ID: 1014002306

View in Genome Browser
Species Human (GRCh38)
Location 6:116378130-116378152
Sequence CTTCTTTTCTTCAGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 553
Summary {0: 1, 1: 0, 2: 5, 3: 68, 4: 479}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014002306_1014002316 29 Left 1014002306 6:116378130-116378152 CCATCTTCCCTGAAGAAAAGAAG 0: 1
1: 0
2: 5
3: 68
4: 479
Right 1014002316 6:116378182-116378204 AAGGATTTATGGTAAATACAGGG 0: 1
1: 0
2: 1
3: 31
4: 271
1014002306_1014002314 18 Left 1014002306 6:116378130-116378152 CCATCTTCCCTGAAGAAAAGAAG 0: 1
1: 0
2: 5
3: 68
4: 479
Right 1014002314 6:116378171-116378193 CAAGCATCAAGAAGGATTTATGG 0: 1
1: 0
2: 2
3: 11
4: 191
1014002306_1014002315 28 Left 1014002306 6:116378130-116378152 CCATCTTCCCTGAAGAAAAGAAG 0: 1
1: 0
2: 5
3: 68
4: 479
Right 1014002315 6:116378181-116378203 GAAGGATTTATGGTAAATACAGG 0: 1
1: 0
2: 1
3: 11
4: 168
1014002306_1014002313 10 Left 1014002306 6:116378130-116378152 CCATCTTCCCTGAAGAAAAGAAG 0: 1
1: 0
2: 5
3: 68
4: 479
Right 1014002313 6:116378163-116378185 ACTTAAAGCAAGCATCAAGAAGG 0: 1
1: 1
2: 0
3: 17
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014002306 Original CRISPR CTTCTTTTCTTCAGGGAAGA TGG (reversed) Intronic
901353817 1:8625018-8625040 TGCATTTTCTTCAGGGAAGAAGG + Intronic
901561016 1:10070624-10070646 CTTCTTTTGCTCAGGGGACATGG + Intronic
902655179 1:17862120-17862142 CGTCTTTTTTTGAGTGAAGATGG + Intergenic
902655312 1:17863708-17863730 CATCTGTTCTTCAGGGAGTATGG - Intergenic
902740435 1:18434161-18434183 CTTCTTTGCCTCTGGGAGGATGG - Intergenic
904424886 1:30416832-30416854 CTTCTTATCTTCCAGGAAGGAGG + Intergenic
904539449 1:31222984-31223006 CCTCTTTTCTTCAGGGAGGGAGG + Intronic
905250857 1:36647433-36647455 ATTCCTTACTTCAGGGAAAAGGG - Intergenic
906001005 1:42424887-42424909 CTTCTTTTCTTAAGGTCAGATGG + Intergenic
907105762 1:51881134-51881156 CTTCTCTTCTTCAGAGCAGTGGG + Intergenic
907918277 1:58890497-58890519 CTTATATTCTTATGGGAAGACGG + Intergenic
908172305 1:61517461-61517483 CTTTCTGGCTTCAGGGAAGAAGG + Intergenic
908335100 1:63114597-63114619 CATCTTTACTTCAAGGAATAGGG + Intergenic
908845236 1:68317806-68317828 CTGCTTTTCTTCTGGGCACATGG - Intergenic
909147983 1:71962167-71962189 ACTCTTGTCTTCAGGAAAGAGGG - Intronic
909383933 1:75034898-75034920 GTTCTTTTCTTCAAGGCAGCAGG - Intergenic
909732780 1:78915465-78915487 CATCTTGTCTTCAGGGGATAGGG + Intronic
909973458 1:82018788-82018810 TTTCTTTTCTTCAGGGTTGATGG - Intergenic
909984338 1:82142180-82142202 CTTCTTCCCTTCAGGGAGCAAGG + Intergenic
910358603 1:86392333-86392355 CTTCTTTTCCTCTGGGTAGGTGG - Intronic
911326761 1:96477550-96477572 TTTCTTTGTTTCAGGGAACATGG + Intergenic
911778279 1:101842740-101842762 CTGCTTTTCTTCAGTGGAGGGGG - Intronic
912524259 1:110269066-110269088 ATTGTTTTCTTCAGGGCAGCAGG + Intronic
912668160 1:111601628-111601650 CTACCTGTCATCAGGGAAGATGG - Intronic
912939574 1:114033093-114033115 CTTCTGTTCTTCATGGATGGGGG - Intergenic
913297966 1:117340106-117340128 CCTCTGTTCTTGAGGGAAAATGG + Intergenic
914452092 1:147801562-147801584 ATCCTTTTCTTCAAGGCAGATGG + Intergenic
914830346 1:151166456-151166478 CTTCTTTTCTGCAGGGAGTAGGG - Exonic
915249401 1:154577694-154577716 CTTGGTTTCCTCAGGGAAGAGGG - Exonic
915577762 1:156791968-156791990 GTTTTTTTCTTCATGGAAGAAGG + Intronic
917003402 1:170385680-170385702 GTTCTTTTCTTCAAGGCAGTGGG + Intergenic
917619480 1:176781390-176781412 TTTTTTTTTGTCAGGGAAGAAGG + Intronic
918187957 1:182144277-182144299 CTTGTTTTCTTCAGGGGCCAGGG + Intergenic
918443655 1:184594674-184594696 CCTCTTTTCTTCCTGAAAGAAGG - Intronic
919056412 1:192575284-192575306 CTTCTTTTCTGCAGGAAGCAGGG - Intergenic
919210719 1:194480461-194480483 CTTCTTACCTACAGGGAATACGG - Intergenic
919789272 1:201279788-201279810 CTTATTTTCTACAGGAGAGAAGG - Intergenic
919938001 1:202267589-202267611 CTCCTTTTCTGCATGCAAGATGG + Intronic
920212828 1:204340928-204340950 ATTCTTTTGTCCAGAGAAGATGG + Intronic
920268355 1:204743738-204743760 CATCCTTTCTTCTAGGAAGAAGG + Intergenic
920986473 1:210895164-210895186 TTTTTTTTTTTCAGGCAAGAGGG + Intronic
921474449 1:215589575-215589597 CTTCTTTCCTTCTGGGAATCTGG - Intronic
921761431 1:218919579-218919601 CTTCTTTTTTTCAAGACAGATGG - Intergenic
922415588 1:225419380-225419402 CTTCTTCTCTTCTTGGACGAAGG + Exonic
923151659 1:231238933-231238955 CTATTGTTCTTTAGGGAAGAGGG + Exonic
923388589 1:233490741-233490763 CTTCTCTGCTCCTGGGAAGAGGG - Intergenic
1064437527 10:15324252-15324274 CGTCTTTTCCTAAAGGAAGACGG + Intronic
1065963029 10:30749710-30749732 CTGCTTTTCTACAGAGAAGACGG - Intergenic
1067927863 10:50528830-50528852 CTTCTTCTCTTTTTGGAAGAAGG - Intronic
1069457359 10:68563162-68563184 CTTCCTCTCTGCAGGGCAGAGGG + Intronic
1069959459 10:72071078-72071100 CTTCTATGATTCAGGAAAGAAGG + Intronic
1070231886 10:74576529-74576551 CTCATTTTTTCCAGGGAAGAAGG - Intronic
1070232915 10:74589867-74589889 CCTCTTTTTTTCTGGGGAGACGG + Intronic
1070381139 10:75881500-75881522 CTACTTTTCTGCATGGCAGATGG + Intronic
