ID: 1014009711

View in Genome Browser
Species Human (GRCh38)
Location 6:116461904-116461926
Sequence GCGCGACGCCCCGGGGGACG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 107}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014009701_1014009711 24 Left 1014009701 6:116461857-116461879 CCATTTGACAAGCAGGACAACGA 0: 1
1: 0
2: 0
3: 9
4: 82
Right 1014009711 6:116461904-116461926 GCGCGACGCCCCGGGGGACGAGG 0: 1
1: 0
2: 0
3: 5
4: 107
1014009700_1014009711 30 Left 1014009700 6:116461851-116461873 CCAAAACCATTTGACAAGCAGGA 0: 1
1: 0
2: 0
3: 15
4: 144
Right 1014009711 6:116461904-116461926 GCGCGACGCCCCGGGGGACGAGG 0: 1
1: 0
2: 0
3: 5
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014009711 Original CRISPR GCGCGACGCCCCGGGGGACG AGG Exonic
900087160 1:904194-904216 GCGCGACTCCCAGGGGCCCGGGG + Intergenic
900192992 1:1359229-1359251 GCGGGCAGCCCCAGGGGACGGGG - Intronic
900237584 1:1600088-1600110 GCGCGGCGCGCCGGGGATCGCGG - Exonic
900607816 1:3531531-3531553 GCGCGGCCCCCTGGGGGAGGTGG - Intronic
903287414 1:22285727-22285749 GCGCGCCGCCCAGGGTCACGGGG - Intergenic
903446296 1:23424640-23424662 CCGCGACGCCCGGCGGGGCGAGG + Exonic
907341561 1:53739212-53739234 GGGCGGTTCCCCGGGGGACGGGG + Intergenic
910825673 1:91404730-91404752 GCCCGACGCCCGCGGGGAAGTGG - Intronic
912401468 1:109397455-109397477 GGGCTGCGGCCCGGGGGACGCGG + Intronic
1065099138 10:22316525-22316547 GCTGGACGCCCAGGCGGACGAGG + Exonic
1066047118 10:31603708-31603730 GGGCGGGGCCCCGGGCGACGGGG - Intergenic
1072591478 10:96832229-96832251 GTGCGCGGCCCCGGGCGACGCGG + Intergenic
1076657944 10:132036846-132036868 GGGCGACGTCCCGAGGGAGGGGG + Intergenic
1078180006 11:9003716-9003738 GCGCGAAGCCGCCGGGGCCGGGG + Intronic
1083572682 11:63768704-63768726 GCGCGGGGCCCCGGGGCGCGGGG + Exonic
1083921014 11:65781344-65781366 ACGCGCGGCCCCGGGGGGCGTGG + Intergenic
1084128705 11:67118238-67118260 CCGCGACGGCCCGGGGGCGGTGG - Intergenic
1084171274 11:67401970-67401992 GCGCGGCGGCCCGGGGGGCGGGG + Intronic
1086064753 11:82733189-82733211 GCTCGGCACCCCCGGGGACGTGG + Exonic
1090647458 11:128777242-128777264 CCCCGAGGCCCCGGGGGAGGTGG + Intronic
1100490413 12:95073159-95073181 GCGCGGGGCCCCGGGAGAGGCGG - Intronic
1100985657 12:100199839-100199861 GCGCGAAGGCGCGGGGGCCGGGG - Intronic
1104983410 12:132583666-132583688 CCGCGGCGGCCCGGGGGGCGTGG - Exonic
1106308392 13:28532796-28532818 GCGCTGGGCTCCGGGGGACGCGG + Intergenic
1107123335 13:36819147-36819169 GCGCGGCGCCTCTGGGGGCGGGG - Intergenic
1113779720 13:112969172-112969194 GCGCTGCGCCGCGGGGGGCGGGG - Intronic
1117302228 14:54441146-54441168 GCGCAAAGCCCCGGCGGCCGTGG + Intronic
1117478131 14:56118200-56118222 GCCCCACGCGCCGGGGGAGGGGG + Intronic
1122374226 14:101247750-101247772 ACGCGATGCCCTGGGGGACTCGG + Intergenic
1122637839 14:103138609-103138631 GCGCGAGGCCCCAGGCGAGGAGG + Intergenic
