ID: 1014011167

View in Genome Browser
Species Human (GRCh38)
Location 6:116477533-116477555
Sequence GGGTTGATAATTGTTGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014011167_1014011172 21 Left 1014011167 6:116477533-116477555 CCAGTTTCAACAATTATCAACCC No data
Right 1014011172 6:116477577-116477599 CCCACACTTCCCTCCATTACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014011167 Original CRISPR GGGTTGATAATTGTTGAAAC TGG (reversed) Intergenic