1070612198 10:77940973-77940995 CCTCTTTTATTCAGGGAGGCTGG + Intergenic
1070895426 10:79980031-79980053 CTTCTTTCCTTGAGGGCAGTGGG - Intronic
1071255429 10:83868008-83868030 CTGCTTCTCTCCTGGGAAGAGGG + Intergenic
1072204054 10:93186964-93186986 CTCCCTTTCATCTGGGAAGAGGG + Intergenic
1072522817 10:96243712-96243734 CTTCTTTTATTGAATGAAGAAGG - Intronic
1072640108 10:97205366-97205388 CACTGTTTCTTCAGGGAAGAAGG + Intronic
1073169247 10:101489075-101489097 CTAAGTTTTTTCAGGGAAGAGGG - Intronic
1073677658 10:105666640-105666662 CTTCTATTCTTCTGAAAAGAAGG - Intergenic
1075915926 10:126167057-126167079 CTTGTTTTCTGAAAGGAAGAAGG - Intronic
1076118651 10:127918894-127918916 TATCTTCCCTTCAGGGAAGAGGG + Intronic
1076484209 10:130805364-130805386 ATTCTTATCTTCATGGAAGCTGG - Intergenic
1078001485 11:7500291-7500313 TGGCTTTTCTTCAGGCAAGAAGG + Intronic
1078572725 11:12473511-12473533 CTTGCTTTCCTCAGGGAAGCAGG - Intronic
1079658578 11:23012937-23012959 CTTCTTTTATTCAGAGCAAAAGG + Intergenic
1080260771 11:30347683-30347705 CTTCTTTTATTGTGGCAAGAAGG - Intergenic
1081015996 11:37881510-37881532 CTTTTTTTCTTCTGGGAATGTGG + Intergenic
1081128906 11:39352390-39352412 CTTTTTTACTTCTGGTAAGATGG + Intergenic
1081174605 11:39912217-39912239 CTCCTTTTTTTCAGGGCAGAAGG + Intergenic
1082787635 11:57325499-57325521 CTTTTGTTCTTACGGGAAGAAGG - Intergenic
1083106337 11:60361787-60361809 CTGGTTCTCTTCAGGGAAGGAGG - Intronic
1084851599 11:71945940-71945962 TTTTTTATTTTCAGGGAAGATGG - Intronic
1085114890 11:73922243-73922265 CTACTTTTCTGCTGGGAAGAAGG + Intronic
1085450902 11:76631840-76631862 TTTTTTTTTTTCATGGAAGATGG + Intergenic
1086197358 11:84156495-84156517 GTTTTTTTCTTCAGTGAGGATGG - Intronic
1086407722 11:86513156-86513178 CTTCTTATCTTCAACAAAGAGGG - Intronic
1087222024 11:95556701-95556723 CTTCTATTCATCAGGGCAGCAGG + Intergenic
1087766231 11:102157696-102157718 TCACTTTTCTTCAGGGAAGTGGG + Intronic
1088164352 11:106914863-106914885 CTTTTTTTCTTGTTGGAAGATGG - Intronic
1089434214 11:118449800-118449822 CATCTTTCCTTCTGGGAAGATGG - Intronic
1089454137 11:118616027-118616049 CCTCTTGTCTCCAGGGAGGACGG + Exonic
1090059633 11:123452877-123452899 TTTCATTTCTCCAGGAAAGAAGG + Intergenic
1091176757 11:133565639-133565661 GTTTTTTTCTTCTGTGAAGAAGG + Intergenic
1091265370 11:134266764-134266786 CTTCTTTTCTTCAGAGACAAGGG - Intergenic
1091301904 11:134513354-134513376 CTTCGTCTCTCCAGGAAAGAAGG - Intergenic
1091686441 12:2566199-2566221 CTTCAGTTCTCCCGGGAAGAGGG - Intronic
1092677448 12:10936948-10936970 CATCTTTTTTTAAGGGGAGAGGG + Intronic
1092698212 12:11198055-11198077 CTTCTCTTATTGAGAGAAGACGG - Intergenic
1094152130 12:27296561-27296583 CTTCTTTACTTAAAGCAAGATGG + Intronic
1094666135 12:32522990-32523012 CTTCCCTTCTTCAGTGAAGGAGG + Intronic
1095796939 12:46230174-46230196 TTTCTTTTCTGCAAGGGAGAGGG - Intronic
1097831114 12:64224704-64224726 TTTTTTTTCTTCAGGAAACAAGG - Intergenic
1099116211 12:78627846-78627868 CCTTTTTTCTTCAGGGAGTAGGG - Intergenic
1099264179 12:80423683-80423705 CTTTTTTTCCTCAGGAAAGAAGG + Intronic
1099478497 12:83138619-83138641 CATCTCTTCTTCAGAGTAGAGGG + Intergenic
1099664725 12:85613453-85613475 GTTCTTTTCATCTGGGAATAGGG + Intergenic
1099947076 12:89257070-89257092 ATTCTTATCATCATGGAAGAAGG - Intergenic
1100926514 12:99554611-99554633 CTTCTTTTCTTCATGGATTATGG - Intronic
1101708118 12:107239924-107239946 GTTCTTTACTTAAAGGAAGAAGG + Intergenic
1104166604 12:126236794-126236816 TCTCTTTTCTACAGGCAAGAAGG - Intergenic
1104578936 12:129995018-129995040 CTTCTCTGCTTCAGTGATGATGG - Intergenic
1104936293 12:132366129-132366151 CTTCTTATCTACAGGGCACATGG - Intergenic
1104999589 12:132681271-132681293 CTTCTTTCACTCAGGGATGATGG - Exonic
1105533455 13:21241961-21241983 CTTCTATTATTCAGGAAAAAAGG + Intergenic
1106124565 13:26889664-26889686 TTTCTCTTCTGCAGGGCAGAAGG - Intergenic
1106717636 13:32407704-32407726 GATTTTTTCTTCAGGGAAGATGG - Exonic
1106820543 13:33459594-33459616 CTTCTTTTTCTCATGGAAGTGGG + Intergenic
1107373821 13:39780903-39780925 TTTCTTTTCTTCTTGGAAAATGG + Intronic
1107959868 13:45548181-45548203 TTCCATTTCCTCAGGGAAGATGG - Intronic
1108710446 13:53027861-53027883 TTTTCTTTCTCCAGGGAAGAAGG + Intergenic
1109403099 13:61861024-61861046 CTTCCTTTCTTCAACAAAGAAGG + Intergenic
1110032865 13:70639027-70639049 CTTCTTCTCCTTCGGGAAGAAGG - Intergenic
1110474994 13:75903279-75903301 CTTCTTTTCACCAGGGAAGCTGG - Intergenic
1110655203 13:77989558-77989580 CTTAATCTCTTCAGGGAACAGGG + Intergenic
1111178370 13:84628760-84628782 CTCATTTTTTTCAGGGAAGATGG + Intergenic
1111384980 13:87513479-87513501 CTTCTTTTCTAAAGGAGAGAAGG - Intergenic
1111427019 13:88099312-88099334 CATCTTTTTTTCAAGGTAGAAGG - Intergenic
1111566247 13:90020436-90020458 TTTCTTTTCTCTAGTGAAGAAGG - Intergenic
1112219788 13:97476259-97476281 CTTCTTCACTTCAAGGAAGCTGG - Intergenic
1112553500 13:100445056-100445078 CTGCTTTTATTCATGGTAGAAGG + Intronic
1112783391 13:102926297-102926319 CTTCTTTCTCTGAGGGAAGAAGG + Intergenic