1122657663 14:103273294-103273316 GGGCGAGGCCGCGGGGGACCCGG - Intergenic
1125485624 15:40108917-40108939 GCGTGACGCGCAGGGGGGCGGGG - Intergenic
1127103314 15:55588480-55588502 GCGGGAGGCGCCGCGGGACGAGG - Intronic
1132601553 16:775219-775241 CCGTGCCGCCCAGGGGGACGTGG - Exonic
1132978267 16:2721148-2721170 GCGCGGCGCCGCGGCGGAAGAGG + Intergenic
1133924801 16:10183508-10183530 GCGCGAGGCACTGGGGGAGGAGG - Intergenic
1134539741 16:15055367-15055389 GCCCTACGCCCCGGGGGTAGGGG + Intronic
1136110844 16:28063021-28063043 CCGCGCCGCCCCGGGGGAGCCGG + Intronic
1139467119 16:67159945-67159967 GCGGGACGCGCGGGCGGACGGGG - Exonic
1139968765 16:70760914-70760936 GCGCGAGGCCCAGGTGGACTTGG - Intronic
1142134510 16:88445489-88445511 GCGCCAGGCCCTGGGGGGCGAGG - Intergenic
1142222647 16:88863229-88863251 CCGCGTCTCCCCGTGGGACGGGG - Intergenic
1143521542 17:7446972-7446994 GCGCGGGGCCTCGGGGGGCGGGG + Intronic
1152648564 17:81481585-81481607 GCGGGCCGGCCCGGGGGAGGGGG + Intergenic
1160242104 18:77131982-77132004 GCGCTTCGCCCCGGGGGCAGGGG + Intronic
1160540372 18:79617438-79617460 GGGCGGCGTCCCGGGGGGCGGGG - Intergenic
1161350088 19:3786433-3786455 GCGGGAGGCGCCGGGGGCCGCGG - Intronic
1161955047 19:7489040-7489062 GCGCGCCGCGCCAGGGGGCGGGG + Intronic
1162298252 19:9828118-9828140 GCGCGGCTCCCCGGGGTTCGCGG + Intronic
1162456785 19:10789930-10789952 GTGCTAAGCCCCGGGGGACAGGG - Intronic
1164551108 19:29213047-29213069 GCCCGCCACCCCGCGGGACGTGG + Exonic
1165914178 19:39247812-39247834 CCGCGATGCCCCGGGCCACGTGG + Intergenic
1166869757 19:45864233-45864255 GCGCGCCGCCCTCGGGGAGGCGG + Intronic
1167386868 19:49168579-49168601 GCGCGGTGACCCGGAGGACGGGG + Exonic
1167610654 19:50506388-50506410 GCCCGAGGCCCTGGGGGATGAGG - Exonic
1168412180 19:56146983-56147005 GCGCGTCGCCCAGGTGGAAGCGG - Exonic
930730399 2:54723524-54723546 CAGCGACGCCCCGGAGGACTGGG - Intronic
934521996 2:95025596-95025618 GCCCCACGCCCCGGGAGACCCGG - Intergenic
946909066 2:224442627-224442649 CCGCGAAGGCCCGGGGGACGTGG - Intergenic
947875330 2:233464088-233464110 GCGCGAGGCCCAGGGGGGTGAGG - Intronic
1169132437 20:3173192-3173214 GCGTGTGGCCCCGGGGGGCGGGG + Intronic
1172118177 20:32583830-32583852 CCGGGCCGGCCCGGGGGACGGGG + Intronic
1174204390 20:48828165-48828187 GCACGGGGCCCCTGGGGACGCGG + Intergenic
1174607038 20:51768459-51768481 CCGCGCCGCCCCGGGGGAGGAGG + Exonic
1175185907 20:57179517-57179539 ACGTGAAGCCCCGGGGGAGGGGG + Intronic
1176008856 20:62881090-62881112 GCCCGAAGCCCAGGGGGAAGAGG + Exonic
1176034300 20:63028903-63028925 GCGCGGAGGCCCGGGGGACTCGG - Intergenic
1176181459 20:63751702-63751724 GTGCGACCCACCGGGGGGCGGGG - Intronic
1176234581 20:64048484-64048506 GAGCGGCGCCGCGGGGGGCGCGG + Exonic
1181265599 22:21629035-21629057 GCGCGACGCCCGGGCCGCCGTGG - Exonic
1183071666 22:35400486-35400508 GGGCGACGCCCAGGCCGACGAGG + Exonic
1183765964 22:39875340-39875362 GCCCGCCACCCCGCGGGACGTGG - Intronic
