ID: 1014012775

View in Genome Browser
Species Human (GRCh38)
Location 6:116495317-116495339
Sequence TGTCATTTGCAAAACATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 475
Summary {0: 2, 1: 14, 2: 23, 3: 76, 4: 360}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014012775_1014012778 -2 Left 1014012775 6:116495317-116495339 CCATCCATGTTTTGCAAATGACA 0: 2
1: 14
2: 23
3: 76
4: 360
Right 1014012778 6:116495338-116495360 CAGGATCTCATTCTTCTTTATGG 0: 17
1: 377
2: 2008
3: 6355
4: 15136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014012775 Original CRISPR TGTCATTTGCAAAACATGGA TGG (reversed) Intronic
902967821 1:20022563-20022585 TGGCATTTGCACAACCTAGATGG - Intergenic
904026175 1:27504972-27504994 TGTCCTCTGCAAAACAGGGAAGG - Intergenic
904935890 1:34129307-34129329 TATCAGTTACAATACATGGAAGG + Intronic
905370153 1:37478722-37478744 TTTCATCTGAAAAACAGGGAAGG + Intronic
906020290 1:42622240-42622262 TGTCATTTGCAATACATGGATGG - Intronic
906812205 1:48839413-48839435 TGTCATTTGCAACAACTAGATGG + Intronic
906870900 1:49479607-49479629 TGTCCTTTGCATGACATGGATGG - Intronic
907751350 1:57266265-57266287 TGTCATTTGCTACTCATGAAGGG - Intronic
908314297 1:62917750-62917772 TGTCCTTTCTAAAATATGGAAGG + Intergenic
908643301 1:66249035-66249057 TGCAATTTGAAGAACATGGATGG - Intronic
909460160 1:75902506-75902528 TGTCCTTTACACAACATAGATGG - Intronic
910545385 1:88410063-88410085 TGTCATTTGCCAAAAATAGAAGG - Intergenic
910733644 1:90427287-90427309 TGTCATTTGCAACAAATGGATGG + Intergenic
911856243 1:102879866-102879888 TGTCATTTGCACCATATTGATGG + Exonic
911857615 1:102900879-102900901 TGTCATCTGGAAAACATATAAGG - Intronic
911961407 1:104307756-104307778 TGTCACTTGCAAATCATGGATGG + Intergenic
912019131 1:105083065-105083087 TGTTATTTACATAATATGGAGGG - Intergenic
912600638 1:110929700-110929722 TGTTTTTTGAGAAACATGGATGG + Intergenic
914994258 1:152527576-152527598 TGTCTTTTACAGAACATGGATGG - Intronic
915166489 1:153950959-153950981 TTTCATTTCTAAAACAAGGATGG - Intronic
915866924 1:159511159-159511181 TGATATATGCAAAACTTGGATGG + Intergenic
916247286 1:162701327-162701349 TGGCATTTGCAGTAAATGGAAGG + Intronic
916345815 1:163790172-163790194 TGTCATTTGAAAGGCTTGGAGGG - Intergenic
916634711 1:166656157-166656179 TGTGAATTGTAAAACATGCATGG - Intergenic
916870698 1:168911716-168911738 TCTCATTTTCAAAACAAGAAAGG + Intergenic
917613437 1:176713578-176713600 TGTCATTTTCAAAACTAGGCTGG + Intronic
917763055 1:178185278-178185300 TGTCATTTGCAAATAAAGGCAGG + Intronic
918563305 1:185895607-185895629 TTTCATTTACAAAACAAGCAAGG + Intronic
918731217 1:187999868-187999890 TGTCATTTAAAAGGCATGGACGG + Intergenic
918774492 1:188610745-188610767 AGTCATTTGCTGAAGATGGAAGG - Intergenic
919204586 1:194405750-194405772 TGTTCTTTGCAGGACATGGATGG + Intergenic
919316379 1:195975708-195975730 TGTGATTTGCAACAAAGGGATGG - Intergenic
919598744 1:199596594-199596616 TGTCCTTTGCAGGAAATGGATGG - Intergenic
921099367 1:211915159-211915181 TGTCATCAGCATCACATGGAGGG - Intergenic
923942073 1:238839143-238839165 AGTTAATTGCAAAACATGCATGG - Intergenic
924001964 1:239564143-239564165 TGTCATTCATAAAACATGTACGG + Intronic
924578964 1:245306678-245306700 TGGCATTTGAATAACATGTAAGG - Intronic
1064550688 10:16498098-16498120 TGTCATTTACAAAACATCCTGGG - Intronic
1065700014 10:28415732-28415754 TGTCTTTTGCGGAACATGGATGG - Intergenic
1068456271 10:57257792-57257814 TATCGTTTGCAAAACATGAAGGG - Intergenic
1068811140 10:61257190-61257212 TGTCAGTTTTAGAACATGGATGG + Intergenic
1069253888 10:66308123-66308145 TTTCATTTGCAAAAAATGCAGGG - Intronic
1069258924 10:66369687-66369709 TGTCATTTGCAAATGTTGGCCGG + Intronic
1069345969 10:67470251-67470273 TGTCATTTGCAAAACATGGTTGG - Intronic
1070545991 10:77452966-77452988 TCTCATCTGGAAAACAGGGATGG + Intronic
1071058543 10:81541366-81541388 TGGCATTTACATAACCTGGATGG + Intergenic
1071436899 10:85655784-85655806 TGTCATTTTAAAAGGATGGAAGG - Intronic
1072075900 10:91973568-91973590 TCTCATCTGCAAAACAGGAATGG - Intronic
1072165830 10:92812266-92812288 TGCCATTTGCAGAAAATGGCAGG + Intergenic
1073084668 10:100880396-100880418 TGTTATTTGCAGAACAGGGATGG - Intergenic
1073938511 10:108664600-108664622 TGATATTTGCAGAAAATGGAAGG - Intergenic
1073952948 10:108831848-108831870 TGTCCTTTCCAGGACATGGATGG + Intergenic