1113078104 13:106488345-106488367 GTTCTTTTCACCTGGGAAGAAGG - Intergenic
1113411016 13:110089926-110089948 CTTCTTTTCTCCAGGAAATATGG - Intergenic
1115848563 14:37567061-37567083 CTTTATTTCTTCGGAGAAGATGG - Intergenic
1116722222 14:48512322-48512344 GTTCTTTGGATCAGGGAAGAAGG - Intergenic
1116933637 14:50715194-50715216 CTTCTTTTTTTTAAGGAGGAAGG + Intergenic
1117580614 14:57147991-57148013 CTACTTTTCTTTTGGGATGATGG - Intergenic
1117961913 14:61171642-61171664 CACCTTTTCTCCAGGAAAGAAGG - Intergenic
1118055041 14:62070805-62070827 CTTCTTTCCTTTTGGGAAGGTGG + Intronic
1118690340 14:68332712-68332734 GTTTTTTTCTTCAGGGAAAGAGG - Intronic
1118865636 14:69701501-69701523 CCTCTTTTGTTCAGGGCAGCAGG - Intronic
1119272738 14:73323984-73324006 CTCCTGCTCTTCAGGGGAGAAGG - Intronic
1119304299 14:73595034-73595056 CTTCTTTTCTTCCAGGTAAAAGG + Exonic
1119417413 14:74482326-74482348 CTCTTTTTCTTCATGGAAAAAGG + Intronic
1119917995 14:78420070-78420092 CTGCTTTTGGGCAGGGAAGATGG + Intronic
1120108776 14:80527889-80527911 CTTCATTTCTTGGGGGAAGAAGG + Intronic
1120766066 14:88327164-88327186 CTTCTGGACTTCAGGGAAGAAGG - Intergenic
1120815187 14:88849312-88849334 GTTCTTTTCTGAATGGAAGAAGG + Intronic
1120862459 14:89267075-89267097 CTTTTTTCCTGTAGGGAAGAAGG - Intronic
1122739399 14:103862804-103862826 CACCTTTTCTTCATGGCAGATGG - Intergenic
1123412769 15:20073523-20073545 GTTCATTTGTCCAGGGAAGATGG - Intergenic
1123522111 15:21080636-21080658 GTTCATTTGTCCAGGGAAGATGG - Intergenic
1123633825 15:22282160-22282182 TGCATTTTCTTCAGGGAAGAAGG - Intergenic
1124463300 15:29913043-29913065 CTTCTTTTCTTCACTGTTGAGGG - Intronic
1125599882 15:40909693-40909715 CTCCTTTCCTTCAGGGAACCAGG - Intergenic
1125718848 15:41835573-41835595 CATCTTTCCTGCAGGGCAGAAGG - Exonic
1126500126 15:49336210-49336232 CCACCTTTCTTCTGGGAAGATGG - Intronic
1126891067 15:53204705-53204727 GATCTTTTCTCCAGAGAAGATGG - Intergenic
1127046779 15:55034420-55034442 TTTGTTTTCTTTAGAGAAGATGG - Intergenic
1127211209 15:56776789-56776811 CTGGTTTGCTTTAGGGAAGAGGG - Intronic
1127375323 15:58379009-58379031 CTTCTTGTCTTAAGGGTAGCAGG - Intronic
1128147942 15:65343189-65343211 TATCTGTTCTTGAGGGAAGATGG + Intronic
1128386323 15:67151243-67151265 TTTCTTTTCTTTGGAGAAGAGGG + Intronic
1128617383 15:69120921-69120943 CTTATTATCTGGAGGGAAGATGG + Intergenic
1129815008 15:78544175-78544197 CTTTTTTTCTTCAAGGGACATGG + Exonic
1130192099 15:81747206-81747228 CATCTTGCCTTCTGGGAAGAAGG - Intergenic
1130213418 15:81946667-81946689 CACCTTTTCTGCAGGGCAGATGG + Intergenic
1130375688 15:83326719-83326741 TTTGTTGTCTTCAGGGAAAAGGG + Intergenic
1131294693 15:91136719-91136741 CTTCCTTCCCTCAGGGAGGAGGG + Intronic
1131411162 15:92209409-92209431 CTTCTTTCCTTCTGGGCAGGGGG - Intergenic
1131778357 15:95826958-95826980 TTTCTTTTCTTCAGGTCTGATGG - Intergenic
1133264800 16:4576498-4576520 CTTCTTGTCTTCAGGGCTCATGG - Exonic
1133638102 16:7689606-7689628 ATTCTTATCTTCAGGGAAGTTGG + Intronic
1134752088 16:16633452-16633474 TTTCTTTTCTCCCAGGAAGAGGG + Intergenic
1135391869 16:22100402-22100424 CTTTGCTTCTTCAGGGAGGAGGG + Exonic
1135636202 16:24077729-24077751 CTACTGTTGTTCAGGGATGAAGG - Intronic
1136473668 16:30498542-30498564 TTTCTCTTCTTCATGGAAAATGG + Intronic
1136610677 16:31363151-31363173 CTTTTTTTCTGCAGTGGAGAAGG + Exonic
1136865001 16:33741317-33741339 ATTATTTTCCTCAGGGAAGAAGG - Intergenic
1136865130 16:33743192-33743214 ATTATTTTCCTCAGGGAAGAGGG - Intergenic
1138096393 16:54215213-54215235 CCGCTTTCCTTCAGGGAAGCAGG + Intergenic
1138217719 16:55219245-55219267 CTTGCTATCTTCAGGGCAGAGGG - Intergenic
1138589398 16:57991516-57991538 CTTCTGTCCATCTGGGAAGATGG + Intergenic
1138695280 16:58807282-58807304 CTTCTTTTCACCAGGGAATTAGG - Intergenic
1139734165 16:68973034-68973056 CTGCTCATATTCAGGGAAGAAGG + Intronic
1140562497 16:75999571-75999593 ATTCCTTTCTTCAGCCAAGATGG + Intergenic
1203126499 16_KI270728v1_random:1589460-1589482 ATTATTTTCCTCAGGGAAGAGGG - Intergenic
1142725692 17:1812026-1812048 CCTCTTTTCTACAGAGAAGAAGG - Exonic
1143417170 17:6758656-6758678 CATCTCTCCTGCAGGGAAGATGG - Intronic
1143417217 17:6758847-6758869 CATCTCTCCTGCAGGGAAGATGG - Intronic
1143417253 17:6758990-6759012 CTTCTTTCTTGCAGGGAGGATGG - Intronic
1144994712 17:19259685-19259707 CTTCATTTAATCAGGGAACAGGG - Intronic
1145051072 17:19661281-19661303 CTCCTTTTCCTATGGGAAGATGG + Intronic
1145200934 17:20944203-20944225 CTTCCTCCCTTCAGGGAAGTGGG + Intergenic
1145256976 17:21330783-21330805 TTTCTTTCCCTTAGGGAAGAGGG + Intergenic
1145843070 17:28012731-28012753 CTTCTTTGCAACAGGAAAGATGG - Intergenic
1145889330 17:28404074-28404096 CTTCTTTTTTTGATGGGAGAGGG - Intronic
1146022163 17:29289137-29289159 TTTCTTTTCTTCTTGAAAGAGGG - Intronic
1146643163 17:34556196-34556218 CTTATTTTCCTCTGGGAAGCTGG - Intergenic
1146850443 17:36217067-36217089 TTAATTTTTTTCAGGGAAGATGG + Intronic
1147322035 17:39652456-39652478 CTTCCTTTCTTCAGTGAAGTGGG - Intronic
1147412184 17:40261625-40261647 CTTCCTTTATTCAGGGCAAAGGG - Intronic