1184280784 22:43436330-43436352 GCGGGACGCCCCTGGGGAGGCGG - Intronic
1184472139 22:44702148-44702170 TCTCGGCGCCCCGGGGGGCGGGG - Intronic
1185278869 22:49961429-49961451 TCGCGCCGCCCTGGGGGACACGG - Exonic
949559476 3:5188324-5188346 GCGCGCGGCCCCGGGCGGCGGGG - Intronic
953485042 3:43286837-43286859 GCGCGCGGCCCGGGAGGACGCGG + Intronic
961740769 3:129031988-129032010 GTGGGACTCCCCTGGGGACGGGG + Intronic
967164976 3:186772537-186772559 GCGCGACCCCCCACGGGACCCGG - Intergenic
968356661 3:198113590-198113612 GCGCGACGGGGCGAGGGACGGGG + Intergenic
971230842 4:24799481-24799503 GCGGGACGCCCCCGCGGAGGTGG - Intronic
972290489 4:37686304-37686326 ACGCGGCGCCCTGGGGGAGGAGG - Exonic
982157371 4:152535690-152535712 GCCCCACGCCCCACGGGACGAGG + Exonic
984964266 4:185127441-185127463 GGGAGAAGCCCCGGAGGACGAGG + Intergenic
984973424 4:185209928-185209950 GCCGGAGTCCCCGGGGGACGCGG + Intronic
986321288 5:6633989-6634011 GGGGGACGCCCCGGGGGATCTGG - Intronic
998401145 5:141849741-141849763 GAGCAACGCCCCGGGAGGCGGGG + Intergenic
1002211197 5:177600285-177600307 GAGCGGCGCCCGGGAGGACGGGG - Intronic
1002696863 5:181098002-181098024 GCGCCAAGCTCCAGGGGACGGGG - Intergenic
1002697759 5:181101371-181101393 GCGCCAAGCTCCAGGGGACGGGG + Intergenic
1006814339 6:36840134-36840156 GCGTGGCGGGCCGGGGGACGCGG + Intergenic
1007521139 6:42452414-42452436 GCGCTGCGCCCCGGGGGAAAGGG - Intergenic
1007633488 6:43285220-43285242 GCGGGACGCCCCGGGGCGGGGGG - Exonic
1007729769 6:43938846-43938868 GCCCGAAGCCCTGGTGGACGTGG + Intergenic
1014009711 6:116461904-116461926 GCGCGACGCCCCGGGGGACGAGG + Exonic
1014205543 6:118651670-118651692 GCGCGGCGCCGCGCGGGGCGGGG + Intronic
1022207777 7:28180285-28180307 GCGCGAGGTGCCGGGGGGCGGGG - Intronic
1024312222 7:47979662-47979684 GGGCCACGCCCCGGAGGAGGTGG + Intergenic
1029494327 7:100889145-100889167 GCCCCACTCCCCGGGGTACGTGG + Exonic
1031531871 7:122886193-122886215 GCGGGACGCGCCGGGGCGCGCGG - Exonic
1034446088 7:151115019-151115041 GCGCCAGGCCCCGGCGGCCGAGG - Intronic
1036454189 8:8893375-8893397 GCGCGGCGCCTCGGGGGGCCCGG + Exonic
1038205050 8:25458157-25458179 GCGCGGCGGGCCGGGGGTCGGGG - Intronic
1039454595 8:37698385-37698407 GCCCGAGGCCCCGGGGTAGGCGG - Exonic
1049197861 8:141325396-141325418 ACGCGACCCCCCGGGGGATGCGG + Intergenic
1053306243 9:36986496-36986518 GCGCGGCGCCCCCGGGAAGGAGG - Intronic
1060811581 9:126613783-126613805 GCGCGGAGCCCCGGGGCGCGCGG + Intergenic
1062558860 9:137130179-137130201 GCGCGGCGTCGCGGGGGCCGAGG + Intergenic
1062718646 9:138023503-138023525 GCGCGGCTCCCCGGAGGAGGCGG + Exonic
1187173174 X:16870659-16870681 GCTCGCCGCCCCGGGGCTCGCGG - Intergenic
1195364301 X:104112502-104112524 GCGTGACGGGCCGGGCGACGCGG - Intronic
1198424028 X:136497157-136497179 GCGCGAGGCCCGGGGAGGCGGGG - Exonic
1199772679 X:150984264-150984286 GCGCCCCGCGCCGGGGGGCGGGG + Intronic