ID: 1014007221

View in Genome Browser
Species Human (GRCh38)
Location 6:116433471-116433493
Sequence AGAAGGAACCGTGTGGTGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 1, 2: 0, 3: 12, 4: 187}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014007221 Original CRISPR AGAAGGAACCGTGTGGTGGA AGG Exonic
900536674 1:3182091-3182113 AAGAGGCACCGTGTGGTGGCTGG - Intronic
900922582 1:5682957-5682979 AGAAGGACCCTTTTGGAGGATGG - Intergenic
901193350 1:7425641-7425663 AGAAGGGGCAGTATGGTGGAGGG - Intronic
901398259 1:8998078-8998100 AGAAGCAACTGAGTGGTGAAAGG - Intergenic
901944711 1:12692334-12692356 AGAAGGTACCAGGGGGTGGAAGG + Intergenic
902310734 1:15579580-15579602 AGAAGGACCCGGGTGGAGGGTGG - Intronic
903547074 1:24132070-24132092 AGAAGGGATAGGGTGGTGGAGGG - Intronic
903730571 1:25492014-25492036 TGAAGCAGCAGTGTGGTGGAGGG + Intronic
904666612 1:32126862-32126884 AGAAAGAACTGAGTGTTGGAAGG + Intronic
906046872 1:42837952-42837974 AGAGGGAACAGTGTGGGGTAAGG + Intronic
907376563 1:54048231-54048253 AGGAGCAACAGTGTGGTGTATGG + Intronic
907658962 1:56374267-56374289 AGATGGAACAGTGCCGTGGAAGG - Intergenic
907808649 1:57846054-57846076 AGAGGGAAGAGTGTGGGGGAGGG + Intronic
910508757 1:87979891-87979913 AGAATGAACAATGAGGTGGAGGG + Intergenic
910861176 1:91743589-91743611 TGAAGGAACCTTCTAGTGGAAGG - Intronic
911365697 1:96934803-96934825 AGAAAGAACAGTGTGGTAGGCGG - Intergenic
913372132 1:118111403-118111425 AGAAGGACCCGTGTGGTTTCAGG - Intronic
913541265 1:119822879-119822901 AGAAAGAGTAGTGTGGTGGATGG - Intergenic
915225213 1:154406403-154406425 AGAAGGACCCGTGAGGGAGAGGG + Intronic
917491115 1:175499514-175499536 AGAAGGGAGGGTGTGGAGGAAGG - Intronic
919848320 1:201655537-201655559 AGAAGCAGCAGTGTGGGGGAAGG - Intronic
921070191 1:211651990-211652012 ACAAGGGACAGTGTGGTAGAAGG - Intergenic
921442304 1:215201883-215201905 AGAAGGAAGGGAGTGATGGAGGG - Intronic
921495103 1:215829899-215829921 AGAAAGAAAACTGTGGTGGAGGG + Intronic
923183431 1:231546543-231546565 AGTAGGAAGAGTGTAGTGGATGG + Intronic
923231475 1:231990431-231990453 TGTAGGAACCCTGTGGTGGTAGG + Intronic
924495586 1:244585546-244585568 GGAAGGAACCTTGTGGTTGAAGG - Intronic
1065642790 10:27802425-27802447 AGAAGGGACCGGGAGGTGCAGGG - Intergenic
1068185453 10:53579979-53580001 AGAAAGTACAGTATGGTGGAGGG - Intergenic
1070219585 10:74426599-74426621 AGAAGGGAGAGTGAGGTGGAAGG + Intronic
1073124019 10:101138958-101138980 GGAAGAAGCTGTGTGGTGGAGGG + Intergenic
1073337207 10:102718764-102718786 AGAAGGGACAGTGTTGGGGAAGG - Intronic
1074103609 10:110373247-110373269 AGAAGGAGCTGTGAGTTGGAGGG + Intergenic
1074394841 10:113089205-113089227 AGAAGGGACCCTGAGCTGGATGG + Intronic
1075541396 10:123317249-123317271 AGAAGGAACCGTGTGCTTCTGGG - Intergenic
1076097069 10:127740342-127740364 AGAAGGAACTGGGTGGGGCAGGG - Exonic
1077478801 11:2803408-2803430 AGAAGGCACCGTGGTCTGGAGGG - Intronic