1147686744 17:42290458-42290480 CTTCTTTACTTGAGGGGAGTGGG + Intronic
1147915314 17:43882172-43882194 CTGGTTTCCTCCAGGGAAGATGG - Intronic
1148609723 17:48956637-48956659 TTTCTTTTCTTCATGTCAGAAGG + Intergenic
1151020861 17:70615900-70615922 CTTCTTTTGTTCAGATAACATGG - Intergenic
1152105332 17:78325373-78325395 CTTCTTTATTTCAGGGAAGAGGG + Intergenic
1153539286 18:6136458-6136480 CTGCTTTTCTGCATGAAAGATGG + Intronic
1153862687 18:9229894-9229916 CATCTTTTCATCAGGGATGTTGG + Intronic
1153892615 18:9532360-9532382 CTTCTTTTCTCTAGGTCAGAGGG + Intronic
1154462104 18:14601855-14601877 TTTCATTTCTTTATGGAAGAGGG - Intergenic
1155170469 18:23263346-23263368 CTTCTCCTCTGCAGGGAAAAGGG - Intronic
1155273354 18:24162623-24162645 TTTTTTTTCTTCTTGGAAGATGG + Exonic
1155768298 18:29665816-29665838 CTTGTTTTCTTCTCGTAAGAAGG - Intergenic
1156869456 18:41928656-41928678 CACCTTTTCTTCATGGAACAGGG + Intergenic
1157158339 18:45289102-45289124 TTTCTTTTCTACAGGAAAGGTGG + Intronic
1157371410 18:47115928-47115950 ATCTTTTTCTTCAGGAAAGATGG - Intronic
1158066810 18:53420399-53420421 CTTCTTTATTTCAGGAAACAGGG + Intronic
1158260119 18:55597393-55597415 CTCCTTTTCTTTGGGGGAGAGGG - Intronic
1158639384 18:59190388-59190410 CCTCTTTTTTTCATGGTAGATGG + Intergenic
1159114627 18:64100147-64100169 TTTTTTTTCTTCAGGGGAGATGG + Intergenic
1160237247 18:77095673-77095695 CTGCTGTTCTCCAGGGAGGATGG + Intronic
1160630767 18:80245825-80245847 CTTCTGTGCTCCAGAGAAGATGG + Intronic
1161413576 19:4131475-4131497 TTTCTTTTCTTTAGAGAAGGGGG - Intergenic
1162639534 19:11997231-11997253 CTTCCTTTCTTTGGGGAGGAAGG - Intergenic
1162871194 19:13588029-13588051 TTTCTTTTCTTAAGGGAGGCAGG - Intronic
1164457719 19:28422356-28422378 CTTACTTTCTTCATGGCAGATGG - Intergenic
1164596369 19:29533125-29533147 CTCCATATCTTCTGGGAAGAAGG - Intronic
1165604651 19:37091328-37091350 CCTTTGTTCATCAGGGAAGATGG - Intronic
1166526927 19:43516992-43517014 TTTTTTTTCTTCAGTAAAGATGG + Intronic
1167193448 19:48008637-48008659 CTTCTTTTCCACAGAGAAGAGGG + Exonic
1167202415 19:48075120-48075142 CTTATTTTCTTCAGGGTTGGAGG + Intronic
1168442981 19:56387600-56387622 TTTCTTTTTTGCAGGGGAGATGG + Intronic
925274462 2:2638802-2638824 CTTCATTTCTGCAGAGAAGCTGG + Intergenic
925295371 2:2772922-2772944 TTTCTTCCCTTCAGGGAGGATGG - Intergenic
925430987 2:3792896-3792918 CTTCATATCTTCAGGGAACCTGG + Intronic
926089318 2:10040163-10040185 CTTCTTTCCTGCAGGACAGAAGG - Intergenic
926447199 2:12957438-12957460 CTTTTGTTCTGTAGGGAAGATGG + Intergenic
926465988 2:13189175-13189197 CTATTTTTTTTCATGGAAGAAGG - Intergenic
926726128 2:15999413-15999435 CTTCTTTTCTCCAGGGAAAATGG + Intergenic
926750266 2:16193374-16193396 CTTATTTCCTTCAGGGAAGTGGG + Intergenic
926834853 2:17007190-17007212 CTTCTGTTTCTCAGGGAATAGGG - Intergenic
926885284 2:17592056-17592078 TTGCTTTTCTTCAGGCAGGATGG + Exonic
927874265 2:26644248-26644270 CTTCTTTGCTCTAGGGAAGGCGG + Intergenic
928008409 2:27583567-27583589 CTTCATTTCTTCTGGGCATAGGG + Intronic
929040007 2:37735468-37735490 CTTTTTTTTTTTAGGGAAGATGG - Intronic
929254886 2:39799478-39799500 TGACATTTCTTCAGGGAAGATGG - Intergenic
929573122 2:43035545-43035567 CCTCTTATCTTCAGGGGACATGG - Intergenic
930693650 2:54389666-54389688 GTTCCTTTCTCCAGGAAAGAGGG - Intergenic
930842994 2:55868514-55868536 GTTCTCTTTTCCAGGGAAGATGG + Intronic
931733120 2:65170617-65170639 CTTTGTTTCCTCAGGGAGGAAGG + Intergenic
932174477 2:69586961-69586983 CTTCTAATCTTCAAGGAACAAGG + Intronic
933544816 2:83696452-83696474 CATCTGTTCTAAAGGGAAGAAGG - Intergenic
934115209 2:88783367-88783389 CTTATTCTCCTCAAGGAAGAGGG + Intergenic
934633519 2:95958127-95958149 ATTATTTTCCTCAGGGAAGAGGG - Intronic
934633645 2:95960009-95960031 ATTATTTTCCTCAGGGAAGAGGG - Intronic
934799981 2:97145151-97145173 ATTATTTTCCTCAGGGAAGAGGG + Intronic
934802590 2:97180375-97180397 ATTATTTTCCTCAAGGAAGAGGG + Intronic
934802977 2:97185949-97185971 ATTATTTTCCTCAAGGAAGAGGG + Intronic
934833223 2:97554598-97554620 ATTATTTTCCTCAAGGAAGAGGG - Intronic
934833606 2:97560201-97560223 ATTATTTTCCTCAAGGAAGAGGG - Intronic
935620414 2:105125331-105125353 TTTCCTTGCTTCAGGGAAGAGGG - Intergenic
935810727 2:106794523-106794545 CTTCTTTACTGCAGAGTAGAGGG + Intergenic
936637979 2:114281071-114281093 ATTTTTTTCTTCAGGTCAGATGG + Intergenic
936656203 2:114490431-114490453 CTAATTTCCTTGAGGGAAGAAGG + Intronic
937426597 2:121804969-121804991 CTTCCTTTCTTCCTGGGAGAGGG + Intergenic
937564156 2:123263125-123263147 CTTCTTTCCTTCATGCAAGGTGG - Intergenic
937665330 2:124480886-124480908 CTTCCTTTCTTCAGGAAAATTGG + Intronic
940328021 2:152445345-152445367 CTTCTCTTATTCTGGGAGGAGGG - Intronic
940369807 2:152888639-152888661 CTTCTTTTCTTCAGTTAATTTGG + Intergenic
941604502 2:167580572-167580594 CTGCATTTCTTCAGGGAGGCTGG - Intergenic
942646779 2:178120123-178120145 CTTCTTTGCTTTCTGGAAGATGG - Intronic
942761098 2:179399293-179399315 CTTCTTTCCTTTAGGGTACAAGG - Intergenic
943065990 2:183086640-183086662 TTTTTTTTTTTCAGAGAAGAGGG - Intronic
