ID: 1014007964

View in Genome Browser
Species Human (GRCh38)
Location 6:116442934-116442956
Sequence GGGAGTAAACATATGGAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 180}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014007964_1014007977 0 Left 1014007964 6:116442934-116442956 CCATATTCCATATGTTTACTCCC 0: 1
1: 0
2: 0
3: 10
4: 180
Right 1014007977 6:116442957-116442979 TGGGGTGAGGTGGGGCAGGGAGG 0: 1
1: 13
2: 71
3: 552
4: 2928
1014007964_1014007979 2 Left 1014007964 6:116442934-116442956 CCATATTCCATATGTTTACTCCC 0: 1
1: 0
2: 0
3: 10
4: 180
Right 1014007979 6:116442959-116442981 GGGTGAGGTGGGGCAGGGAGGGG No data
1014007964_1014007972 -8 Left 1014007964 6:116442934-116442956 CCATATTCCATATGTTTACTCCC 0: 1
1: 0
2: 0
3: 10
4: 180
Right 1014007972 6:116442949-116442971 TTACTCCCTGGGGTGAGGTGGGG 0: 1
1: 0
2: 2
3: 28
4: 285
1014007964_1014007973 -4 Left 1014007964 6:116442934-116442956 CCATATTCCATATGTTTACTCCC 0: 1
1: 0
2: 0
3: 10
4: 180
Right 1014007973 6:116442953-116442975 TCCCTGGGGTGAGGTGGGGCAGG 0: 1
1: 1
2: 15
3: 113
4: 824
1014007964_1014007975 -3 Left 1014007964 6:116442934-116442956 CCATATTCCATATGTTTACTCCC 0: 1
1: 0
2: 0
3: 10
4: 180
Right 1014007975 6:116442954-116442976 CCCTGGGGTGAGGTGGGGCAGGG 0: 1
1: 3
2: 10
3: 121
4: 959
1014007964_1014007980 3 Left 1014007964 6:116442934-116442956 CCATATTCCATATGTTTACTCCC 0: 1
1: 0
2: 0
3: 10
4: 180
Right 1014007980 6:116442960-116442982 GGTGAGGTGGGGCAGGGAGGGGG No data
1014007964_1014007978 1 Left 1014007964 6:116442934-116442956 CCATATTCCATATGTTTACTCCC 0: 1
1: 0
2: 0
3: 10
4: 180
Right 1014007978 6:116442958-116442980 GGGGTGAGGTGGGGCAGGGAGGG No data
1014007964_1014007970 -10 Left 1014007964 6:116442934-116442956 CCATATTCCATATGTTTACTCCC 0: 1
1: 0
2: 0
3: 10
4: 180
Right 1014007970 6:116442947-116442969 GTTTACTCCCTGGGGTGAGGTGG 0: 1
1: 0
2: 0
3: 19
4: 184
1014007964_1014007971 -9 Left 1014007964 6:116442934-116442956 CCATATTCCATATGTTTACTCCC 0: 1
1: 0
2: 0
3: 10
4: 180
Right 1014007971 6:116442948-116442970 TTTACTCCCTGGGGTGAGGTGGG 0: 1
1: 0
2: 3
3: 16
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014007964 Original CRISPR GGGAGTAAACATATGGAATA TGG (reversed) Intergenic
903550067 1:24151750-24151772 GGGAGTAAACTGATGGCATAAGG + Intergenic
905925675 1:41747937-41747959 GGCAGTAATCAGATGGAAGAAGG + Intronic
906676944 1:47700169-47700191 AGGAGTAAACAAATAGAATGAGG + Intergenic
907910130 1:58818201-58818223 GGAATTAAGAATATGGAATAAGG - Intergenic
908348446 1:63260112-63260134 ATGAGTAAAGACATGGAATAGGG - Intergenic
909971173 1:81991701-81991723 TTGAGGAAACATATGAAATAAGG - Exonic
910633599 1:89382867-89382889 AGGAGTAAAGGTAAGGAATAAGG + Exonic
911979283 1:104545811-104545833 GGGATTCAACATATGGATTGTGG - Intergenic
912166902 1:107052697-107052719 GGGAGCAACAATCTGGAATATGG + Intergenic
916494266 1:165330636-165330658 GGGAGTCACCACATGGAAGAAGG + Intronic
916920778 1:169463706-169463728 GGGGGAAAACATCTGAAATAAGG + Intergenic
917812182 1:178670189-178670211 AGCAGTAAACATTTGGAATAGGG + Intergenic
918588477 1:186214741-186214763 GGGAGAAAATAAATGGAAAATGG + Intergenic