1077678222 11:4216126-4216148 AGAAGCACCCGTGGGGTGGGAGG - Intergenic
1078953819 11:16166928-16166950 AGTAGGAACCATGTTATGGAGGG + Intronic
1081455041 11:43212822-43212844 AGAAAGAACAGTGTGGTGCGCGG - Intergenic
1081794597 11:45810810-45810832 AGAAGGCACCCTGTCGTGGCTGG + Exonic
1081963997 11:47158447-47158469 AGGAGGAACAGTGGGGTGGGTGG - Intronic
1084861911 11:72024523-72024545 AGATGGAACTGTGTGGTGGGTGG + Intronic
1085245824 11:75099615-75099637 GGAAGGAAGGGAGTGGTGGAAGG + Intergenic
1087080566 11:94167187-94167209 AGAAGAATCCGTGTGCTTGAAGG - Intronic
1088088652 11:106011405-106011427 AGAAGGAACAGTGTGGACAAAGG - Intronic
1089894128 11:121910345-121910367 AGGAGAAACTGTGTGGAGGATGG + Intergenic
1090464139 11:126918469-126918491 ATAAGCAAGCTTGTGGTGGAGGG + Intronic
1090655170 11:128837699-128837721 AGAAGGACCAGAGTGGTGCATGG + Intronic
1091596761 12:1883624-1883646 AGAGGGAACAGTGTGCTGAAAGG - Intronic
1091705927 12:2693339-2693361 AGAAAATTCCGTGTGGTGGAAGG - Intronic
1092075684 12:5671478-5671500 GGAAGGAACTGTGTGGGGGGTGG + Intronic
1092451446 12:8606137-8606159 GGAAGCATCCGTGGGGTGGAAGG - Intronic
1093278581 12:17160679-17160701 CGAAGGAAACGTGTGGCAGATGG - Intergenic
1096790507 12:54041662-54041684 AGATGGAGCAGTGTGGTTGAAGG - Intronic
1101575656 12:105994138-105994160 AGAAGGAGGCGTGAGGAGGAAGG - Intergenic
1102413555 12:112741009-112741031 AGATGGGTCCATGTGGTGGATGG + Intronic
1102629452 12:114264997-114265019 AGATGGAACTATCTGGTGGAAGG + Intergenic
1103949183 12:124542011-124542033 AGTAGGAACAGTGTGGGGCAGGG + Intronic
1104012092 12:124939116-124939138 AGAAGGACTCGGGTGGTGGGTGG - Intergenic
1106539927 13:30681297-30681319 AGAAGGAACAGAGGTGTGGATGG + Intergenic
1106717876 13:32409790-32409812 AGGAGGAAGCGAGTGCTGGAGGG + Intronic
1107305361 13:39013190-39013212 TGGAGGAACCATGTGGTGGAAGG + Exonic
1107850330 13:44565435-44565457 AGAAGAAATGGAGTGGTGGAGGG + Intronic
1108355557 13:49625932-49625954 ATAAAGAATCGTCTGGTGGAGGG - Intergenic
1109155672 13:58906333-58906355 AGAAGTAATCATGTGTTGGATGG + Intergenic
1110775277 13:79401851-79401873 TGGAGGAAGTGTGTGGTGGAAGG - Intronic
1113467009 13:110519976-110519998 AGGGGGACCCGTGTGCTGGAGGG + Intergenic
1114418281 14:22558535-22558557 AGAAGGAAGCGCGTGATGGAGGG + Intronic
1115716071 14:36104968-36104990 AGAAAAAACAGTGTGGTGAATGG - Intergenic
1115778238 14:36739945-36739967 AGAGGGAATGGTGTGCTGGAAGG + Intronic
1117068376 14:52033330-52033352 AAAAGGACCCGTGAAGTGGAAGG + Intronic
1118842700 14:69524964-69524986 AGAAGGAACAGTGTGGGAAAAGG - Intronic
1119671027 14:76518475-76518497 AGAAGGAAGCGAGTGAGGGAGGG + Intergenic
1122290829 14:100679627-100679649 TGGAGGAACCGTGTGCTGGCTGG - Intergenic
1122758067 14:103998054-103998076 AGGGGGAAAGGTGTGGTGGAGGG + Intronic
1122812577 14:104296363-104296385 AGAAAGAACCGAGTGAAGGAAGG + Intergenic
1124196182 15:27631876-27631898 AGTAGGAAGCGGGTGGTGGAAGG - Intergenic