944271848 2:197793031-197793053 CTTCTGTTGTTTATGGAAGAGGG - Intergenic
944958589 2:204841714-204841736 TTCCTCTTCTACAGGGAAGATGG + Intronic
944994980 2:205283838-205283860 CTGGCTTACTTCAGGGAAGAGGG - Intronic
945973422 2:216252377-216252399 CTGCATTTCTTCTTGGAAGAGGG + Intergenic
946358385 2:219203779-219203801 CTTCTTTTATTCAGGAAGCAAGG + Intronic
1168795747 20:609426-609448 CTTCCTTCCTGCTGGGAAGACGG - Intronic
1170434918 20:16316481-16316503 CTTTTTTTCTTTTTGGAAGATGG - Intronic
1170523019 20:17207779-17207801 CTTGTCTTCTTAAGGGAAGCTGG + Intergenic
1172348163 20:34220969-34220991 TTTTTTTTCTTCAGTGAAGGAGG + Intronic
1173712993 20:45176611-45176633 CTTCTTCTCTCCAGTGAAGAGGG + Intergenic
1174609799 20:51789875-51789897 TTTCTTTACTTCTGGGTAGAGGG - Intronic
1175509266 20:59511539-59511561 CTTGTTTTCCTCTGGGTAGATGG + Intergenic
1176812457 21:13556775-13556797 TTTCATTTCTTTATGGAAGAGGG + Intergenic
1176928177 21:14775414-14775436 CTTCTCTTCTTCAGGGAGTCTGG - Intergenic
1180017857 21:45098967-45098989 TTTCTGCTCTACAGGGAAGAAGG - Intronic
1180228750 21:46413789-46413811 CTTCTTTTCCCCGGGGAAGGAGG + Intronic
1180631263 22:17231709-17231731 TTTCTTTTCTGCGGGGAAAAGGG + Intergenic
1180858356 22:19062365-19062387 CCTCTTTTCTCCAGGGAAGCCGG + Intronic
1182053437 22:27330819-27330841 CATCTTTTTGTCAGGGAAGCCGG - Intergenic
1182085381 22:27557597-27557619 CTTTTCTTCTTTAGGGAGGAAGG - Intergenic
1183291992 22:37008433-37008455 CTTCTTTTCTGCAGAGAAGAAGG + Intergenic
1183750501 22:39717582-39717604 ATTCTTTACTCCAGGGAAGCTGG - Intergenic
1184871110 22:47239050-47239072 ATTCTTTTCTTCAGAGAAAATGG - Intergenic
949228902 3:1727285-1727307 CAGTTTTGCTTCAGGGAAGAAGG - Intergenic
949686566 3:6579244-6579266 CTTATTTTCTGCAGATAAGAAGG + Intergenic
950875640 3:16269287-16269309 CTTCTTTCTTTCAGGGATTAAGG + Intronic
951929770 3:27952246-27952268 CTTCTTTCCTTCAAGGCAGAAGG + Intergenic
951961691 3:28331861-28331883 CTTCTATTCTTATGCGAAGAGGG + Intronic
953182463 3:40608766-40608788 CTTCATGTCCTCAGTGAAGATGG + Intergenic
953686049 3:45079249-45079271 CTTCTGTTCCCCACGGAAGAGGG - Intergenic
953737325 3:45507292-45507314 CTTCCTTACTACATGGAAGATGG - Intronic
953892233 3:46760123-46760145 CTTCTTTTTCTCATGGCAGAAGG - Intronic
953988690 3:47466439-47466461 TTTCTTTTTTTCAGGTTAGATGG - Intronic
955429057 3:58822918-58822940 GTTCCTTTCTTCAGGGGATAGGG - Intronic
955666815 3:61358105-61358127 TTTTTTTTTTTCAGGGTAGATGG - Intergenic
955702639 3:61697144-61697166 CTGCTTTTCTTCACTGAAGTAGG + Intronic
955849902 3:63209018-63209040 ATTCTTTTCATCAAGGAATAAGG - Intergenic
956028524 3:65010453-65010475 CTTCTTTTCCTCAGACCAGAAGG + Intergenic
956234888 3:67058699-67058721 CTGCTTTTCTTCATGGCAGAAGG + Intergenic
956541095 3:70340558-70340580 CTGCCTTCCTTCAGGGAACATGG + Intergenic
956881221 3:73512533-73512555 CTTTTTTTTTTCCGGGGAGAAGG + Intronic
957085757 3:75675164-75675186 GTTCTTTTCTTCAAGGCAGCAGG + Intergenic
957616258 3:82531441-82531463 CTTTTTTTTTTCAGGGGAGGGGG - Intergenic
957760248 3:84547071-84547093 TTTCTTTTCTTCAAGGATGCTGG + Intergenic
957858440 3:85909879-85909901 ATTCATTTCTTTGGGGAAGAAGG + Intronic
958901725 3:99895030-99895052 CTACTTTTCTTCAGGTTAGTTGG - Intronic
959327467 3:104955887-104955909 CTTGTTTTTTTCAGCTAAGAGGG + Intergenic
959412776 3:106046159-106046181 CTTCTTACATTCAGGAAAGAAGG - Intergenic
959731081 3:109603310-109603332 CTTCTTTTTCTCTGGGTAGAGGG - Intergenic
960255949 3:115511894-115511916 CTTCTTTGCTTCCAGGAATAGGG + Intergenic
960656664 3:120011972-120011994 CTTCTTTTTTTAAGGGGAAATGG - Intronic
960813353 3:121647501-121647523 CTTCCATTTTTCTGGGAAGATGG - Intronic
961239062 3:125394505-125394527 TTTCTTTTCTTATGGGAAGCGGG - Intergenic
962989672 3:140566550-140566572 GTTTTTTCCTGCAGGGAAGAAGG + Exonic
963419868 3:145048108-145048130 CTCCTGTTCTACAGGGAAGAAGG + Intergenic
963680248 3:148365313-148365335 CTTCTTTTCTTCCCGAAAGAAGG - Intergenic
963733486 3:148993349-148993371 CTGCTTTTCTTTGGAGAAGAAGG - Intronic
964209332 3:154210382-154210404 GTTCTTTTCTTCAAGGCAGCAGG + Intronic
964627809 3:158776255-158776277 CACCTTTTCTACAGGGCAGATGG - Intronic
965013057 3:163121867-163121889 CTCTCTTTCTTCAAGGAAGAGGG + Intergenic
966369312 3:179231301-179231323 CTTCTTTTCCTCTGGGTAGAGGG + Intronic
967450595 3:189618559-189618581 CCTCTGTTCTTGAGGGTAGAGGG + Intergenic
968376561 4:47774-47796 GTTCTTTTCCCCAGGTAAGAGGG + Intergenic
969137396 4:5041152-5041174 GTCCTTTTCTTCAGGGAAATGGG + Intergenic
970587550 4:17529031-17529053 TTTTTTTTCTTCAGGTCAGATGG - Intergenic
970745897 4:19294903-19294925 CTTCATTTCTTTTGGGAAGGTGG - Intergenic
970898733 4:21133953-21133975 ATTCTTTCCTCCAGGGCAGAAGG - Intronic
971130198 4:23799868-23799890 CTTATTTTCTTCAGTGATGAAGG - Intronic
971850184 4:31975390-31975412 GTTCTTTTCTTCTGGGAATGGGG + Intergenic
972474109 4:39434442-39434464 CTTCTCTGCTTCAGAGAAAATGG - Exonic
972978159 4:44662871-44662893 CTGCTTTTGTTCATGGCAGAAGG - Intronic
974586731 4:63889437-63889459 CTTCCTTTCCTCAGTGAGGAAGG - Intergenic