1074393128 10:113074429-113074451 TGACATTAGCAAGATATGGAAGG - Intronic
1074683760 10:115938690-115938712 AGTCATTTGCAACACATGAATGG + Intronic
1075187598 10:120277033-120277055 TGTCCTTTGAAGGACATGGATGG + Intergenic
1075215960 10:120535107-120535129 TGTCATTTGCAATGAATGGCTGG + Intronic
1075767459 10:124905020-124905042 TGTTATTTCCAAATGATGGAAGG - Intergenic
1075870445 10:125769318-125769340 TGGCAATTGCTCAACATGGAAGG - Intronic
1075900303 10:126037865-126037887 TGGCATTTGGAAACCATGGTGGG + Intronic
1078007535 11:7543750-7543772 TTTCTTTTGCCAAACATGAAAGG + Intronic
1078347690 11:10565549-10565571 TTTCTTTTTGAAAACATGGAAGG + Intronic
1078517753 11:12039156-12039178 TGTCCTTTGCAGCACATGGATGG + Intergenic
1078975287 11:16467475-16467497 TGTCCTTTGCAGGACATGGATGG + Intronic
1079293093 11:19206517-19206539 TGTCATTTATAAAGCAAGGATGG - Intronic
1081015456 11:37872745-37872767 TGACATTTTCACAACATGAATGG - Intergenic
1081826638 11:46060166-46060188 TGACTTTTTCAAAACATGGATGG + Intronic
1082116568 11:48335975-48335997 TGTCCTTTTAAAAACATGGTTGG + Intergenic
1082257225 11:50044335-50044357 TGTCCTTTTAAAAACATGGTTGG - Intergenic
1082904093 11:58287185-58287207 TGTCTTTTGCAGAACATAGATGG + Intergenic
1084131825 11:67141973-67141995 TGTCATTTTCGGAACATGGATGG - Intronic
1084765800 11:71307549-71307571 AGTCCTTTACAAGACATGGAAGG - Intergenic
1085141304 11:74144754-74144776 TGTCCTTTGCAGGACATGGATGG - Intronic
1085449066 11:76621220-76621242 TGTTATTTTTAAAATATGGAAGG + Intergenic
1087175836 11:95094087-95094109 TATCATTTTATAAACATGGAAGG + Intronic
1089020757 11:115211950-115211972 TGTGATTTGCACAAAATGGGAGG - Intronic
1089144038 11:116311319-116311341 TGTCCTTTTCAGACCATGGAGGG - Intergenic
1090087058 11:123659560-123659582 TGCCATTTGCAAATCCAGGAAGG - Intergenic
1090586941 11:128223197-128223219 TGTCCTTTGCAGGACATGGATGG - Intergenic
1091901477 12:4147507-4147529 CCTCATTTGCAAAACAAGGATGG + Intergenic
1093465237 12:19441427-19441449 TGTGATTGTCAAAACATAGATGG - Intronic
1093819879 12:23601235-23601257 TGCAATTTGCAAAAAATGGAAGG - Intronic
1095389167 12:41685443-41685465 TGGCATTTGCACAACCTGGGTGG + Intergenic
1095585945 12:43849202-43849224 GGTCATTTTCCAAAAATGGATGG + Intronic
1097538359 12:60902502-60902524 TGTCATTTGCAACACATGGATGG + Intergenic
1098118439 12:67206702-67206724 TGTCATTTGCACAACATAGATGG + Intergenic
1098843259 12:75503229-75503251 TGTCATATGCTAAACATGGGAGG + Exonic
1099186883 12:79524807-79524829 TGTCATTTGCATTATTTGGATGG - Intergenic
1100085949 12:90911119-90911141 TGTCTTTTGAGCAACATGGATGG + Intronic
1100130199 12:91483183-91483205 TGTGATTTGCAAAAGATGAGAGG - Intergenic
1100198327 12:92272393-92272415 TGTCATTTGCCAAACTCTGACGG - Intergenic
1100268521 12:93001355-93001377 TGTCATTTGCAAAACAGAGATGG - Intergenic
1100705599 12:97197102-97197124 TTTCAGTTGCCAAACAAGGAGGG - Intergenic
1101143156 12:101816881-101816903 TGTAATTTGCAGCGCATGGATGG + Intronic
1102806916 12:115790120-115790142 TGTCATTTGCAGAACATGGATGG - Intergenic
1103103463 12:118201608-118201630 TGAGATTTACAAAATATGGAAGG - Intronic
1104656469 12:130577188-130577210 TCTCATCTGTAAAACAGGGATGG + Intronic
1104796459 12:131523204-131523226 TATCCTTTGCAGGACATGGATGG + Intergenic
1105350286 13:19608808-19608830 TGACATTTGGTACACATGGATGG - Intergenic
1105916855 13:24924870-24924892 TCTCATCTGCAAAACAGGGGTGG + Intergenic
1107643540 13:42470256-42470278 TGTCATTTGCACAAGATGGATGG + Intergenic
1108255385 13:48604745-48604767 TGTCATCTGCACAACATGGTTGG - Intergenic
1108328983 13:49365991-49366013 TGTCATTGCAACAACATGGATGG + Intronic
1108470378 13:50761416-50761438 TGTCATGTGCAAAAAAAAGAGGG + Intronic
1108738978 13:53314998-53315020 TGTCTTTTGCAGAACTTGGGTGG + Intergenic
1108835347 13:54539285-54539307 TTTCAATAACAAAACATGGATGG + Intergenic
1109051449 13:57487618-57487640 TGTCTTGTACAAAACATAGATGG - Intergenic
1110290400 13:73799099-73799121 CGTCTTTTGCAGCACATGGATGG + Intronic
1110887791 13:80659523-80659545 TGTCTTTTGCGCAACTTGGATGG - Intergenic
1110972907 13:81788854-81788876 AGTCATTTGCAGAACGTGGATGG - Intergenic
1111062892 13:83046284-83046306 TGCCATTTGCCACACATGAATGG - Intergenic
1111181167 13:84667278-84667300 TAATATTTACAAAACATGGACGG + Intergenic
