ID: 1014016041

View in Genome Browser
Species Human (GRCh38)
Location 6:116531216-116531238
Sequence CAGGTTAAAGACTCTCTTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1200
Summary {0: 1, 1: 1, 2: 9, 3: 45, 4: 1144}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014016035_1014016041 22 Left 1014016035 6:116531171-116531193 CCTAGCATGAAACTCTACTTAAC 0: 1
1: 0
2: 0
3: 16
4: 127
Right 1014016041 6:116531216-116531238 CAGGTTAAAGACTCTCTTTTTGG 0: 1
1: 1
2: 9
3: 45
4: 1144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014016041 Original CRISPR CAGGTTAAAGACTCTCTTTT TGG Intronic
902661431 1:17906734-17906756 CATCTTATAGCCTCTCTTTTGGG - Intergenic
902908370 1:19576367-19576389 CAGGATAAACAGTCCCTTTTAGG + Intergenic
904970936 1:34418935-34418957 CAGGTTAAGGACCCTATTGTAGG + Intergenic
906856098 1:49306631-49306653 CAGGTTAACAACTCTATTTGTGG + Intronic
906988261 1:50710506-50710528 CATGTAAAAGACCCTATTTTAGG + Intronic
907372393 1:54011831-54011853 TAGGTTAAAGTGTCTCCTTTGGG - Intronic
908216454 1:61958953-61958975 CAGGCTAAAGGCTCACATTTAGG - Intronic
908893463 1:68871962-68871984 CAGTTTCAAGACTCAATTTTTGG + Intergenic
908945829 1:69495467-69495489 GAGGTAAAGGACTCTCTTCTGGG - Intergenic
911372707 1:97013423-97013445 CAGGTTGAAGATTTTCTTCTTGG + Intergenic
911928656 1:103871174-103871196 TAGGTTAAAAACACTCATTTAGG + Intergenic
913750167 1:121954926-121954948 CACGTTTGAGACACTCTTTTTGG - Intergenic
913935186 1:125033407-125033429 CAGTTTAAAAACACTCTTTTTGG + Intergenic
918435875 1:184512313-184512335 GAGGCTAAAAACTATCTTTTTGG + Intronic
921966362 1:221094762-221094784 CACCTTGAAGAGTCTCTTTTGGG + Intergenic
924310524 1:242737906-242737928 CATGTGAAAGACTTTCTTCTGGG - Intergenic
1062991072 10:1818766-1818788 CATGCTCAAGACTCTCTTTAGGG + Intergenic
1064163400 10:12965197-12965219 AAGGTTATATACCCTCTTTTTGG - Intronic
1066762652 10:38770487-38770509 CAGGTAAAAGACTTTCTCTAGGG - Intergenic
1066785606 10:39000735-39000757 CAGGTTGGAAACACTCTTTTAGG - Intergenic
1066785669 10:39001396-39001418 CAGGTTGGAAACACTCTTTTTGG - Intergenic
1066785743 10:39002264-39002286 CAGGTTGAAAACACTCTTTTTGG - Intergenic
1066786814 10:39013606-39013628 CAGGTTGGAAACACTCTTTTTGG - Intergenic
1066786915 10:39014595-39014617 CAGGTTGGAAACACTCTTTTTGG - Intergenic
1066786998 10:39015623-39015645 CAGGTTAAAAACACTCTTTTTGG - Intergenic
1066787344 10:39019735-39019757 CAGCTTAGAAACACTCTTTTTGG - Intergenic
1066787572 10:39022472-39022494 CAGGTTGGAAACACTCTTTTGGG - Intergenic
1066790396 10:39055999-39056021 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1066790451 10:39056685-39056707 CAGGTTAGAAAAACTCTTTTTGG + Intergenic
1066790490 10:39057202-39057224 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1066790746 10:39060396-39060418 CAGGTTTTAAACTCTCTTTTTGG + Intergenic
1066790804 10:39061076-39061098 CAGGTTGCAAACACTCTTTTAGG - Intergenic
1066790857 10:39061760-39061782 CAGGTTCGAAACACTCTTTTTGG - Intergenic
1066791024 10:39063790-39063812 CAGGTTGGAAACACTCTTTTTGG - Intergenic
