAGGGGAGG - Intergenic
1007755140 6:44094581-44094603 CATTCCAGGTAGAGAAGGGCAGG + Intergenic
1007931985 6:45700019-45700041 AATACTGGGCAGAAGAGGGCAGG + Intergenic
1008255826 6:49298169-49298191 AATTCTGGGCAGAAGAAGGCGGG - Intergenic
1008306228 6:49903852-49903874 CATTGGAAGCACATGAGGGCAGG + Intergenic
1009524723 6:64729203-64729225 AATTCTGGGCAGAAGAGGGCAGG - Intronic
1010584540 6:77642120-77642142 AATTCTAGGCAGAAAAGGGTGGG - Intergenic
1010736547 6:79450343-79450365 AATTCTAGGAAGAAAAGGGCAGG + Intergenic
1011233763 6:85192708-85192730 CATTCTAGGCAGAAAAGGTTGGG + Intergenic
1011899590 6:92275431-92275453 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1013240781 6:108243683-108243705 CATTTTAGGAAGCCGAGGGCGGG + Intronic
1013492396 6:110660931-110660953 AATTCTGGGCAGAAGAGGGTGGG - Intronic
1013995666 6:116304775-116304797 CATTCTAGGCAGATGAGGGCTGG - Intronic
1015009117 6:128322240-128322262 CATTGTAGGCAGCTGAAGTCTGG + Exonic
1016546969 6:145234799-145234821 CATTCTAAGCATAAGAGGCCTGG - Intergenic
1016549009 6:145255870-145255892 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
1017584804 6:155909063-155909085 AATTCTAGGCAGAAAAGGGCGGG + Intergenic
1017998965 6:159561260-159561282 AATTCTAGGCAGAAGGGGGCGGG - Intergenic
1019042263 6:169117148-169117170 AATTCTAGGCAGAAAAGGACAGG + Intergenic
1019043405 6:169124717-169124739 AATTCTAGGCAGAAAAGGGTGGG + Intergenic
1019803642 7:3106541-3106563 CATTCTAAGCAGAAAAGGGAGGG - Intergenic
1019803771 7:3107586-3107608 CATTCTAAGCAGAAAAGGGAGGG - Intergenic
1020029253 7:4921234-4921256 CAGTCCAAGCAGATGAGGTCAGG - Intronic
1020284169 7:6667496-6667518 AATTCTGGGCAGAAGAGGGCGGG + Intergenic
1020739133 7:11990702-11990724 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1020994074 7:15240380-15240402 AATTCTTGTCAGATGAAGGCTGG - Intronic
1021647664 7:22802265-22802287 CATTGAAGGCTGAGGAGGGCTGG - Intergenic
1022440502 7:30429095-30429117 CAATGAAGGTAGATGAGGGCGGG + Intronic
1022563037 7:31369619-31369641 AGTTCTAGGCAGAAAAGGGCAGG - Intergenic
1022591758 7:31670680-31670702 AATTCTGGGCAGAAGAGAGCAGG + Intergenic
1022679678 7:32532430-32532452 TATTCTAGGCAGAAAAGGGTGGG - Intronic
1024808914 7:53184281-53184303 AATTCTAGGCAGAAAAGGGCGGG + Intergenic
1024812519 7:53229614-53229636 AATTATAGGGAGATCAGGGCAGG - Intergenic
1026280963 7:68921498-68921520 AATTCTAGGCAGAAGAGGGTGGG + Intergenic
1026419469 7:70218735-70218757 CATTCTTGGTAGATGGGGCCAGG + Intronic
1026919449 7:74144463-74144485 AATTCTGGGCAGAAGAGGGTGGG + Intergenic
1027484763 7:78747677-78747699 CCTTCTAGTGAGATCAGGGCTGG - Intronic
1030546933 7:110907615-110907637 AATTCTGGGCAGAAGAGGGTGGG - Intronic
1031063472 7:117077355-117077377 AATTCTAGACAGAAAAGGGCAGG - Intronic
1031116336 7:117673038-117673060 AATTCTAGGCAGAAAAGGGCGGG + Intronic
1031696123 7:124857347-124857369 AATTCTACGCAGAAGAGGGCAGG + Intronic
1032248426 7:130232432-130232454 AATTCTGGGCAGAAAAGGGCAGG - Intergenic
1032526401 7:132581240-132581262 CTTTCAAGGAAGATGAGGGGAGG + Intronic
1032702277 7:134392829-134392851 CATTCTGAGCAGATGATAGCTGG - Intergenic
1032797591 7:135290207-135290229 AATTCTAGGCAGAAAAGGGCAGG + Intergenic
1034973898 7:155436836-155436858 CATTCCAGCCAGAGAAGGGCAGG - Intergenic
1035184063 7:157112079-157112101 CGTTCTGGGCAGAGGAGGGCAGG - Intergenic
1037131551 8:15412966-15412988 CATTCTGGGCTACTGAGGGCTGG + Intergenic
1037258489 8:16981609-16981631 AATTCTAGGCAGAAAAGGGTGGG + Intergenic
1037331428 8:17747482-17747504 AATTCTAGGCAGACGGGGGCAGG + Intronic
1039378495 8:37061687-37061709 CATGCTTGGGAGATGAGGGTGGG + Intergenic
1039645567 8:39278395-39278417 AATTCTAGGCAGAAAAGGGTGGG - Intronic
1039661305 8:39470506-39470528 AATCCTAGGCAGAAGAGGGTGGG + Intergenic
1039878019 8:41603879-41603901 CATTCTGTGCAGCTGAGGACTGG - Intronic
1040908349 8:52491876-52491898 AATTCTAGGCAGAAAAGGGTGGG - Intergenic