1111400998 13:87734887-87734909 TGGGATTTGAAAAACAAGGATGG + Intergenic
1111882071 13:93969874-93969896 TGTCATTTGCGCAACGTGGATGG - Intronic
1112042079 13:95556593-95556615 TCTCATCTGTAAAACAGGGATGG - Intronic
1112317501 13:98376425-98376447 TGTCATTTGCACAGCATGATTGG - Intronic
1112641599 13:101281631-101281653 TGTCAGTTTAAAAAAATGGAGGG - Intronic
1113307291 13:109092420-109092442 TGTCGTTTGTGGAACATGGATGG + Intronic
1113479412 13:110609511-110609533 TATCATTTGCAAAACTAGGCAGG + Intergenic
1114829139 14:26118231-26118253 TGTCCTTTGCAGGACATGGATGG + Intergenic
1115022662 14:28701712-28701734 TGACATTTGTTAAAGATGGAAGG + Intergenic
1115764714 14:36611837-36611859 TGTTTTTTGCAGGACATGGATGG + Intergenic
1115908289 14:38226095-38226117 TCTCATTTGCAAACCTAGGATGG + Intergenic
1116034204 14:39608426-39608448 TGTCATCTGCAACACATGTATGG - Intergenic
1116035544 14:39622798-39622820 TGTCCTTGGCAGGACATGGATGG - Intergenic
1116717812 14:48449570-48449592 TGTCCTAGGCAAAACAGGGAGGG + Intergenic
1116943687 14:50816036-50816058 TGTCCTTTGCAAGACATAGATGG + Intronic
1117842462 14:59873976-59873998 TGTCATTTGCACAACATGGATGG - Intergenic
1118438204 14:65790256-65790278 AGTCATTTGCTGAACATGCAGGG - Intergenic
1118666912 14:68080176-68080198 TCCCATTTGCAAAATAAGGATGG + Intronic
1119583492 14:75809869-75809891 TGTCATTTGCAGAACATAGATGG - Intronic
1119811521 14:77524692-77524714 TGTCATTTGCACAAGATGGATGG + Intronic
1119891854 14:78188766-78188788 TGTCATTTACAAAATAGGAATGG + Intergenic
1120169271 14:81232691-81232713 TGGCCTATGCAAAAGATGGATGG + Intergenic
1121796128 14:96736857-96736879 TGCCTTTTGTGAAACATGGATGG - Intergenic
1123689542 15:22825887-22825909 TCCCATTTGGAACACATGGATGG - Exonic
1126828426 15:52574451-52574473 TGTCATTTGCAGCAACTGGATGG - Intergenic
1126994392 15:54423740-54423762 TGTCATTATCATAACATGGTAGG + Intronic
1127805512 15:62516309-62516331 TGTCATTTGCAAAAAGGAGAAGG - Intronic
1127857066 15:62961655-62961677 TGTCTTTTGAAAAACATCTAAGG - Intergenic
1127936542 15:63645538-63645560 TGCCATTTACAATAGATGGATGG + Exonic
1128702378 15:69813848-69813870 TGTTATCTGCAAAATATGGGGGG + Intergenic
1130423121 15:83768119-83768141 TGTCTTTTTCAAAACAATGATGG - Intronic
1131719359 15:95150428-95150450 TCTTAGTTGCAAAACTTGGAAGG - Intergenic
1131965222 15:97835020-97835042 TGTCATTAGTAAGACATAGATGG - Intergenic
1132245293 15:100291679-100291701 TGTCCTCTGCAGCACATGGATGG + Intronic
1132248813 15:100318045-100318067 GGACATTTGCAGGACATGGAAGG + Intronic
1134297856 16:12962611-12962633 TGTCATCTGCAAAACAGGAGGGG + Intronic
1134380894 16:13724949-13724971 TGTCTTTTGCGAAACTTGGTTGG + Intergenic
1134867659 16:17622655-17622677 TGTAATTTGCAAAACACAGAAGG - Intergenic
1135279604 16:21142505-21142527 TATCATTTGCAATAAATAGAAGG + Intronic
1135580607 16:23622968-23622990 TGACGTTTGCAGAAGATGGAGGG - Exonic
1138853504 16:60658759-60658781 TGTCTTCTTCACAACATGGATGG - Intergenic
1138872977 16:60915075-60915097 TTTCCTTTGCAAAACATAGAGGG + Intergenic
1139201598 16:64983077-64983099 TGTCACTTGCCAAAAATAGAAGG - Intronic
1139970302 16:70770135-70770157 TGTCATTTGCACACCAGGGCTGG - Intronic
1140722110 16:77781260-77781282 TATCATTTGGTAAACATGGTTGG - Intergenic
1140807776 16:78548961-78548983 TGGCATTTCCAACAGATGGATGG + Intronic
1141135840 16:81464861-81464883 TGGCATGTGCTAAACATGGGGGG - Intronic
1141260244 16:82446909-82446931 TGGCATTTGCAGCACCTGGATGG + Intergenic
1141601297 16:85128060-85128082 TGTAATTTGTTAAACAGGGAAGG - Intergenic
1142302151 16:89265144-89265166 TGGCTTTTGTAAAACCTGGAAGG - Intergenic
1144286097 17:13776198-13776220 AGTCATTTGTACAACAAGGAAGG + Intergenic
1145939650 17:28736077-28736099 TGTCCTTTGTAGGACATGGATGG - Intronic
1147996195 17:44361759-44361781 GTTCATTTGTAAGACATGGAAGG - Intronic
1150316010 17:64169578-64169600 TGTGATGCGAAAAACATGGATGG + Intronic
1150841350 17:68609793-68609815 TGTCAGTTTTAACACATGGATGG - Intergenic
1152398178 17:80047931-80047953 TGTCATTTGCAAGTAATGAAAGG - Intronic
1152882987 17:82830987-82831009 TGTCATTTTCAAAACCTCCAAGG - Intronic
1153474841 18:5488260-5488282 TGTCCTTTTCAGGACATGGATGG + Intronic
1153564560 18:6406505-6406527 TGTCATCTGCAAAACAGGCTGGG + Intronic
1153757046 18:8294677-8294699 TATCATTTCAAAAACATGGTAGG - Intronic
1153837250 18:8974975-8974997 TGTCATTTGCAAAACATGGATGG + Intergenic