1127976105 15:63998452-63998474 TGCAGGAACAGTGTGGTGGCAGG - Intronic
1131315841 15:91336534-91336556 AGAAGGAAGAGAGGGGTGGACGG - Intergenic
1132721958 16:1320911-1320933 AGAAGGAACCAAGTTGTAGAGGG - Intronic
1132829628 16:1920979-1921001 CCAAGGAACCGTGTGGGTGAAGG + Intergenic
1133009808 16:2904814-2904836 AGAGGGAGCGGTGTGGTGCAGGG + Intergenic
1136233847 16:28902986-28903008 AGAAGGCACAGTGAGGAGGAAGG - Intronic
1137443000 16:48511917-48511939 AGAAGGGAGCCTGGGGTGGAGGG + Intergenic
1138589916 16:57994045-57994067 AGGAGGAAAGGTGTGCTGGAGGG + Intergenic
1139301702 16:65950354-65950376 AGCAGGAGCAGTGTGGTGGTAGG + Intergenic
1141726874 16:85795500-85795522 AGAGGGAACAGTGGAGTGGAAGG - Intronic
1141756915 16:85997394-85997416 AGAAGCAGCGGTGTGGTAGATGG + Intergenic
1146993923 17:37301160-37301182 AGAAAGATCCGTTTGGTGAAAGG - Intronic
1147636819 17:41968955-41968977 AGAAGGATAGGTGTGGTGGGAGG - Intronic
1147991172 17:44334432-44334454 AAAAGGAACAGGGTGGTGAAGGG + Intergenic
1148537259 17:48450547-48450569 AGAAGGAGCCGTGACGGGGAGGG - Intergenic
1150308531 17:64107912-64107934 AGAAGGAACTGTATGGTTGATGG - Intronic
1153651604 18:7245867-7245889 AGAGGGAACCGTGTGTTTGAAGG - Intergenic
1154140217 18:11816961-11816983 AGAAGGAACTGAGTGGTGGTTGG + Intronic
1155388438 18:25307211-25307233 AGAAGGAACATTGTGGGGAAAGG - Intronic
1157493772 18:48141144-48141166 AGAAGGAACAGTGGGGGGGGTGG - Intronic
1157549555 18:48572059-48572081 AGGAGGAACGGTGAGGGGGAAGG - Intronic
1158865997 18:61638230-61638252 TGAAGGGAGGGTGTGGTGGAAGG - Intergenic
1159960238 18:74550017-74550039 AGAAAGAACCTAGAGGTGGAGGG + Intronic
1159985418 18:74835566-74835588 AGAAGTAAACTTGTGGTAGAAGG + Intronic
1162062675 19:8106460-8106482 AGAGGAAACTATGTGGTGGATGG - Intronic
1162700116 19:12508290-12508312 AGAAGGAATGGTCTGGTGGGTGG - Intronic
1165135604 19:33666500-33666522 AGAAGGAACCGGAAGGTGGGAGG + Intronic
1168406651 19:56114134-56114156 AGATGGAACCCTGTGGTGCCTGG - Intronic
925747411 2:7055453-7055475 AGAAGGAACAGTGGAGAGGATGG - Intronic
928059490 2:28096720-28096742 AGAAGGAAGGGAGTGGGGGAGGG - Intronic
931641841 2:64387340-64387362 AAAATGAACCTTGTGGTGGTTGG + Intergenic
932330404 2:70895429-70895451 AGAAGGACCCGTGGGCTGTAGGG - Intergenic
932863975 2:75322288-75322310 AGAGGAAACAGTGTGGTCGAGGG + Intergenic
933004123 2:76968634-76968656 AGAGGGAAATGTATGGTGGAAGG + Intronic
933835567 2:86242812-86242834 AGAAGGAAGGGTGTGGAGGAAGG + Intronic
934044875 2:88164706-88164728 AGAATGGACTGTGAGGTGGAAGG + Intergenic
934729258 2:96646409-96646431 AAAAGAACTCGTGTGGTGGAAGG + Intergenic
935310512 2:101778476-101778498 AGAAGGTATCTTGTGGGGGAGGG + Intronic
935638140 2:105266274-105266296 GGAAGGGCCCGTGTGCTGGATGG - Exonic
935707530 2:105870020-105870042 ACAAGGACCCATGTGGTGGTCGG + Intronic
936013298 2:108939564-108939586 AGAGGGAACAGTGTGGGTGAGGG + Intronic