1062957287 10:1548669-1548691 GGGAGTAAAGATCTAGGATAAGG + Intronic
1063984800 10:11490850-11490872 GGCAGCAAGCACATGGAATAAGG + Exonic
1065400299 10:25292567-25292589 GGGAGTAAACAGTTGGAGAATGG + Intronic
1065582843 10:27189113-27189135 GGGAGGAAACTAATTGAATAAGG - Intergenic
1065804941 10:29385516-29385538 GGGAGAAAATATATGGCACAGGG + Intergenic
1068189592 10:53634046-53634068 GGAAGTCATAATATGGAATAAGG + Intergenic
1068281697 10:54880067-54880089 GGGTGTAAAAATATTGAATCAGG - Intronic
1070167113 10:73907126-73907148 GGGAGTAAGCATAGGCAATGTGG + Intergenic
1070255852 10:74812771-74812793 GCGAATAAACATATGAAAAATGG - Intergenic
1071720146 10:88135543-88135565 GGGAGTAAAAATAGAAAATAGGG + Intergenic
1072224516 10:93356037-93356059 GGGAGTAAAAGGATGGGATAAGG + Intronic
1080308049 11:30858088-30858110 GGGAGAAAACAAATGAAACAGGG - Intronic
1081495913 11:43610055-43610077 GGGAAGAAAAATTTGGAATATGG + Intronic
1087108192 11:94433070-94433092 TGGATTAAACATTTGGAGTAAGG - Intronic
1087334563 11:96826857-96826879 GGGATTCAACATATGGATTTTGG + Intergenic
1088970514 11:114770980-114771002 TGCAATAAACATATGTAATATGG - Intergenic
1089115828 11:116094310-116094332 GGGTTTCAACATATGGATTAGGG - Intergenic
1091114592 11:133001236-133001258 GGTAGTAAACATTTGAAATAGGG - Intronic
1092478901 12:8842518-8842540 GGGTGTTAACATATGCAACAGGG - Intronic
1092770586 12:11892839-11892861 GGGTGCAAACAGATGGACTATGG + Exonic
1093369560 12:18351236-18351258 TATAATAAACATATGGAATATGG + Intronic
1099660463 12:85552033-85552055 GGTAGTAAAAATATGAAATTTGG + Intergenic
1104082450 12:125442248-125442270 GGCAGGAAATATATGAAATAGGG + Intronic
1104625565 12:130351340-130351362 GGGAGTGAACATATAGTAAAAGG - Intronic
1106689782 13:32102675-32102697 GGTAATAAACATATGAAATCAGG + Intronic
1106988315 13:35383380-35383402 GAGAGTGAACAGATGGAATAGGG + Intronic
1107713642 13:43175791-43175813 TTGAGTAAAAATATGGTATAAGG + Intergenic
1108258763 13:48636364-48636386 GGGAGTAAAAATATCTCATAGGG + Intergenic
1109249122 13:59997153-59997175 GGGTGCAAACATATGGTAGAAGG - Intronic
1109971432 13:69775563-69775585 TGGAGTAAAGATATGGAGAAGGG + Intronic
1110040525 13:70751171-70751193 TTGAGTAAAAATATGGAAGAAGG - Intergenic
1111434598 13:88190547-88190569 GGGATAAAAAATAAGGAATAAGG - Intergenic
1112726021 13:102305780-102305802 TGAAGTAAACAGATGAAATAGGG + Intronic
1113090149 13:106609598-106609620 GTGAGAAAATAAATGGAATAGGG - Intergenic
1114733256 14:25017259-25017281 GGGAGAAAGAATATGAAATAGGG + Intronic
1115886282 14:37975321-37975343 GGGAATAGAGAAATGGAATATGG - Intronic
1115895453 14:38081490-38081512 GGGAGTCAACATATGAATTTTGG + Intergenic
1116532942 14:45995202-45995224 GGAAGAAAAGAAATGGAATATGG + Intergenic
1117526048 14:56606048-56606070 TGGAGTAAGCATATGGCACAGGG - Intronic
1117747542 14:58886090-58886112 GGCAATAAACATATGTTATAGGG - Intergenic
1118543063 14:66852465-66852487 GGGAGTTAAAATATTGCATATGG + Intronic
1121483606 14:94296723-94296745 GGGAGGAAACTAAAGGAATAAGG - Intergenic
1127697000 15:61459954-61459976 GGGAGTAAGCATGTGGGATTTGG - Intergenic
1129505453 15:76077913-76077935 GGGAGTAAACACATGGTAAATGG + Intronic