1066791354 10:39067747-39067769 CAGGTTCAAAACACTTTTTTTGG + Intergenic
1066791580 10:39070520-39070542 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1066791629 10:39071036-39071058 CAGGTTGGAAACCCTCTTTTTGG + Intergenic
1066792191 10:39077928-39077950 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1066792350 10:39079813-39079835 CAAGTTGAAAACTCTCTTTTTGG + Intergenic
1066792923 10:39085830-39085852 CAGGTTGTAAACGCTCTTTTTGG + Intergenic
1066792979 10:39086511-39086533 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1066793087 10:39087951-39087973 CAGGTTGGAAACCCTCTTTTTGG + Intergenic
1066793170 10:39088811-39088833 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1066793328 10:39090538-39090560 CAGGTTGTAAACACTCTTTTTGG + Intergenic
1066793571 10:39093513-39093535 CATGTTAAAAACGCTCTTTTTGG + Intergenic
1066793612 10:39094033-39094055 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1066793658 10:39094534-39094556 CAGGTTGGAGACTTTCTTTTTGG + Intergenic
1066793708 10:39095221-39095243 CAGGTTAAAAACACTCTTTTTGG + Intergenic
1066793783 10:39096075-39096097 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1066793980 10:39098302-39098324 CAGGTTGGTGACACTCTTTTTGG + Intergenic
1066793997 10:39098473-39098495 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1066794161 10:39100353-39100375 CAGGTTGTAAACACTCTTTTTGG + Intergenic
1066794321 10:39102229-39102251 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1066794439 10:39103643-39103665 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1066794456 10:39103816-39103838 CAGGTTGGAGAGACTCTTTTTGG + Intergenic
1066795656 10:39117452-39117474 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1066795935 10:39120590-39120612 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1066796681 10:39129817-39129839 CAGGTTGAAAACACTCTTTTTGG + Intergenic
1066796938 10:39132616-39132638 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1066927919 10:41720853-41720875 CAGGTTGAAAACACTCTTTTTGG + Intergenic
1066928225 10:41724283-41724305 GAGGTTGAAAACACTCTTTTTGG + Intergenic
1066928388 10:41726346-41726368 CAGGTTGGAAACTTTCTTTTTGG + Intergenic
1066928402 10:41726518-41726540 CAGGTTGAAAACTCTCTTTTTGG + Intergenic
1066928770 10:41730658-41730680 GAGGTTGAAAACACTCTTTTTGG + Intergenic
1066928885 10:41731874-41731896 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1066929091 10:41734442-41734464 CAGGTTGAAAACACTCTTATTGG + Intergenic
1066929173 10:41735293-41735315 CAGGTTAAAAAGACACTTTTTGG + Intergenic
1066929263 10:41736319-41736341 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1066929365 10:41737515-41737537 CAGGTTAAAAAGTCACGTTTTGG + Intergenic
1066929583 10:41740265-41740287 CAGGTTGTAAACACTCTTTTTGG + Intergenic
1066929599 10:41740438-41740460 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1067734138 10:48836282-48836304 AAGGTTAAAGACTCCGTTATTGG + Intronic
1073388286 10:103147576-103147598 AAGGTTTAAGCCTCTCATTTGGG - Intronic