1153982310 18:10320893-10320915 TGTTATTTGCAAAATAAGAAGGG + Intergenic
1154020260 18:10658402-10658424 TGTCATTTACATAACATGAGAGG + Intergenic
1154461018 18:14586252-14586274 TGTTATTTGCAAAGCATGGATGG + Intergenic
1155630801 18:27889835-27889857 TGTCCTTTGCACAACATTCAAGG + Intergenic
1156715364 18:40002561-40002583 TGTATTTTGCAGAACATGGATGG + Intergenic
1156873815 18:41980931-41980953 TGTCATTTACAAAACATTCGAGG - Intronic
1157381138 18:47218622-47218644 TGTCCTTTGTAAAATAAGGAAGG + Intronic
1158123132 18:54072358-54072380 TGTCATTTGTAGAATATGAATGG - Intergenic
1160081765 18:75734559-75734581 TGTCCTTTGCAGGACATGGATGG - Intergenic
1161547927 19:4893588-4893610 TGTGATTTGAAAAACATTGCTGG + Intronic
1161846875 19:6716770-6716792 TCTCATTTGCAGGACATGGCAGG + Intronic
1162272261 19:9625797-9625819 TGCCATTTGTAACAAATGGAAGG + Intronic
1162475489 19:10896928-10896950 CTTCATTTGCAAAACCCGGAAGG - Intronic
1164254075 19:23512011-23512033 TGTAATTTGCAATTCATGGAAGG - Intergenic
1164722244 19:30441015-30441037 TGTCACTTGCATAGCATGAATGG + Intronic
1168672391 19:58250496-58250518 TGTCATTTAGAAAACCTGTATGG - Intronic
925699408 2:6618684-6618706 TCCCATCTGCAAAACAAGGATGG + Intergenic
926304206 2:11626284-11626306 GGTCATTTGAAAAACAAGCAGGG + Intronic
926353784 2:12021398-12021420 TATCACTTGCAGAGCATGGAGGG + Intergenic
926415018 2:12641306-12641328 TGTCATTTGTAAAATAGAGATGG - Intergenic
927294892 2:21442707-21442729 TGTCATTGCAACAACATGGATGG + Intergenic
927307620 2:21591468-21591490 TGTCTAATGCAAAATATGGATGG + Intergenic
928494932 2:31821936-31821958 TGTTATTTGCAGAACATGTATGG - Intergenic
928498824 2:31865361-31865383 TCTCATTTGTAAAATGTGGAGGG - Exonic
928634146 2:33225884-33225906 TGTCATTTGTGTAACATGGATGG - Intronic
928863510 2:35889523-35889545 TGTCACTTGCAACAAATGGATGG - Intergenic
929979574 2:46666013-46666035 TATCATTTCCACACCATGGAAGG - Intergenic
930191593 2:48465723-48465745 TGTCCTTTGCAGTACTTGGATGG - Intronic
931502148 2:62881080-62881102 TGTTCTTTGCAGCACATGGATGG + Intronic
931599214 2:63986412-63986434 TGTCATTTGCAACAGATGGATGG - Intronic
931983075 2:67714760-67714782 TGTCTTTTGCACAGCATGAATGG - Intergenic
932647463 2:73518268-73518290 TGTCTTTTGCAGAACATGGATGG - Intronic
932977293 2:76618693-76618715 TGTCATTTGCAGTACATGGGTGG - Intergenic
933296829 2:80500478-80500500 TGTCATTTGCCAAGCATTAATGG + Intronic
933377973 2:81504819-81504841 TCTCACATGCAAAACATTGAGGG - Intergenic
933418357 2:82016153-82016175 TGTCTCTTCCAAAACATAGAAGG - Intergenic
933500545 2:83105417-83105439 TCTCATTTGCTACAAATGGAAGG + Intergenic
935575085 2:104701071-104701093 TGGCAGCTGCAAAACATGGCAGG - Intergenic
935627380 2:105182536-105182558 AGTCATTTGCACCACATGGATGG - Intergenic
936415210 2:112301523-112301545 TCTCATGTGAAAAAAATGGATGG - Intronic
937084671 2:119163083-119163105 TGGTCTTTGCAAAACATAGATGG - Intergenic
937464304 2:122116921-122116943 TGTCATTTTCAGCACATGGATGG - Intergenic
937735966 2:125289750-125289772 TGTCCTTTGCGGGACATGGATGG - Intergenic
938659810 2:133474237-133474259 TGTCATTTCTACAACATAGATGG + Intronic
939409347 2:141804116-141804138 TGTCATTTGAAAATTATGGAAGG - Intronic
940346442 2:152633814-152633836 TGTCATTTGAAAAACATCGGTGG + Intronic
940551352 2:155161089-155161111 TGTCATCTGAAAAACATTAATGG + Intergenic
941648929 2:168072172-168072194 TGTCATTTTTAAAACATGAATGG - Intronic
942916793 2:181319004-181319026 TGGAATTTGCAAAACAAGGCAGG + Intergenic
943136932 2:183925498-183925520 TAACACATGCAAAACATGGATGG + Intergenic
943221247 2:185109207-185109229 AGTAAATTGAAAAACATGGATGG + Intergenic
943387834 2:187224458-187224480 TGTCATGTGAAAAAAAGGGAAGG + Intergenic
943484230 2:188458997-188459019 AGTCATTTGCAACAAATGGATGG - Intronic
943572471 2:189589992-189590014 TGTCATTTGAGCAATATGGATGG - Intergenic
943866713 2:192933656-192933678 TGTGGTTTGCCCAACATGGATGG - Intergenic
943926284 2:193785258-193785280 TGTCAATTAAAAAACATGGATGG + Intergenic
944362310 2:198871475-198871497 TGTCATTGGAAAAAATTGGAAGG + Intergenic
945377472 2:209096304-209096326 TGCTCTTTGCAGAACATGGATGG - Intergenic
945789505 2:214287120-214287142 TGGCATTTGCTAAATATGCAAGG - Intronic
945814366 2:214585902-214585924 TTTCACTTGCAGAAAATGGAAGG + Intergenic