975084546 4:70322126-70322148 CTTTTTGTCTTCAGGGACAATGG - Intergenic
975335430 4:73170335-73170357 GTTCTTTTCTTCAAGGGAGCAGG - Intronic
976224257 4:82782647-82782669 CTTGTTTTCTTGGGGGAGGATGG - Intronic
976646650 4:87394355-87394377 CTTTTTTGCGTTAGGGAAGAAGG - Intergenic
977552323 4:98455526-98455548 CTTCTTTTCTTCTGGGTAGATGG - Intergenic
977608213 4:99004224-99004246 CTTCATTCCTTCAGGGTATATGG + Intronic
978223400 4:106304643-106304665 CTGATTTTCTTCAGGGAGAAAGG - Intronic
978254479 4:106677766-106677788 GTACTTTTCTTCTGGGCAGAGGG - Intergenic
978963314 4:114710548-114710570 GTTTTTTCTTTCAGGGAAGAGGG + Intergenic
979870883 4:125820257-125820279 CTAATTTTATTCAGGGAATAAGG - Intergenic
979936029 4:126697388-126697410 TTTCTTTTCCTGGGGGAAGAAGG - Intergenic
979978761 4:127228540-127228562 CTTTCTTTCTTCTGGGAAGTGGG + Intergenic
980638773 4:135544505-135544527 CTCCATTTCTCCAGTGAAGAAGG + Intergenic
980964099 4:139503698-139503720 CTTATTTTCCTCAGAGAAGAAGG - Intronic
981209438 4:142085214-142085236 CTTACTTTCTTCTGGGAAAAAGG - Intronic
982686585 4:158497497-158497519 GTTCTTTTCCTCAGGAGAGAAGG + Intronic
983111738 4:163758584-163758606 CTTCTGTCCTTCAGGGAAATTGG - Intronic
983530134 4:168801988-168802010 GTTCTCTTCTTCATGGAACATGG - Intronic
984666627 4:182436174-182436196 CTTCTTTGCTTAAGGGAGTATGG + Intronic
984754710 4:183314384-183314406 CTTCGTATCTTAAGGGAAGCTGG - Intronic
984872258 4:184336253-184336275 TTTTTTTTTTTCAGGGAGGAGGG - Intergenic
985444256 4:190012361-190012383 GTTCTTTTCTTCAAGGCAGCAGG - Intergenic
985826597 5:2196419-2196441 CTTCTTTTCTTCAGCAAAACAGG - Intergenic
987125053 5:14804200-14804222 CTCCTTTTCTACAGAGACGAAGG + Intronic
987725106 5:21687950-21687972 GAGCTTTTATTCAGGGAAGAAGG - Intergenic
988538131 5:32087153-32087175 CATCTCTTCCCCAGGGAAGAAGG + Exonic
988918725 5:35921387-35921409 CTTCTTTTATGGATGGAAGAGGG - Intronic
989468863 5:41791612-41791634 CTTCTTCCCTTCGGGGAACATGG - Intronic
990363642 5:55047317-55047339 CTTCATTACTGCTGGGAAGATGG + Intergenic
991142399 5:63259950-63259972 CTTTTGTTCCACAGGGAAGAAGG + Intergenic
991330373 5:65486587-65486609 CTTCATTTCTTAAACGAAGAAGG - Intergenic
991395765 5:66203761-66203783 CTTTCTTGCTTCAGAGAAGACGG - Intergenic
991400760 5:66248971-66248993 CTTCTTTTTTTCTGGCAATAAGG - Intergenic
991911241 5:71563446-71563468 CTTATTATATTCAGGGAAAAAGG + Intronic
991984671 5:72272399-72272421 CTTCTTTCCTTCTGGGATTATGG + Intronic
992280394 5:75169442-75169464 CTGCTTTTCTGCAGAGATGAGGG + Intronic
992338875 5:75801013-75801035 CCTCTTGGCTTGAGGGAAGAGGG + Intergenic
992630297 5:78673645-78673667 CTTGTTTTCCTCTGGGAAGCAGG + Intronic
992757955 5:79926656-79926678 CTACTTTCCTTCAGGAAAAAAGG + Intergenic
992789589 5:80201493-80201515 GTTCATATCTTCAGGGAAGCAGG - Intronic
993733291 5:91447255-91447277 CCTAGTTTCTTCAGGGAGGAAGG + Intergenic
993976215 5:94485092-94485114 TATCTTTTCTTCTGGGAAGCTGG + Intronic
994102461 5:95908872-95908894 CTTCTTTCTTTCTGGGAAGGGGG + Intronic
994429488 5:99639291-99639313 TACCTTTCCTTCAGGGAAGAAGG + Intergenic
994477693 5:100291162-100291184 GTTCTTTCCTTCAAGGCAGAGGG + Intergenic
994879327 5:105467294-105467316 CTTCATTTCTCCAAGGAAAAGGG + Intergenic
994955294 5:106523231-106523253 TTTTTTTTCTTCAGGCCAGAAGG - Intergenic
995116524 5:108486757-108486779 CTTCTAATCTGCAGTGAAGAGGG + Intergenic
995293233 5:110485122-110485144 CTTCTTTTCTTCTGGGTAGTAGG - Intronic
996142227 5:119925972-119925994 TTTCTTTTATTAAGGGAACATGG - Intergenic
996478929 5:123951325-123951347 TTTCATTTCTGCAGGAAAGAAGG - Intergenic
996558568 5:124803931-124803953 CTTCCTTCCTTCAGGAAGGAAGG + Intergenic
997527925 5:134565435-134565457 CTTTTTGTCCTCTGGGAAGAGGG - Intronic
998639836 5:143997021-143997043 CCTCCTTTGCTCAGGGAAGATGG - Intergenic
998733639 5:145109731-145109753 CCTCTTTTCTTCAGAGAAAGTGG - Intergenic
998928187 5:147150948-147150970 CTTGTTTTCTTCATAGAAGCAGG - Intergenic
999685345 5:154097780-154097802 CATCATTTCTTCTGGGTAGACGG - Intronic
999816857 5:155185517-155185539 TTGCTTGTCTTCATGGAAGAGGG + Intergenic
999871785 5:155758900-155758922 TTTCTTGTCCTCAGGGAAGTTGG + Intergenic
999936957 5:156497216-156497238 CTTCTGTTATTGAGGAAAGATGG + Intronic
1000369991 5:160525884-160525906 CTTCATTTCTCCAGGGGTGATGG + Intergenic
1000456568 5:161456620-161456642 CCTCATTTCTTCATGTAAGATGG + Intronic
1001631922 5:173181916-173181938 CCTCCTTTCTTTAGGGAAGTGGG + Intergenic
1002157600 5:177295194-177295216 CTTCTTTTCTTCAGTGGGGAGGG - Exonic
1002367813 5:178726923-178726945 CCGCTTTTATTCAGGGAAGGAGG + Intronic
1002385834 5:178866424-178866446 CTGCTTTTATTCAGGGAAGGAGG - Intronic
1002622555 5:180498808-180498830 CTTCTTTTTTTCTGAGATGAAGG + Intronic
1002775383 6:323977-323999 CTTTTCTTCTTCAGGGCATAGGG - Intronic
1002960728 6:1912570-1912592 TTTCTTTTTTTAAGGGAAGGTGG - Intronic
1003178292 6:3770361-3770383 CATCTTTTCTTTAAGGAAAAGGG + Intergenic
1003388804 6:5694385-5694407 CTTCTATTATTCAGGAAAAAAGG - Intronic
1004484038 6:16048781-16048803 CTCCTTTTCTTCATGGAAACTGG - Intergenic