1073983432 10:109181027-109181049 AATGTTAAAGACTTTTTTTTAGG + Intergenic
1074000265 10:109365056-109365078 CATGGTAAAAACTCTCTGTTGGG - Intergenic
1075321712 10:121496516-121496538 AATGTGAAAGACTCACTTTTTGG + Exonic
1078132762 11:8626312-8626334 CAGGTTCAAGACACTGATTTTGG - Intronic
1078162252 11:8851560-8851582 CAGGTTAAAGACTTTCTGGAGGG + Intronic
1078302822 11:10150628-10150650 CAGCTTAAAAACTAGCTTTTGGG - Intronic
1081147060 11:39575262-39575284 CAAGGTAGAGACTCTCTTTAGGG + Intergenic
1082597566 11:55103361-55103383 CAGCTTGGAGACACTCTTTTTGG + Intergenic
1086655995 11:89356168-89356190 CAGAATAATGACTATCTTTTAGG + Intronic
1087965717 11:104411819-104411841 CAGTTCAAAAATTCTCTTTTGGG - Intergenic
1088182823 11:107131354-107131376 CTGATTAAAGACTCTCAGTTTGG - Intergenic
1089441766 11:118523482-118523504 CAGGTTCAGGACTCTGTCTTGGG - Exonic
1092987604 12:13861608-13861630 CAGGTTAGAGATTTTCTTTAAGG + Intronic
1094885162 12:34859671-34859693 GAGGTTAAAGACCCTTTTTGTGG + Intergenic
1094909321 12:35250972-35250994 GAGGTTAAAGACCCTTTTTGTGG + Intergenic
1095079714 12:37984882-37984904 CAGGTTAGAAACACTCTTTTTGG + Intergenic
1095079778 12:37985577-37985599 CAGGTTGGAAACCCTCTTTTTGG + Intergenic
1095080010 12:37988526-37988548 CAGGTTGAAAACACTCTATTTGG + Intergenic
1095082517 12:38022450-38022472 CAGTTTGAAAACACTCTTTTTGG + Intergenic
1097380183 12:58885785-58885807 CATCTTAGAGATTCTCTTTTAGG + Intronic
1098295636 12:69001329-69001351 CAGGTACAGGACTCTCTCTTAGG + Intergenic
1104172316 12:126293794-126293816 CAGGTTACACTTTCTCTTTTGGG - Intergenic
1105076129 13:16025941-16025963 CAGTTTTAAAACACTCTTTTTGG + Intergenic
1105076331 13:16029865-16029887 CAGTTTTAAAACACTCTTTTTGG + Intergenic
1105076522 13:16033781-16033803 CAGTTTTAAAACACTCTTTTTGG + Intergenic
1105076724 13:16037700-16037722 CAGTTTTAAAACACTCTTTTTGG + Intergenic
1105077554 13:16053362-16053384 CAGTTTTAAAACACTCTTTTTGG + Intergenic
1105077750 13:16057277-16057299 CAGTTTTAAAACACTCTTTTTGG + Intergenic
1105077944 13:16061018-16061040 CAGTTTTAAAACACTCTTTTTGG + Intergenic
1105078350 13:16068848-16068870 CAGTTTTAAAACACTCTTTTTGG + Intergenic
1105078748 13:16076509-16076531 CAGTTTTAAAACACTCTTTTTGG + Intergenic
1105078938 13:16080251-16080273 CAGTTTTAAAACACTCTTTTTGG + Intergenic
1105079142 13:16084171-16084193 CAGTTTTAAAACACTCTTTTTGG + Intergenic
1105079543 13:16091660-16091682 CAGTTTTAAAACACTCTTTTTGG + Intergenic
1105079744 13:16095576-16095598 CAGTTTTAAAACACTCTTTTTGG + Intergenic
1105079939 13:16099319-16099341 CAGTTTTAAAACACTCTTTTTGG + Intergenic
1105080151 13:16103234-16103256 CAGTTTTAAAACACTCTTTTTGG + Intergenic
1105080362 13:16107153-16107175 CAGTTTTAAAACACTCTTTTTGG + Intergenic
1105114696 13:16676910-16676932 CAGGTTTGAAACGCTCTTTTTGG + Intergenic
1105357552 13:19672788-19672810 CACATTTAATACTCTCTTTTAGG - Exonic
1105622113 13:22078262-22078284 CAGGTTAATGACTCACTTAAGGG - Intergenic
1109198447 13:59405227-59405249 CAGGTCAAAATCTCTCTGTTTGG + Intergenic
1109690099 13:65876163-65876185 CAGGTTAAAAACTATTTTTATGG + Intergenic