945973006 2:216248495-216248517 TGTCATTGCAACAACATGGATGG - Intergenic
947223424 2:227817154-227817176 TTTCACTTGCACATCATGGAGGG + Exonic
947584919 2:231349267-231349289 AGTCATTTGCAAAACATGGATGG + Intronic
948019049 2:234715275-234715297 GGTCATCTTCAAAACATGGATGG + Intergenic
1170598071 20:17820428-17820450 TGTCATTTTTCAAACATGGAAGG + Intergenic
1170708810 20:18770229-18770251 CGTCATTTGCAAAACATGGATGG - Intergenic
1171002847 20:21432180-21432202 ATTCATTTGCAAAAGAAGGAAGG - Intergenic
1172690242 20:36784917-36784939 TCTCATTTGGGAAACTTGGAGGG + Exonic
1173099524 20:40072471-40072493 TGCCATTTGGAACACATAGATGG + Intergenic
1173153709 20:40589677-40589699 TCTTATTTGAAAAACTTGGAGGG + Intergenic
1174738359 20:52986772-52986794 TATCATTTGCCATACATTGATGG - Intronic
1175619312 20:60430215-60430237 TGTCATGTGCAAAATAAGCAAGG + Intergenic
1176813484 21:13571588-13571610 TGTTATTTGCAAAGCATGGATGG - Intergenic
1177764848 21:25445870-25445892 TGTCTCTTGCAGAACATAGATGG + Intergenic
1178482282 21:32989942-32989964 GGTCATTTGCAAAATGGGGATGG + Intergenic
1178945551 21:36944210-36944232 TGAGATATGCACAACATGGATGG + Intronic
1184591138 22:45484188-45484210 TGTCAATTGCAACACACAGAGGG - Intergenic
1184898517 22:47427191-47427213 TGACAGATGCAAAAGATGGATGG + Intergenic
949416321 3:3818656-3818678 TGTGACTTTCAAAACATGGGAGG + Intronic
949480275 3:4487458-4487480 TGTCATTTAAAAAATATGGCAGG - Intergenic
950166191 3:10801586-10801608 TCACATTTGCAAAAAATGCATGG + Intergenic
950953877 3:17029910-17029932 TGTCCTTTGCAAAACATGCCAGG - Intronic
951270839 3:20621932-20621954 TGTCATTTCAACAGCATGGATGG - Intergenic
951754061 3:26069800-26069822 TCTCATTTCAACAACATGGATGG - Intergenic
952482310 3:33774349-33774371 TGTCATTTGTACACCATGGTTGG + Intergenic
952538818 3:34344669-34344691 AGTCATTTGCAACAACTGGAAGG + Intergenic
952798359 3:37263477-37263499 TGTCATGTGAACATCATGGAGGG - Intronic
953816016 3:46157387-46157409 TGTCCTTTGCAAGGAATGGATGG - Intergenic
954883833 3:53854816-53854838 TGTCCTTTTCAAATGATGGATGG + Intronic
955125694 3:56109324-56109346 TGTCTTTTGTGGAACATGGATGG - Intronic
955162456 3:56477793-56477815 TGGCAGTTGAAAAACTTGGAAGG - Intergenic
955287866 3:57661132-57661154 TGTCACTTGCTACAGATGGAAGG - Intronic
955641767 3:61093357-61093379 TGTGATTGTCAAAACCTGGAGGG + Intronic
956330494 3:68101602-68101624 TTTCCTCTTCAAAACATGGAAGG - Intronic
956531757 3:70227767-70227789 CCTCATTTGTAAAACATGGAGGG - Intergenic
956687811 3:71847400-71847422 TATCATTTGCAGGAGATGGAGGG - Intergenic
957429719 3:80086590-80086612 TGTCTGTTGCAAAATATGCATGG + Intergenic
957482732 3:80819356-80819378 TGTCCTTTGTGCAACATGGATGG + Intergenic
958023462 3:88023885-88023907 TGTCATTTGCAGCAACTGGATGG + Intergenic
958828089 3:99056355-99056377 TGTCAGTGGCAAAACACGAAAGG + Intergenic
959773740 3:110132074-110132096 TGTCCTTTGCAGGACATAGATGG + Intergenic
960920476 3:122741936-122741958 AGACATTTGGAAAACATGGGTGG + Intronic
961374856 3:126457386-126457408 TCTCTTTTCCAAAACATGCAGGG - Intronic
962068414 3:132008374-132008396 TAGAAGTTGCAAAACATGGAAGG - Intronic
962341586 3:134589936-134589958 TGTCTTTTCAGAAACATGGATGG + Intergenic
962392872 3:134987821-134987843 TGGCATCTGCAAACCAAGGACGG + Intronic
963532545 3:146489006-146489028 TGTCCTTTGCAGGACATGGATGG + Intronic
963747381 3:149138513-149138535 TGTAATTTGGAGGACATGGATGG + Intronic
964904622 3:161704680-161704702 AGTCATTTGCAAAACATAGGTGG + Intergenic
965295383 3:166938716-166938738 TGTTTTTTGCAGAACATGTATGG - Intergenic
965989265 3:174796526-174796548 TGTCTTTAGCACAACATGGATGG - Intronic
965993851 3:174854218-174854240 TATCTTTTGCAGTACATGGATGG + Intronic
966654800 3:182343833-182343855 TGTTCTTTGCAGCACATGGATGG - Intergenic
966966798 3:185002753-185002775 TGGCATTTGCACAATCTGGATGG - Intronic
967787605 3:193514384-193514406 TGTCCTTTTCAGGACATGGATGG - Intronic
969008383 4:4040289-4040311 TGCCATTTGCAGAACAGAGATGG - Intergenic
970049334 4:11896316-11896338 TGTCATCTCCAGAACCTGGAAGG - Intergenic
970366531 4:15364695-15364717 TGTGATTTTTAAAACATGTATGG + Intronic
970370369 4:15399793-15399815 TGCCACTTGCAAAATTTGGAAGG + Intronic
971521034 4:27550663-27550685 CATCATTTGCACAACATAGAAGG + Intergenic
971620199 4:28845786-28845808 TGTTCTTTGCAGGACATGGATGG - Intergenic
971735588 4:30445593-30445615 ATTCATTTCCAAAATATGGAAGG + Intergenic