937194624 2:120141664-120141686 AGAAGGATCTGTATGGTGAAGGG + Intronic
938124111 2:128659483-128659505 AGGAGGAAGCATATGGTGGAGGG - Intergenic
940347080 2:152639032-152639054 GGGAGGAACAGTGAGGTGGAAGG - Intronic
946216175 2:218185504-218185526 AGAATGCACCGTGAAGTGGAAGG - Intergenic
947702418 2:232245378-232245400 AGCAGGATCCCTGTGGAGGAGGG - Intronic
1172852978 20:37979975-37979997 AGAAGGCACTGTGTTGTGGAAGG - Intergenic
1174121803 20:48271392-48271414 AGAAGGAAGAGTGTGTGGGAAGG + Intergenic
1174580841 20:51570450-51570472 AGAAGGAACGGGGCGGTGGCTGG + Intergenic
1178801208 21:35797554-35797576 AGCAGCAGCAGTGTGGTGGAAGG - Intronic
1179827200 21:43972794-43972816 CGAAGAAACCGTGCGCTGGATGG + Intronic
1182556636 22:31132907-31132929 AGAAGGAACCCTGGGCTGGGAGG + Intronic
1182743888 22:32589806-32589828 AGAATGAACCAAGTAGTGGATGG - Intronic
1183356612 22:37363167-37363189 AGAGGAAACCAAGTGGTGGATGG - Intergenic
1183467325 22:37986329-37986351 AGGAGGAACTGAGGGGTGGAAGG - Intronic
1185071006 22:48655769-48655791 AGGAGGGACAGTGTGGTTGAAGG + Intronic
949946142 3:9191606-9191628 AGAAGGAACAGTATGGTCAAAGG + Intronic
953808475 3:46091990-46092012 AGAAGGCATCATATGGTGGAAGG + Intergenic
956699122 3:71943179-71943201 AGATGGAACCGTCTAGTTGAAGG + Intergenic
959122463 3:102248772-102248794 AGAAGGAAATTGGTGGTGGAAGG - Intronic
961906910 3:130272390-130272412 AGGAGGAACTGTGGGGAGGATGG + Intergenic
962201288 3:133403145-133403167 TGAAGGCAGCGTGTTGTGGAAGG - Intronic
963094524 3:141522284-141522306 AGATGGACCACTGTGGTGGAGGG + Intronic
963779401 3:149472109-149472131 AGAGGGAATCGTGGGGGGGATGG - Intergenic
964221248 3:154347779-154347801 AGAAAGGAGAGTGTGGTGGAAGG + Intronic
964443856 3:156739977-156739999 AGAAGGAGCAGTGAGGTGGTAGG + Intergenic
969062496 4:4448856-4448878 AGAATGAACCCTGTGGTGTTGGG - Intronic
971718075 4:30206790-30206812 AGAAGAAAAGGTGAGGTGGAAGG + Intergenic
972297167 4:37750953-37750975 AGAAGGAATTGTATGGTTGAGGG - Intergenic
975993446 4:80285354-80285376 AGAAGGAACAGGGTGTTGAAAGG - Intronic
982467541 4:155748986-155749008 AGATGTAACCCTGTGGTGTATGG - Intergenic
985542089 5:492062-492084 AGGTGGAACCCTGTGGGGGAAGG + Exonic
991319393 5:65352937-65352959 AGAAGGAACATAGTGCTGGAGGG - Intronic
991985900 5:72286911-72286933 AGAAGAATCCGTGTGGTGCTGGG + Intronic
998979982 5:147691349-147691371 AGAAGGAGCTGGGTGGGGGATGG - Intronic
999353629 5:150903338-150903360 AGCAGGCACCATGTGGAGGAGGG + Exonic
1000129052 5:158277032-158277054 AGAAGGAACTGTGTGGGCCAAGG + Intergenic
1000767463 5:165309902-165309924 AGGAGCAACCCTGTTGTGGAAGG + Intergenic
1000779571 5:165464582-165464604 AGAAGGATCCCTGTGGTGCCAGG - Intergenic
1000970392 5:167707947-167707969 AAAAGGAACGGTGTGGTGCTCGG + Intronic
1002404075 5:179015330-179015352 AGAAGGAAAAGTGGGCTGGAGGG + Intergenic
1002484215 5:179523660-179523682 GGAGGGGACCGTGTGGGGGAGGG + Intergenic