1110025971 13:70539608-70539630 CACGTTAAAGACTTTATGTTTGG - Intergenic
1111188755 13:84780389-84780411 CTTGTTAAAGACTCTCAGTTTGG + Intergenic
1111349737 13:87011917-87011939 CAGATCAAATACTCTTTTTTGGG - Intergenic
1111834750 13:93374439-93374461 CAGGGTAAAGACTCTGTTGCAGG - Intronic
1114001727 14:18259443-18259465 CAGGTTTGAAACACTCTTTTTGG - Intergenic
1119362908 14:74066819-74066841 CAGATTACAGACTCGCTCTTTGG + Exonic
1119758135 14:77133089-77133111 CAGGTTCAAGACCCTTTTTCTGG - Exonic
1119798689 14:77423183-77423205 CAGGTTACAGGCACTGTTTTCGG + Intronic
1120980193 14:90282551-90282573 CAGGTTAAAACCTCATTTTTAGG - Intronic
1123226474 15:17039568-17039590 CAGTTTTAAAACACTCTTTTTGG + Intergenic
1126155069 15:45558291-45558313 CTGGTTGAAGACTCACATTTTGG + Intergenic
1126549521 15:49911266-49911288 CAGGTTAAGGAGTTTCTTGTAGG - Intronic
1126862146 15:52895688-52895710 CATGTTCAAGACTTTTTTTTAGG - Intergenic
1128828109 15:70740311-70740333 CAATTTAAAAACTTTCTTTTGGG + Intronic
1134596869 16:15502708-15502730 GGGATTCAAGACTCTCTTTTGGG + Intronic
1136714591 16:32268082-32268104 CAGGTTTAAGTTTTTCTTTTAGG + Intergenic
1136742639 16:32552042-32552064 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1136742716 16:32552903-32552925 CAAGTTAGAAACACTCTTTTTGG + Intergenic
1136743259 16:32559134-32559156 CAGGTTGAAAACACTCTTCTTGG + Intergenic
1136744185 16:32569243-32569265 AAGGTTGAAAACACTCTTTTTGG + Intergenic
1136744302 16:32570595-32570617 CAGGTTATAAACACTCGTTTTGG + Intergenic
1136744407 16:32571964-32571986 CAGGTTGAAAACCCTCCTTTTGG + Intergenic
1136744605 16:32574450-32574472 TAGGTTAAAAACCCTATTTTTGG + Intergenic
1136744741 16:32575978-32576000 CAGGTTTCAAACACTCTTTTTGG + Intergenic
1136745127 16:32580138-32580160 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1137072726 16:35919785-35919807 CAGGTTGGAAACACTCTTTTTGG - Intergenic
1137079676 16:36031048-36031070 CAGTTTAGAAACACTCTTTTTGG + Intergenic
1137260033 16:46819040-46819062 GAGTTTAAATACCCTCTTTTTGG - Intronic
1138876629 16:60959353-60959375 CTGGTACAAAACTCTCTTTTGGG + Intergenic
1140076861 16:71708040-71708062 CAGGTCAAAGCCTTTCTTTAAGG + Intronic
1203024856 16_KI270728v1_random:499250-499272 CAGGTTGCAAACACTCTTTTTGG - Intergenic
1203024948 16_KI270728v1_random:500291-500313 CAGGTTGGAAACACTCTTTTTGG - Intergenic
1203024992 16_KI270728v1_random:500780-500802 TAGGTTAAAAACCCTATTTTTGG - Intergenic
1203025190 16_KI270728v1_random:503268-503290 CAGGTTGAAAACCCTCCTTTTGG - Intergenic
1203025257 16_KI270728v1_random:504128-504150 CAGGTTGGAAACGCTCTTTTTGG - Intergenic
1203025297 16_KI270728v1_random:504637-504659 CAGGTTATAAACACTCGTTTTGG - Intergenic
1203025414 16_KI270728v1_random:505989-506011 AAGGTTGAAAACACTCTTTTTGG - Intergenic
1203026340 16_KI270728v1_random:516095-516117 CAGGTTGAAAACACTCTTCTTGG - Intergenic
1203026883 16_KI270728v1_random:522326-522348 CAAGTTAGAAACACTCTTTTTGG - Intergenic
1203026959 16_KI270728v1_random:523186-523208 CAGGTTGGAAACACTCTTTTTGG - Intergenic