1042004359 8:64165247-64165269 AATTCTGGGCAGAAGAGGGTGGG + Intergenic
1042445955 8:68885191-68885213 AATTCTAGGCAGAAGAGGGCAGG - Intergenic
1043078015 8:75727114-75727136 TTTTCTAGGCAAAGGAGGGCTGG + Intergenic
1043701397 8:83292234-83292256 AATTCTAGGCACAAAAGGGCAGG - Intergenic
1045762592 8:105628411-105628433 AATTCTAGGCAGAAAAGGGTGGG + Intronic
1047435741 8:124834379-124834401 CATTCTTGGCTGCTGAAGGCAGG + Intergenic
1047535928 8:125719554-125719576 CATTGTAGGATGATGAGAGCAGG - Intergenic
1047615940 8:126562571-126562593 CATCCCAGGCAGATGGAGGCTGG + Intergenic
1048800351 8:138188928-138188950 AATTCTGGGCAGAAGAGGGAAGG + Intronic
1049829636 8:144692223-144692245 CAGAATAGCCAGATGAGGGCAGG - Intergenic
1050158394 9:2692376-2692398 CATTCAAGGCAGATGAGTTTAGG + Intergenic
1050768417 9:9165413-9165435 CATTCTATGCAGATGAAGGTAGG + Intronic
1050944348 9:11499028-11499050 AATTCTGGGCAGAAGAGGACAGG + Intergenic
1052122234 9:24731555-24731577 AATTCTAGGCAGATGGGGGTGGG - Intergenic
1052518746 9:29515155-29515177 CGTTCTAGGCAGAAAAGGGCAGG - Intergenic
1052593706 9:30531561-30531583 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1053545418 9:39018138-39018160 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1053632534 9:39958748-39958770 AATTCTGGGCAAAAGAGGGCAGG - Intergenic
1053773226 9:41504783-41504805 AATTCTGGGCAAAAGAGGGCAGG + Intergenic
1053809748 9:41839836-41839858 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1054211354 9:62291949-62291971 AATTCTGGGCAAAAGAGGGCAGG + Intergenic
1054313629 9:63556903-63556925 AATTCTGGGCAAAAGAGGGCAGG - Intergenic
1054620845 9:67347592-67347614 AATTCTGGGCAGAAGAGGGTGGG + Intergenic
1055376171 9:75649750-75649772 TATTCTAGGCAGAAAAGGGTGGG - Intergenic
1056059511 9:82869851-82869873 CATTCTAGGCAGACAGGGGCAGG + Intergenic
1056859350 9:90165395-90165417 CATTCATGGCTGCTGAGGGCAGG + Intergenic
1059732864 9:117074031-117074053 TATTCCCGGCAGGTGAGGGCCGG - Intronic
1059764397 9:117370125-117370147 CCTTTGAGGTAGATGAGGGCGGG + Intronic
1061364958 9:130167878-130167900 CATTTTAAGCTGATGTGGGCAGG + Intergenic
1186033268 X:5392613-5392635 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1186087095 X:6002626-6002648 AATTCTGGGCAGAAGAGAGCGGG + Intronic
1186128674 X:6443089-6443111 AATTCTGGGCAGAAGAGGGCGGG - Intergenic
1187452511 X:19411477-19411499 CATGCAAGGCCCATGAGGGCAGG - Intronic
1188182350 X:27072261-27072283 AATTCTGGGCACAAGAGGGCAGG + Intergenic
1188188311 X:27144245-27144267 AATTCCAGGCAGATAAGCGCGGG + Intergenic
1188527060 X:31098085-31098107 AATTCTAGGCAGACAAGGGTGGG - Intronic
1188553206 X:31383503-31383525 AATTCTGGACAGAAGAGGGCGGG + Intronic
1188554841 X:31399566-31399588 AATTCTGGGCAGAAGAGGGCAGG - Intronic
1189533012 X:41906622-41906644 CCTCCTATGCACATGAGGGCAGG + Intronic
1191057306 X:56254966-56254988 AATTCTAGGCAGAAGTGGGCAGG - Intronic
1193809926 X:86039595-86039617 AATTCTAGGCAGAAAAGGGCAGG + Intronic
1194176257 X:90651714-90651736 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1194878902 X:99225636-99225658 AATTCCTGGCAGAAGAGGGCAGG + Intergenic
1195853274 X:109305862-109305884 AATTCTAGGCAGATAGCGGCAGG - Intergenic
1196300713 X:114047411-114047433 AATTTTGGGCAGAAGAGGGCAGG + Intergenic
1196395962 X:115261814-115261836 AATTCTGGGCAGAAGAGAGCAGG - Intergenic
1196818939 X:119687542-119687564 CATTCAAGACAGATGAGGCCAGG - Intronic
1197288634 X:124627182-124627204 CACTTAAGGCACATGAGGGCAGG - Intronic
1198299793 X:135324073-135324095 CTTTCTGGGGAGAGGAGGGCAGG + Intronic
1199336996 X:146630165-146630187 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
1199991881 X:152992036-152992058 CCCTCCAGGCAGAAGAGGGCAGG + Exonic
1200522882 Y:4232659-4232681 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1202055822 Y:20828437-20828459 CATAAAAGTCAGATGAGGGCTGG - Intergenic