1131578206 15:93613528-93613550 GGAACTAAACAGATGGAAAAAGG + Intergenic
1133362848 16:5187656-5187678 GGGAGTAAGCATATTCAAAATGG - Intergenic
1135548152 16:23379329-23379351 GGGGGCAAACATATGTAAAAAGG + Intronic
1136255204 16:29034379-29034401 GAGATTCAACATATGGAAGAGGG + Intergenic
1142523062 17:518599-518621 GGGAGTAAAGAAATGGAGGAAGG + Exonic
1145357236 17:22170227-22170249 GCAAGTAAAAATATGAAATATGG - Intergenic
1145754206 17:27379039-27379061 GGGAGTCAACACTTGGAAGAAGG - Intergenic
1146252314 17:31358739-31358761 GAGAGTAAAAAAATGGAATATGG - Intronic
1149034298 17:52116562-52116584 GGGAATAAAAAGATGGAAGAAGG + Intronic
1149415268 17:56453048-56453070 GGGAGGAAAAAAATGGAAGAAGG - Intronic
1149451269 17:56751813-56751835 GGGAGTATACATTGGGCATATGG - Intergenic
1157000094 18:43513176-43513198 TGGAGTAGACATATGGATGAAGG + Intergenic
1157855224 18:51099268-51099290 GTGAGAAGACATATGGAGTAGGG - Intergenic
1159359006 18:67376505-67376527 GGGAGTAAAAATTTGGGATTTGG - Intergenic
1159428865 18:68325131-68325153 GGGAGAAAACAGATGGGCTAGGG + Intergenic
1160335823 18:78038352-78038374 GGGAGTAGTCATATTGATTATGG + Intergenic
1162045304 19:7995877-7995899 TGGAGTAAACATTTGCAAAAGGG + Intronic
1163781469 19:19251486-19251508 AGGAGTAAGGATTTGGAATAAGG + Exonic
1165135561 19:33666215-33666237 GGGGGTACACATAGGGAAGATGG + Intronic
1167650629 19:50726716-50726738 GGGAGTAAAGGTATGAAAAATGG - Intergenic
1168376895 19:55887447-55887469 GGCAGTAAAGATATAGAAAAAGG + Intergenic
1168704434 19:58461132-58461154 GGGACTAAACATATGTAAAAAGG - Intergenic
927929488 2:27035064-27035086 GGGAGTAAAGAAATGGGGTAGGG - Intronic
934879635 2:97964616-97964638 GGGAGTAAACAGGTGGTTTAAGG - Intronic
935014306 2:99165401-99165423 GGGAGTATACATGGGGAGTAGGG + Intronic
936822886 2:116544325-116544347 GTGAGTGAACATATAAAATAGGG - Intergenic
940032088 2:149274360-149274382 GGGAGGAAACTTATGGAAAAGGG - Intergenic
940380005 2:153003667-153003689 GTGAGTAATCATAAGGACTATGG + Intergenic
948320758 2:237066898-237066920 ATGAGGAAAGATATGGAATATGG - Intergenic
1173426661 20:42949044-42949066 GGAAGTCAACATTTGTAATAGGG - Intronic
1178574203 21:33770423-33770445 GGGCTTAAACATATGGATTTTGG + Intronic
1180758290 22:18178558-18178580 GGGAGTAAAAATAGGGAGTTTGG + Intergenic
1180768578 22:18362350-18362372 GGGAGTAAAAATAGGGAGTTTGG + Intergenic
1180777733 22:18500041-18500063 GGGAGTAAAAATAGGGAGTTTGG - Intergenic
1180810458 22:18757352-18757374 GGGAGTAAAAATAGGGAGTTTGG - Intergenic
1180826453 22:18865574-18865596 GGGAGTAAAAATAGGGAGTTTGG + Intergenic
1181196602 22:21191607-21191629 GGGAGTAAAAATAGGGAGTTTGG - Intergenic
1181212926 22:21301517-21301539 GGGAGTAAAAATAGGGAGTTTGG + Intergenic
1181523579 22:23464529-23464551 GGGAGTAAAAATAGGGAGTTTGG + Intergenic
1181677417 22:24464926-24464948 GGAAATAAACTTATAGAATAAGG - Intergenic
1181894219 22:26092840-26092862 GGGAGTAGGCATGTGGAAGAAGG + Intergenic
1203230196 22_KI270731v1_random:103238-103260 GGGAGTAAAAATAGGGAGTTTGG + Intergenic
1203276596 22_KI270734v1_random:91480-91502 GGGAGTAAAAATAGGGAGTTTGG + Intergenic
951607290 3:24450040-24450062 GGAAGTAAACAGAGGGAAGAAGG + Intronic