1004965674 6:20848204-20848226 CATCTTTTCTGCAGGGCAGATGG - Intronic
1005361657 6:25036802-25036824 CTCCTGTTCTTCTGGGAAAATGG - Intronic
1006092508 6:31636406-31636428 CATCGTTGCTTCAGGTAAGAGGG + Exonic
1007201059 6:40109497-40109519 TTGCTTTTCTTCAGGGTTGATGG + Intergenic
1007461913 6:42025361-42025383 CCTCTTTGCTCCAGGAAAGAAGG - Intronic
1007983285 6:46180826-46180848 CTGCTTTTCTTGAGGGGAGAGGG + Intergenic
1007993133 6:46278111-46278133 CATCTTTTGTTCAAAGAAGAGGG - Intronic
1009036009 6:58117800-58117822 CACCTTTTCTGCAGGGCAGATGG - Intergenic
1009211827 6:60871401-60871423 CACCTTTTCTGCAGGGCAGATGG - Intergenic
1009738061 6:67704976-67704998 CATGTTTTCTTTAGGGAAGATGG - Intergenic
1009897905 6:69775585-69775607 ATTGTATTCTTCAGGGAGGAGGG + Intronic
1010018724 6:71135334-71135356 TTTCTTTCCTTCAGGGCAGTGGG - Intergenic
1010272455 6:73929558-73929580 CATCTTTTCTGGAGGGAACATGG + Intergenic
1012672346 6:102070194-102070216 CTTCTTTTCTTCAGGTAGTTGGG - Intergenic
1013342012 6:109224217-109224239 CTCATTTTCTTCTGGGAAGTTGG - Intergenic
1013975847 6:116077699-116077721 CTTCTTTCTTTCAGAGAAAATGG + Intergenic
1014002306 6:116378130-116378152 CTTCTTTTCTTCAGGGAAGATGG - Intronic
1014179052 6:118364803-118364825 TTTCTTCTTTTCAGGGAAGCGGG - Intergenic
1014806072 6:125831186-125831208 CTACTTTTCTTAAGGTAAGATGG - Intronic
1015159726 6:130139141-130139163 TTTCTTTTCTTCATGGTGGAAGG + Intronic
1015561399 6:134520168-134520190 TTTTTTTTTTTCAGGGAGGAAGG + Intergenic
1015601464 6:134915158-134915180 CTTCTTTTCTTCAGAAAATGGGG - Intergenic
1015847945 6:137541025-137541047 CTTTTTTGCTTCTGGAAAGATGG + Intergenic
1015926082 6:138311666-138311688 TTTCTTTCCTTCATGGAAAAAGG - Intronic
1016581479 6:145633415-145633437 CTTTTTTTCTTCCTTGAAGAAGG + Intronic
1016832368 6:148446411-148446433 GTTCTTTTCTTAAGGAAAGAGGG + Intronic
1017220621 6:151961668-151961690 CTTCAGTTCTTCAGGGAATTGGG + Intronic
1017578445 6:155833320-155833342 CTTCTTATTTTAAGAGAAGAGGG + Intergenic
1018738660 6:166710629-166710651 CTTCTTCTCTTCCAGGAAGATGG + Intronic
1020639395 7:10736592-10736614 TTTCTTTGCTTCAGAGAAGGTGG + Intergenic
1020661351 7:10987289-10987311 TTTCTTATCTTCAGGGCAGTAGG + Intronic
1021180101 7:17496172-17496194 CTTCCTGTCCTCAGGGGAGATGG + Intergenic
1021250434 7:18318663-18318685 ATTCTTTTCTTGAGAGACGAAGG + Intronic
1021263978 7:18496113-18496135 CTGCTTCTCCTCAGGGAGGAGGG + Intronic
1021421895 7:20454989-20455011 CTTCATTTCTTGACGTAAGAAGG + Intergenic
1021481035 7:21117329-21117351 CTTTTTGTCTTTAGGGGAGAAGG - Intergenic
1021507066 7:21397619-21397641 CTTCTTTTCTTCTATGAAGAAGG - Intergenic
1021704554 7:23353831-23353853 CTTTTTTTCTTAAGGGAATGTGG + Intronic
1022157749 7:27677399-27677421 CTTCTTTTCTTCTGGGGGGAGGG - Intergenic
1022957349 7:35393398-35393420 CTTCTTTTCTTCAAGGCAGAAGG + Intergenic
1023203681 7:37725156-37725178 GATCTTTTCTTCTTGGAAGAAGG + Intronic
1023716230 7:43046869-43046891 GTTCTTTCCTTCAAGGCAGAAGG - Intergenic
1025195992 7:56934193-56934215 CTTTTTTTCTTCTGGGCAGTAGG - Intergenic
1025675956 7:63642743-63642765 CTTTTTTTCTTCTGGGCAGTAGG + Intergenic
1025733084 7:64123590-64123612 GGGCTTTTCTTCAGGGAAGGCGG + Intronic
1026266240 7:68798291-68798313 GGGCTTCTCTTCAGGGAAGACGG + Intergenic
1027112604 7:75452821-75452843 CTCCACCTCTTCAGGGAAGAGGG - Intronic
1027284850 7:76637427-76637449 CTCCACCTCTTCAGGGAAGAGGG - Intergenic
1027443499 7:78245809-78245831 CTTCTTTTCTGGAGGGAGCATGG - Intronic
1027799362 7:82732774-82732796 GTTCTTTCCTTCAGGGCAGTGGG - Intergenic
1029093682 7:98068412-98068434 TTTCTTTTTTTCAGTAAAGAAGG + Intergenic
1030214752 7:107032810-107032832 ATTCTTTCCTTCTGGGTAGAGGG - Intergenic
1032691468 7:134291553-134291575 CTTCTCTTCTTCTGGAAAGATGG - Exonic
1032729065 7:134619639-134619661 CTTCTTTCCTTCAGAGGAAAAGG + Intergenic
1032801942 7:135323965-135323987 CTGCTGTTCCTCAGGAAAGAAGG + Intergenic
1032997313 7:137462417-137462439 CTTATTTTCTTGTGTGAAGACGG - Intronic
1033230217 7:139591491-139591513 CTTGCTTTCCACAGGGAAGAAGG - Intronic
1034684581 7:152958951-152958973 CTTTTTCTCTGCAGGGGAGATGG - Intergenic
1035858522 8:3002926-3002948 TTTTTTTTCTTCAGGCAAGGAGG - Intronic
1036048555 8:5170428-5170450 CTTATTTTCTGCAGTGGAGAAGG + Intergenic
1036217261 8:6891164-6891186 CGTTTCTTCTTCTGGGAAGAGGG - Intergenic
1036683337 8:10892110-10892132 CTTTTTTTCCCCAGTGAAGAGGG + Intergenic
1036806449 8:11837645-11837667 CTTTTTTTCTCCAGGTGAGAGGG + Intronic
1037601543 8:20400394-20400416 CTTCTTTTCCACAGGGAAGTGGG + Intergenic
1038085145 8:24187955-24187977 TTGCTTCTCTTCAGAGAAGAAGG - Intergenic
1038285723 8:26204713-26204735 TTTCATTTCTTTTGGGAAGAGGG - Intergenic
1038970679 8:32630734-32630756 TTTTTTTTTTTCAGGCAAGATGG + Intronic
1039270080 8:35870308-35870330 CTTCTTTTCCTCAGGGTACATGG - Intergenic
1039683138 8:39764402-39764424 CTTCTTTTTTGAGGGGAAGAGGG - Intronic
1040636886 8:49285511-49285533 CTTTTTTTCTGCTGGGAAAATGG - Intergenic
1041765678 8:61415740-61415762 CTTCATCTCTTCAATGAAGAGGG - Intronic