972213176 4:36863092-36863114 TGTCTTTTGCACAACTTGGATGG + Intergenic
972297616 4:37755180-37755202 TGTTATTTGTAAAAAATGGAAGG + Intergenic
972910663 4:43812649-43812671 TGTCCTTTGCAGAGCGTGGATGG + Intergenic
972950974 4:44321904-44321926 TGTCACTTCAACAACATGGATGG - Intronic
973120983 4:46520928-46520950 TGTTATTTGCAGAAGATGGCAGG + Intergenic
973182090 4:47281726-47281748 TGTTATTTGTAACAAATGGATGG + Intronic
974337151 4:60563968-60563990 AGTCATTTGTACAACATGGATGG - Intergenic
975442153 4:74423168-74423190 TATCAGTCTCAAAACATGGATGG - Intergenic
975752366 4:77537251-77537273 AGTCATTGGCTAAACCTGGAGGG + Intronic
978400167 4:108322712-108322734 TGTCATTTGCAACAACAGGATGG + Intergenic
978894009 4:113864139-113864161 TTTCATTTGCAAATAAGGGAAGG - Intergenic
979482523 4:121236383-121236405 TGTCTTTTGGAAAACTTTGAAGG + Intergenic
979553787 4:122021589-122021611 TGTCCTTTGCACAACATCGTTGG + Intergenic
980282758 4:130741797-130741819 TATCCTTTGGAGAACATGGATGG - Intergenic
981453302 4:144924417-144924439 TGTCATTTGCAATAACTGGATGG - Intergenic
981462808 4:145031775-145031797 AGTTATTTGCAAAAGATGGCAGG - Intronic
982873874 4:160619981-160620003 TGGCATCTGCAAACCATGGTGGG - Intergenic
983099708 4:163610022-163610044 TGCCATTAGCACAACAGGGATGG - Intronic
983155620 4:164344063-164344085 TGTCCTTTGCACAGCATGGATGG + Intronic
983809721 4:172045998-172046020 TGCTATTTGCAAGACATGGATGG - Intronic
984628016 4:182030384-182030406 TGTCTTTTGCAGGACAGGGATGG - Intergenic
987015207 5:13810918-13810940 TGTCATTTGAACAACATGAATGG + Intronic
987433836 5:17868705-17868727 AGTCATTTCAACAACATGGATGG - Intergenic
987657141 5:20821681-20821703 AGTTATTTGCAAAAGATGGCAGG + Intergenic
987843632 5:23253880-23253902 TATCATTTGAAAAATATGGGGGG + Intergenic
988118612 5:26929679-26929701 TGTCATTTCAAAAACACAGATGG + Intronic
988556038 5:32236914-32236936 TGGCATTTACATAACATGGGAGG - Intronic
989033930 5:37149970-37149992 TGTCTTTTGCTACACATGGTGGG - Intronic
989606717 5:43251459-43251481 CCTCGTTTGTAAAACATGGAAGG - Intronic
990723346 5:58724089-58724111 TGACATTTGCAAAAGAGAGATGG - Intronic
990797039 5:59555188-59555210 TGTCCTCTGCAAAACGTGGATGG + Intronic
992210899 5:74478575-74478597 TGTTATTTGCAAATGATGTATGG - Intergenic
992331968 5:75726382-75726404 TATCATTTGAACAAAATGGATGG - Intergenic
993057926 5:83003736-83003758 TGTCACATGCACAACATGGAAGG - Intergenic
993071139 5:83165787-83165809 TGTCCTTTGCAGGACATGGATGG - Intronic
993247684 5:85471655-85471677 TGTCCTTTGCAAAACATGGATGG + Intergenic
993568689 5:89508562-89508584 TGTCTTTTGCGGAACATGGATGG + Intergenic
993820605 5:92611011-92611033 TATCCTTTGCAGGACATGGATGG + Intergenic
993889903 5:93461172-93461194 TGTCCTTTGCAAGACATGGATGG + Intergenic
995059044 5:107794179-107794201 TGTCCTTTGCAAAACATGGATGG + Intergenic
995357641 5:111257835-111257857 TGTCCTTCGCAGGACATGGATGG + Intronic
995458893 5:112381816-112381838 TGTCATTTTCACATTATGGAAGG - Intronic
995621904 5:114034868-114034890 TGTTCTTTGCAGAACATGGATGG - Intergenic
996795853 5:127345998-127346020 TGACATTTGCAGCACCTGGATGG - Intronic
997489945 5:134265716-134265738 TGTTAACTGCAAACCATGGATGG + Intergenic
997785989 5:136714456-136714478 TGTCCTTTGCAGAAAATGGATGG - Intergenic
998046909 5:138995012-138995034 TGTCCTTTGCAGGACATGAATGG - Intronic
998604717 5:143621948-143621970 TGTCTTTTGCAGAACATGGATGG + Intergenic
998634406 5:143937020-143937042 TGTCATTTGCACAGCATGGATGG + Intergenic
998946712 5:147347767-147347789 TTTCATTTTCAAAACACAGAAGG + Intronic
1000189600 5:158897255-158897277 TGTCCTTTGCGGGACATGGATGG + Intronic
1000588463 5:163129143-163129165 TGTCCTTTGCAGAACATGGATGG + Intergenic
1000847757 5:166302807-166302829 TGTATTTTGTAAAACATGGCTGG - Intergenic
1001178895 5:169499782-169499804 TGTCCTTTGTGCAACATGGATGG - Intergenic
1001448862 5:171808654-171808676 TGTCCTTTGCAGAACGTGGATGG + Intergenic
1004183811 6:13404750-13404772 TCTCATTTACAAAACCTGGTTGG + Intronic
1004973638 6:20939854-20939876 TGTAATTTGCCATACATGGGTGG - Intronic
1005919240 6:30384100-30384122 TGTCCTTTGCGGAACATGGATGG - Intergenic
1007452438 6:41950478-41950500 TCTCATTTGCAAAAGGAGGATGG + Intronic
1007552117 6:42738118-42738140 TGTCATTTGCAACAAATGGATGG + Intergenic