955113692 3:55975336-55975358 GGAAGAAACTATATGGAATATGG - Intronic
955229988 3:57090216-57090238 GGGAGAAAGCCTGTGGAATATGG - Exonic
955540565 3:59971917-59971939 GGGAGAAATGAGATGGAATAAGG - Intronic
958145770 3:89622760-89622782 GTGAGTAAATATATGAAGTAGGG + Intergenic
959336442 3:105071455-105071477 GGGAGAAAAGATAGGGAAAAGGG + Intergenic
959598391 3:108152299-108152321 GGGAGTTAACATGTGGATAATGG + Intergenic
961103308 3:124220453-124220475 GGGAGAAAACATAAGGTAAAGGG - Intronic
962116306 3:132512472-132512494 GGAAGTAAATATATGGGATTAGG + Intronic
962286976 3:134094386-134094408 AGGAGAAAACATATTGGATAAGG - Intronic
963365978 3:144335011-144335033 GGAAGTCCACATATGGATTAAGG - Intergenic
964755791 3:160089796-160089818 GGGGGTAAATCTAGGGAATAAGG - Intergenic
964969596 3:162543158-162543180 GTGGGTAACCATATGGAGTATGG - Intergenic
971579528 4:28316993-28317015 GAGAGTGAACATTTAGAATAAGG + Intergenic
971833143 4:31724819-31724841 TGAAGTCAACATATGGAAGAGGG + Intergenic
972489084 4:39569925-39569947 GGGAGGAAACTAATGGAGTAAGG - Intronic
972994384 4:44862117-44862139 GTAAATAAAAATATGGAATATGG - Intergenic
974095463 4:57359136-57359158 AGGAGGAGACGTATGGAATAAGG + Intergenic
977218934 4:94315888-94315910 AGGACTAAAAATATTGAATAAGG - Intronic
978582019 4:110241474-110241496 GGAAGTAAACGTATAGAAAAAGG + Intergenic
979019057 4:115471927-115471949 TGGAATAAGGATATGGAATATGG - Intergenic
982186327 4:152805208-152805230 GGAAGTAGATAAATGGAATATGG - Intronic
987835134 5:23150874-23150896 GAGAGTAAATAGCTGGAATAGGG - Intergenic
988326431 5:29774416-29774438 GGAAGTAAACATTTGGGATCAGG + Intergenic
990797210 5:59557149-59557171 AAGAGTAAACATATGCCATAAGG + Intronic
990841542 5:60085252-60085274 GGGAGGGAATATAGGGAATAGGG + Intronic
994338081 5:98592875-98592897 GGGGGTATACATATGGAAGGGGG - Intergenic
994371990 5:98977960-98977982 GGGGGTAAACATATCTAACAGGG - Intergenic
995159520 5:108962229-108962251 TTGTGTAAACATATGGAAGATGG + Intronic
996216711 5:120876408-120876430 GGAAGCAAACATTAGGAATAAGG + Intergenic
996872260 5:128204359-128204381 GGGAGTAAACAGAAGAAATGGGG - Intergenic
1003214781 6:4099359-4099381 GGGAGTAAACTCATGGAAATGGG + Intronic
1005824475 6:29624490-29624512 GGGAGGAAACAAATGGAAGGTGG - Intronic
1007041527 6:38726759-38726781 GTGAGTAAAGAGATGGAACAAGG + Intronic
1007995976 6:46308421-46308443 GTGAGGAAACATTTGGATTAAGG + Intronic
1009417231 6:63429254-63429276 GGAAGTAAAAATATGGCATCTGG - Intergenic
1009962160 6:70536431-70536453 TGTATTAAAAATATGGAATAGGG + Intronic
1010805465 6:80230481-80230503 GGGATTTGACATATGGAACAGGG + Intronic
1012406197 6:98901591-98901613 CAGAGTAAAAATATGCAATATGG - Intronic
1014007964 6:116442934-116442956 GGGAGTAAACATATGGAATATGG - Intergenic
1014023367 6:116616564-116616586 GGGCGTGAAAATATGGAAGAAGG - Exonic
1014140209 6:117933255-117933277 GGGAGTTTAAATATAGAATATGG - Intronic
1014939982 6:127426543-127426565 GAAAGTAAACAGATGGAAAAAGG + Intergenic
1016860239 6:148710546-148710568 GGGATTCAACATATGGATTTTGG + Intergenic
1021496635 7:21282048-21282070 AGGAGAAAGCATATAGAATAAGG + Intergenic
1023004753 7:35851983-35852005 GGGAATAAACATTTGAAACAGGG - Intronic