1043068248 8:75603793-75603815 CTTCTTTTCATGAGAGTAGATGG + Intergenic
1043229348 8:77781258-77781280 TTTTTTTTTTTCAGGGAACATGG + Intergenic
1043356330 8:79416981-79417003 CTTCTTTTTTTCTGGAAACAAGG - Intergenic
1043693616 8:83189090-83189112 CTGCTTTTCTTCTGGGAATCTGG + Intergenic
1044331711 8:90928123-90928145 CATCTTTCCTTCAGGGTTGAAGG + Intronic
1044993345 8:97816213-97816235 ATTCTTTTCATTAGGGAAGCTGG + Intronic
1045318682 8:101064988-101065010 CTTCCCATCTCCAGGGAAGATGG + Intergenic
1045599001 8:103692626-103692648 GTTCTTTCCTTCAGGGCAGTGGG + Intronic
1045630203 8:104110008-104110030 CTTATTTTCTAGAGGGGAGATGG + Intronic
1046618431 8:116502130-116502152 CTCCTTTTCTTCAGGAAAGTGGG - Intergenic
1046837891 8:118823125-118823147 CTTGTTTATTACAGGGAAGAAGG + Intergenic
1047353837 8:124101244-124101266 CATCTTCTCTTTAGAGAAGATGG + Exonic
1047390778 8:124449263-124449285 CTGCTTTTCTGCAGGGCAGAAGG - Intergenic
1048178020 8:132170325-132170347 TTTCCTTTCTTCAGGCAAGTGGG - Exonic
1048888065 8:138924547-138924569 CTGGTTTTCTTTAGGGAACAGGG + Intergenic
1048947817 8:139466444-139466466 CTTCTTCTTATCAGGTAAGAGGG - Intergenic
1049390684 8:142368760-142368782 CTTTTATTCTTCAGGGGAGAGGG - Intronic
1049557131 8:143288575-143288597 CTTTTTTTTTTCAGGGTAGCAGG + Intergenic
1051177338 9:14374258-14374280 CTTCTTTTCTTTGGGAAGGAGGG - Intronic
1051242872 9:15078833-15078855 CTTGGTTTCCTCAGGGAAAATGG - Intergenic
1051586708 9:18734326-18734348 TGTCTTTTCTTCAGGAAAAAAGG - Intronic
1051607451 9:18929382-18929404 CTTCCTTTCTTCTGTGGAGAAGG + Intronic
1051680639 9:19604285-19604307 CTTCATTGCTTCAGTGAAGTAGG + Intronic
1054883337 9:70168782-70168804 CTGCTCATCTTCAGGTAAGACGG + Exonic
1056322260 9:85446821-85446843 CTTCTTTTCCTCTGGGTAGATGG + Intergenic
1057493098 9:95537987-95538009 CTGCTTTTCTACAGGGAATTTGG - Intergenic
1058168953 9:101655992-101656014 TTTCATTTCTTCAGAGAAGCTGG + Intronic
1058767785 9:108198618-108198640 GTTCTTTTCTTCAGGGCAGCCGG - Intergenic
1059561482 9:115338885-115338907 CTTCTTTTCTTCTGTGTAGCTGG + Intronic
1060969921 9:127732091-127732113 CTGCTCGTCTTCAGGGAAGAAGG + Exonic
1061659273 9:132117690-132117712 TTTTTTTTCTTCATGGAAGATGG - Intergenic
1062652765 9:137586785-137586807 CTCCTTTTCTTCATGGGAGCGGG - Intronic
1203572669 Un_KI270744v1:146372-146394 GTTCTTTTCCCCAGGTAAGAGGG - Intergenic
1203582578 Un_KI270746v1:25157-25179 ATTATTTTCCTCAAGGAAGAGGG + Intergenic
1186075276 X:5871666-5871688 CTTCTTTTCTGCCTGGAATATGG - Intronic
1186511010 X:10129784-10129806 CTTCTGTTTTCCAGGGAAGATGG - Intronic
1186706257 X:12142086-12142108 CTTCTTTTCTTTAAGCAAAACGG + Intronic
1186771863 X:12826341-12826363 CTTTTTTTTTTCAAGGAAGCTGG - Intergenic
1187479350 X:19640756-19640778 CTCCTTTTCTGCGGGGCAGATGG + Intronic
1187790416 X:22944233-22944255 CTTGGTTTCTTCGTGGAAGAAGG - Intergenic
1188319499 X:28718585-28718607 CTTCATTTCTTCATGGCAAAAGG - Intronic
1188334764 X:28917147-28917169 CTTCATTGCCTGAGGGAAGATGG + Intronic
1188595817 X:31898691-31898713 TTTCTTTTCTTAAGGAATGATGG + Intronic
1189069537 X:37848990-37849012 CACCTTTTCTGCAGGGCAGATGG - Intronic
1189378736 X:40486290-40486312 CTCTTTTTCTTCAGAGATGAAGG + Intergenic
1191778547 X:64844167-64844189 CTCCTTTTCTTCTGGAAGGAAGG - Intergenic
1192027122 X:67465785-67465807 ATTCTTTTCTTCAAGGTAGCGGG - Intergenic
1192499045 X:71636619-71636641 CTTCTTGACATCAGGGAAGCAGG + Intergenic
1192893596 X:75416591-75416613 CTACTTTTCTAAAAGGAAGAGGG - Intronic
1193343855 X:80383406-80383428 CTTCTTTTCTAGAAGAAAGAAGG - Intronic
1193469204 X:81878633-81878655 TGTCTTTTCTTCAGGGAAGTGGG + Intergenic
1194025828 X:88749242-88749264 ATGCTTTTCTTGGGGGAAGAAGG + Intronic
1194165037 X:90505644-90505666 TTTCTTTTCTTCAAGGCAGTGGG - Intergenic
1194998321 X:100616173-100616195 CTTCTTGCCTTCATGGAAGACGG + Intergenic
1195643955 X:107207579-107207601 TTTCCTTTCTTCAGGAAATATGG - Intronic
1195710176 X:107767154-107767176 AATCTTCTCTTCAGGGGAGATGG - Intronic
1196563024 X:117173465-117173487 CTTCTTTTTTTCAGGATGGATGG + Intergenic
1196676069 X:118421149-118421171 CTGCTTTGCTTTAGGGAAAAGGG + Intronic
1198771034 X:140130306-140130328 CTTTTTTTCTGTAGGGAAGGGGG + Intergenic
1199701974 X:150386539-150386561 CTTCCTGTCTTCAGGGACAAAGG + Intronic
1199734717 X:150674874-150674896 CATCTTTCCTTCAGGAAATAGGG - Intergenic
1200014002 X:153145261-153145283 CTTCTTCTCTCCAGGAAAAAGGG - Intergenic
1200025598 X:153254692-153254714 CTTCTTCTCTCCAGGAAAAAGGG + Intergenic
1200511301 Y:4083447-4083469 TTTCTTTTCTTCAAGGCAGTGGG - Intergenic
1201482750 Y:14457724-14457746 TTTATTTTCTTCATGGGAGATGG - Intergenic
1201514758 Y:14807994-14808016 CTTCTGATCTTCATGGAAGCAGG + Intronic
1201743444 Y:17346799-17346821 TTTCTTCTCTTCCGGGAGGAGGG + Intergenic
1202189448 Y:22225784-22225806 ATTTTTTTCTCCAGGCAAGATGG - Intergenic
1202305201 Y:23461820-23461842 TGCATTTTCTTCAGGGAAGAGGG - Intergenic
1202565608 Y:26208769-26208791 TGCATTTTCTTCAGGGAAGAGGG + Intergenic
1202586858 Y:26439445-26439467 ATTATTTTCCTCAGGGAAGAGGG + Intergenic