1003500899 6:6702025-6702047 ATAGCGAACTGTGTGGTGGAGGG - Intergenic
1004462273 6:15848740-15848762 AGAAGGATCCGGATGGTGGAAGG - Intergenic
1005000982 6:21241475-21241497 AGAAGGTAGCGGGTGCTGGAGGG - Intergenic
1010386240 6:75284268-75284290 AGAGGGAAGGGGGTGGTGGACGG + Intronic
1013313258 6:108917414-108917436 GGAAGGAACCGAGTGAAGGAAGG - Intronic
1014007221 6:116433471-116433493 AGAAGGAACCGTGTGGTGGAAGG + Exonic
1014544043 6:122711728-122711750 AGAAGTAACATTGTGCTGGAAGG + Intronic
1016992817 6:149941799-149941821 GGAAGGAACCGTGTCTTGGCAGG + Intergenic
1017046689 6:150353067-150353089 ACAAGGAACTGGGTGGTTGAGGG - Intergenic
1017911242 6:158794869-158794891 AAAAAGAACCATGTGGTTGACGG + Intronic
1022113924 7:27246787-27246809 AGAAGGGAGTGTGAGGTGGAGGG - Intronic
1026296602 7:69058313-69058335 AGCAGGAAGCTTGTGGTGGAAGG + Intergenic
1028006221 7:85571970-85571992 AGAAGGGAGCGTGTTTTGGAAGG + Intergenic
1030584245 7:111397519-111397541 AGAAAGAACAGTTTGGTGGTAGG - Intronic
1035823429 8:2619095-2619117 AGAAGTACCCGAGTGATGGAAGG - Intergenic
1036773636 8:11595270-11595292 AGAACGAAGCGTGGTGTGGAGGG - Intergenic
1037609807 8:20466523-20466545 AGAAGGAATTGTGGGGTGGCAGG + Intergenic
1038037285 8:23697036-23697058 GGAAGGAACCGAGGGGTGAAAGG + Intergenic
1041683946 8:60625192-60625214 AGAGTGAACCTTGTGGTGGTAGG + Intergenic
1041867990 8:62598711-62598733 AGAAGGGACACTGTGTTGGAGGG + Intronic
1044423907 8:92029480-92029502 AGTAGGAACCGAGAGGTGCATGG + Intronic
1045584483 8:103517404-103517426 AGAAGGGATGGAGTGGTGGAAGG + Intronic
1045771779 8:105749790-105749812 AGAAGGAAGAGAGTGGAGGAAGG + Intronic
1048524907 8:135193535-135193557 AGATGGAACAGTTTGGTAGAAGG - Intergenic
1049818918 8:144622364-144622386 AGAAGGAAGCCTGTGGCGGGTGG - Intergenic
1051546848 9:18285614-18285636 ATAAGGAACCTTGTTGTGGCGGG + Intergenic
1054721684 9:68610151-68610173 AGAAGGAACTGTGTGGTGGAAGG + Intergenic
1055412909 9:76050931-76050953 AGAATGAGCCATATGGTGGAGGG + Intronic
1056989749 9:91399744-91399766 AGTAGGCACAGTGTGGTAGATGG + Intergenic
1057891325 9:98872161-98872183 ACAAGGAACAGTGTTGAGGAAGG - Intergenic
1061547539 9:131313413-131313435 GGAAGAAACCAGGTGGTGGAAGG - Intergenic
1062409063 9:136413006-136413028 AGAAGGAGCCCTGTCCTGGATGG + Intronic
1187246178 X:17554634-17554656 ACAAGGAACTGTGTCGTGGTTGG + Intronic
1189173814 X:38934239-38934261 AGAAGGAACACTGTGCTGGGTGG - Intergenic
1190149500 X:47932224-47932246 AGAAGGAACCCTGTAGTGCTGGG - Intronic
1193114614 X:77764670-77764692 AGGAGGAAGTCTGTGGTGGAGGG - Intronic
1196529267 X:116765571-116765593 AGAAGGAACAGTGGGGTGTGAGG + Intergenic
1197518837 X:127472707-127472729 AGAAGGATCCCTGTGGTGCCAGG - Intergenic
1198013234 X:132581625-132581647 AGAGGGAGCAGTGTGGTGGGTGG - Intergenic
1198449202 X:136749889-136749911 AGAAGGTATAGTGTGGTGAAGGG - Intronic
1200247204 X:154532533-154532555 AGAAGGAGCAGTGTGGAGGGTGG - Intronic