1007959521 6:45946401-45946423 TGTGATTTGAAAAAAATGGTTGG + Intronic
1007962916 6:45977432-45977454 TTTAATTTACAAAAGATGGAGGG - Intronic
1008208558 6:48692786-48692808 TGTCCTTTGCAGGACATAGATGG + Intergenic
1008213901 6:48761136-48761158 TGTCTTTTGCAAAAAATTGTGGG - Intergenic
1008933163 6:56961257-56961279 TTTCCTTTGCTAACCATGGACGG - Intronic
1010242864 6:73632840-73632862 TGTCATTTTCTCAACATTGATGG - Intronic
1010601389 6:77831595-77831617 CATCATTTGCAGAGCATGGATGG + Intronic
1010829029 6:80508429-80508451 AGTCAGTAGCAAATCATGGAAGG - Intergenic
1012009498 6:93764353-93764375 TGTGAGTTGCTAAAAATGGAAGG - Intergenic
1013563064 6:111326072-111326094 CGTCATTTGCAAAACATGGATGG - Intronic
1014012775 6:116495317-116495339 TGTCATTTGCAAAACATGGATGG - Intronic
1014213086 6:118727404-118727426 TGTCAGTTGCAAGCCATGTAGGG - Intergenic
1014375300 6:120664774-120664796 TGTCCTTTGCAGGGCATGGATGG - Intergenic
1015208514 6:130669471-130669493 TGTCATTGGAACAACATGAATGG + Intergenic
1016271820 6:142299263-142299285 TGTCATTTGTGACACGTGGATGG - Intergenic
1016633835 6:146264838-146264860 TGTCTTTTGTGCAACATGGATGG - Intronic
1018515566 6:164576309-164576331 TGGAATATGCAAAACATGAATGG - Intergenic
1019025116 6:168954861-168954883 TGTCATTTGCACAACATGGCTGG + Intergenic
1019098427 6:169607465-169607487 TGTCTTTTGCAGCACATGGATGG + Intronic
1020603333 7:10304179-10304201 TAGCATTTGAAAAACATGTATGG + Intergenic
1021364247 7:19756750-19756772 GGTCTTTTGCAGGACATGGATGG - Intronic
1022344789 7:29503722-29503744 TTTCATTTGGAAAACATTTATGG - Intronic
1024404184 7:48959092-48959114 TTTGATTTTCAAAACATAGAAGG - Intergenic
1024504946 7:50154540-50154562 TGCCATTTGCACAACACAGATGG - Intronic
1025114705 7:56247767-56247789 TATCATTTGTAAAACATGGAGGG - Intergenic
1025164418 7:56699350-56699372 TGTCATTTCAACAAGATGGATGG + Intergenic
1025282758 7:57640031-57640053 TGTTATTTGCAAAACATTCCTGG - Intergenic
1025301959 7:57825386-57825408 TGTTATTTGCAAAACATTCCTGG + Intergenic
1026055296 7:66978512-66978534 TGAAATTAGCAAAACATGCAGGG + Intergenic
1026722405 7:72843321-72843343 TGAAATTAGCAAAACATGCAGGG - Intergenic
1028481816 7:91314374-91314396 TGTCACTGGGAAACCATGGATGG - Intergenic
1028568833 7:92263898-92263920 TGGGATTTGGAAAATATGGACGG + Intronic
1028750787 7:94380552-94380574 TGTCATTCACAAAGCAAGGAGGG - Intergenic
1032313692 7:130814071-130814093 TCTCATTTGCAAAACATTAATGG - Intergenic
1032661639 7:133990419-133990441 TGTCATTCGAGCAACATGGATGG - Intronic
1032945213 7:136843867-136843889 TGTAATTTTGAAAACATGTAGGG + Intergenic
1032962267 7:137050053-137050075 TGTCATTTGCACCATTTGGAAGG - Intergenic
1033147897 7:138886795-138886817 TGTCATTTGCAAAAGGCTGAGGG - Intronic
1033813721 7:145047766-145047788 TGTCATGTGCAAAACATGGATGG - Intergenic
1035073244 7:156159946-156159968 TGTGATTTGAATAGCATGGAAGG + Intergenic
1036106949 8:5851471-5851493 TGTCTTTTGCACAATTTGGATGG + Intergenic
1037103389 8:15075515-15075537 TTTCATTTGCTAAAAATTGAGGG - Intronic
1038477563 8:27878786-27878808 CCTCATTTGAAAAACAGGGATGG + Intronic
1040535142 8:48302613-48302635 TGATATTTGCAAAACAAGGGAGG - Intergenic
1040762149 8:50861748-50861770 TGTGACTTGGATAACATGGAAGG + Intergenic
1041572043 8:59348747-59348769 TGTCCTTTGCAGAACATGGATGG + Intergenic
1041803675 8:61826559-61826581 TGTCAATGGCAAAACAGTGAGGG + Intergenic
1043084893 8:75817207-75817229 TGTCATTTGACAACCATGCAAGG + Intergenic
1043325044 8:79039759-79039781 TGTCATTTGCAGGACATGATTGG + Intergenic
1043793971 8:84511846-84511868 TTGCATTTGCACAGCATGGATGG - Intronic
1043920365 8:85975779-85975801 TGTCATTTTCAGAACAGGGCAGG - Intergenic
1044489812 8:92800236-92800258 TATAATTGCCAAAACATGGAAGG - Intergenic
1045116139 8:98982473-98982495 ACTCATTTGTAAAACAGGGAGGG - Intergenic
1045961008 8:107968286-107968308 TGTCATTTCCAGTGCATGGATGG + Intronic
1046390781 8:113569543-113569565 TGTCATTTTTAAGACATGGTTGG + Intergenic
1047359072 8:124151409-124151431 TGTTAGTTGGAAAACATGAAAGG + Intergenic
1048109350 8:131450838-131450860 TGTCTTTTGCAGGACATGGATGG - Intergenic
1048145707 8:131840835-131840857 TGTCATTTCTGAAACCTGGATGG + Intergenic
1048838350 8:138543175-138543197 CGTCATTTGAAAAACATGCAAGG + Intergenic
1050804030 9:9651545-9651567 TGTCCTTTGCAGGACATGGATGG - Intronic
1050910393 9:11061511-11061533 TGTCATTTGTAAAAAATGTCAGG - Intergenic