1024611772 7:51071542-51071564 GGGGGAAAACAAATGCAATAGGG - Intronic
1025218609 7:57083660-57083682 GGGAATAAACATTTGAAACAGGG + Intergenic
1025629531 7:63257259-63257281 GGGAATAAACATTTGAAACAGGG + Intergenic
1025652738 7:63486779-63486801 GGGAATAAACATTTGAAACAGGG - Intergenic
1026276707 7:68885150-68885172 GGGATTCAACATATGGATTTTGG + Intergenic
1026771569 7:73204251-73204273 GGGAGTAAACAGAAGGATAAGGG + Intergenic
1027012435 7:74757647-74757669 GGGAGTAAACAGAAGGATAAGGG + Intronic
1027075605 7:75188406-75188428 GGGAGTAAACAGAAGGATAAGGG - Intergenic
1029013554 7:97289522-97289544 GGGAGTACACAAAAGGAAAATGG - Intergenic
1031672030 7:124560944-124560966 TGGATTATACATATGGTATATGG - Intergenic
1032969784 7:137147643-137147665 GAGAGTAAGCATTTGGAATGTGG + Intergenic
1038667535 8:29552786-29552808 GGGAGTTGCCATTTGGAATAAGG - Intergenic
1038788073 8:30640398-30640420 GGGAGTAAACATATCAAAATGGG + Intronic
1039768541 8:40658867-40658889 GGAGGTGAACATTTGGAATAAGG - Intronic
1040923876 8:52654844-52654866 AAGAGGAAACATAAGGAATAAGG - Intronic
1040938612 8:52809121-52809143 GGGAGAAAACATAAGGGAAAGGG - Intergenic
1041838820 8:62246893-62246915 TGGGGTAAACATATGTAATTTGG + Intergenic
1042129815 8:65577003-65577025 GAAAGTAAACAGATGGAAAAAGG - Intergenic
1043581057 8:81715588-81715610 GGTAATAAAAATATGAAATAGGG - Intronic
1043757491 8:84020863-84020885 GGAAAAAAACATATGGAAGAGGG - Intergenic
1044502730 8:92978295-92978317 GGGAGTAAACAAATGCATAAGGG - Intronic
1044952182 8:97445426-97445448 GGAAGTAAACATAAGGTATTTGG + Intergenic
1045235406 8:100348258-100348280 GGGAGTAAGCAGATGGGAAATGG - Intronic
1045606408 8:103782055-103782077 TGCAGTAAATATATAGAATAGGG - Intronic
1045950079 8:107841566-107841588 GGGGGCAAACATATGGGATTTGG - Intergenic
1046898545 8:119499203-119499225 GGGAATATATATATAGAATATGG + Intergenic
1046976205 8:120280874-120280896 AAGAATAAACATAAGGAATATGG - Intronic
1047349757 8:124062434-124062456 GGGATTAGAGATAAGGAATAAGG - Intronic
1050449281 9:5762854-5762876 AGCAGTTAACATATGGAGTATGG - Intronic
1050893866 9:10860100-10860122 GGGAGTCAAAATATGGAAAATGG + Intergenic
1051293710 9:15572807-15572829 GCCAGTAAACATAAGCAATATGG - Intronic
1053188782 9:36041957-36041979 GTGAGTTACCATATGAAATATGG + Intronic
1058957071 9:109959091-109959113 TGGAGAAAACATCTAGAATAGGG - Intronic
1060423809 9:123488176-123488198 TGGAGTAAACACATGGACAATGG + Intronic
1060678489 9:125538961-125538983 GGGAGTAAACATGTACAACAGGG - Intronic
1185972184 X:4677246-4677268 GTGAGTTAACACATGAAATAAGG + Intergenic
1191977667 X:66891562-66891584 GGGAGTCAACATATGTAAATTGG + Intergenic
1192404732 X:70873274-70873296 GGCAGTAAACCTATGGAACTGGG - Exonic
1193201277 X:78694088-78694110 GGGAGTAAATATCAGAAATATGG - Intergenic
1193630167 X:83875740-83875762 GGGAGGAAACATGTAGAATAGGG - Intronic
1197081407 X:122422104-122422126 AGGAGTAAATACATAGAATAGGG + Intergenic
1197816275 X:130501834-130501856 GGGAGAAGACAGATGGAAGAAGG - Intergenic
1197909790 X:131468983-131469005 AGGAATAAACAGATGGAGTAAGG - Intergenic
1198643825 X:138784786-138784808 GGGAGTTAATATTTGGAAAATGG - Intronic
1199098793 X:143773746-143773768 GGTAGTAAACCTATGGTACATGG + Intergenic