1051506728 9:17835151-17835173 AGACATTTTCAAATCATGGAAGG - Intergenic
1051516048 9:17931444-17931466 TGTCATTTGGAAAAGTTGGGAGG + Intergenic
1051600634 9:18869344-18869366 TGTGAGCTGCAAAGCATGGAAGG - Intronic
1051916549 9:22215782-22215804 TGTCACTTGCAAAACAGAAATGG - Intergenic
1052618782 9:30878104-30878126 TGTCCTTTGCAGAACATGGATGG - Intergenic
1053049232 9:34945062-34945084 TGTCATTTGGAAGACATGGGGGG - Intergenic
1054711538 9:68516051-68516073 TCTTATTTGTAAAACATGGATGG - Intronic
1055943546 9:81672722-81672744 TGTCATTTTGAAAACAAGCAGGG - Intronic
1056054996 9:82812629-82812651 TATCCTTTGCAAAGCATGAATGG + Intergenic
1056485337 9:87051301-87051323 TGTCTTTTGCAGAGCATGGATGG + Intergenic
1056567871 9:87790773-87790795 TGTCATTTGCGTGAAATGGATGG + Intergenic
1056844702 9:90027133-90027155 TGTGATTTGCAGGACATAGAAGG - Intergenic
1057980406 9:99655852-99655874 TGTCATTTGTGCAACATGGATGG + Intergenic
1058406463 9:104681056-104681078 TGTCATTTGCACAACATGGATGG + Intergenic
1058549369 9:106097549-106097571 TGTCCTTTGCAGGACATGGATGG + Intergenic
1059838324 9:118182752-118182774 TCTCATTTGCAAAACAAAAAAGG - Intergenic
1060652059 9:125336696-125336718 TGACATTCTCAAAACATTGATGG + Intronic
1185732181 X:2470084-2470106 TGCCATTTGCGCAACATGGATGG + Intronic
1186051300 X:5598504-5598526 CGTCTTTTGCAGAACATGGATGG - Intergenic
1186927158 X:14346785-14346807 TGTCATTTGTAAAACATGGATGG - Intergenic
1187144291 X:16623563-16623585 TGTCATTTGCACAGCACAGATGG - Intronic
1187640241 X:21279763-21279785 TGTCTTTTGCAGGACATGAATGG - Intergenic
1187724560 X:22189082-22189104 TGTCATTTGCAACACATGGATGG - Intronic
1188229119 X:27639127-27639149 AGTCATTTCAACAACATGGATGG + Intronic
1188258258 X:27988704-27988726 TTTCTTTTCCAAAACATGCATGG + Intergenic
1188287260 X:28342963-28342985 TGTCATTACAACAACATGGATGG - Intergenic
1188288604 X:28360799-28360821 TCTCATATGCATAACATGGAAGG + Intergenic
1188419141 X:29975183-29975205 TGTCATTTGAACAACATGGATGG - Intergenic
1188814440 X:34694248-34694270 TGTCATCTGCAAATCAAAGATGG + Intergenic
1188909176 X:35824296-35824318 TGTCTTTTGTAGAATATGGATGG - Intergenic
1189033430 X:37472214-37472236 TTTCATTTGGAAAACACAGATGG + Intronic
1189500622 X:41553036-41553058 TGTCTTTTGGAAAATATTGATGG - Intronic
1189762318 X:44334271-44334293 TGTTATTTCCAAAGTATGGATGG + Intronic
1190516881 X:51233069-51233091 TGTGGTATGCAAACCATGGATGG - Intergenic
1191026762 X:55922302-55922324 TGTCCTTTGTAGGACATGGATGG + Intergenic
1191040653 X:56075818-56075840 TGTCATTTGCAACAACTGGGTGG - Intergenic
1191689046 X:63921248-63921270 TGTCTTTTGCCACAAATGGAAGG - Intergenic
1193112710 X:77745426-77745448 TGTCATTGCAACAACATGGATGG + Intronic
1193598388 X:83477218-83477240 AGCCATTTGCAGAAGATGGAAGG + Intergenic
1193704398 X:84803497-84803519 TTTCTTTGCCAAAACATGGATGG - Intergenic
1194034210 X:88851577-88851599 TGTCATTTTCAAAACTAGAAAGG + Intergenic
1194166113 X:90519186-90519208 AGTCATTTGTGAAACATGGGTGG + Intergenic
1194172585 X:90605807-90605829 TTTCCTTTGCAGGACATGGAAGG - Intergenic
1194761038 X:97796308-97796330 TATCATTTGCCATAAATGGAAGG - Intergenic
1195150275 X:102060794-102060816 TCACATTTGCTAACCATGGAGGG + Intergenic
1195208823 X:102630766-102630788 GGTCATTTGTAAACCAGGGAAGG + Intergenic
1195304783 X:103570852-103570874 AGTCATTTCCAAAACACAGAAGG - Intergenic
1195555169 X:106213294-106213316 TCTCCTTTGCAAATCATGGTTGG + Intergenic
1195960368 X:110379783-110379805 TGTGATTTGAAATGCATGGATGG + Intronic
1196486568 X:116217303-116217325 TGTCTTTTGCAGAACATGGATGG + Intergenic
1196602011 X:117612456-117612478 TTTCATTTGCACAACACAGATGG + Intergenic
1197683515 X:129412582-129412604 TCACATTTTAAAAACATGGAAGG - Intergenic
1198328661 X:135600492-135600514 TGTCATTGTAGAAACATGGATGG - Intergenic
1198635205 X:138690424-138690446 TGTCATTGGCCAAACATGTGAGG + Intronic
1198998341 X:142602866-142602888 TGTCCTTTGCAGAACATGGATGG - Intergenic
1199669841 X:150135212-150135234 CGTCTTTTGCAAAATTTGGAGGG - Intergenic
1200512383 Y:4096951-4096973 AGTCATTTGTGAAACATGGGTGG + Intergenic
1200518812 Y:4183544-4183566 TTTCCTTTGCAGGACATGGAAGG - Intergenic
1200792323 Y:7310670-7310692 TGCCATTTGAACAACATGGTAGG + Intergenic
1201369286 Y:13243777-13243799 TGTCATTTGGAGAAAATGAATGG + Intergenic