1203044762 16_KI270728v1_random:811245-811267 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1203044838 16_KI270728v1_random:812105-812127 CAAGTTAGAAACACTCTTTTTGG + Intergenic
1203045381 16_KI270728v1_random:818336-818358 CAGGTTGAAAACACTCTTCTTGG + Intergenic
1203046307 16_KI270728v1_random:828442-828464 AAGGTTGAAAACACTCTTTTTGG + Intergenic
1203046424 16_KI270728v1_random:829794-829816 CAGGTTATAAACACTCGTTTTGG + Intergenic
1203046464 16_KI270728v1_random:830303-830325 CAGGTTGGAAACGCTCTTTTTGG + Intergenic
1203046531 16_KI270728v1_random:831163-831185 CAGGTTGAAAACCCTCCTTTTGG + Intergenic
1203046729 16_KI270728v1_random:833651-833673 TAGGTTAAAAACCCTATTTTTGG + Intergenic
1203046773 16_KI270728v1_random:834140-834162 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1203046865 16_KI270728v1_random:835181-835203 CAGGTTGCAAACACTCTTTTTGG + Intergenic
1203047253 16_KI270728v1_random:839346-839368 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1203055460 16_KI270728v1_random:921687-921709 CAGGTTTAAGTTTTTCTTTTAGG - Intergenic
1142842540 17:2644855-2644877 CAAATTAAAAGCTCTCTTTTGGG - Intronic
1145102815 17:20090813-20090835 CAGATTATAGCCTCTCTCTTGGG + Intronic
1145364844 17:22251369-22251391 CAGGTTAAAAACACTCTTTTTGG - Intergenic
1145486011 17:23756151-23756173 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1145508940 17:24090185-24090207 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1145660116 17:26288313-26288335 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1145677848 17:26546499-26546521 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1146565195 17:33906982-33907004 CAGCTGAAAGATGCTCTTTTGGG + Intronic
1147301765 17:39534923-39534945 CTGGTTTAAGACTATCCTTTGGG - Exonic
1147645459 17:42031032-42031054 CAGGTTGTAGTCTCTTTTTTTGG + Intronic
1150100750 17:62421508-62421530 AAGGTTAAAAACTCTCATTCTGG - Intergenic
1151236298 17:72722136-72722158 CATGCTAATGATTCTCTTTTGGG + Intronic
1153492365 18:5662868-5662890 CAGTTGAAAGAGTCTCTTTTTGG - Intergenic
1156985140 18:43341974-43341996 AAAGTTAAAGACTCCCTATTTGG + Intergenic
1158345188 18:56508965-56508987 CAGGTTGAAGATACTCTCTTTGG - Intergenic
1164342248 19:24415797-24415819 CAGTTTTGAAACTCTCTTTTTGG + Intergenic
1164362243 19:27526648-27526670 CAGGTTGGAAACCCTCTTTTTGG + Intergenic
1164363440 19:27545135-27545157 CAGGTTGGAAACCCTCTTTTTGG + Intergenic
1166635640 19:44449381-44449403 CAGGCTAAGGAATGTCTTTTTGG - Intergenic
927024497 2:19051479-19051501 CAAGTTAAAGACACTCCTCTGGG + Intergenic
927414182 2:22859457-22859479 CATGTTCAAGGCACTCTTTTAGG - Intergenic
930516462 2:52413796-52413818 CATGATACAGACTCTCTTTAAGG - Intergenic
930735171 2:54771008-54771030 AAGGTCAAAGGCTCTGTTTTGGG + Intronic
931576134 2:63720949-63720971 CAGGTTAATGACTATCTGTCAGG - Intronic
933411517 2:81931152-81931174 CAGGATAATGACTTTCTTTGGGG - Intergenic
934334181 2:92108780-92108802 CAGTTTTAAAACACTCTTTTTGG + Intergenic
934359116 2:92552900-92552922 CAGGTTTGAAACACTCTTTTTGG + Intergenic
934384639 2:92962088-92962110 CAGTTTTAAAACACTCTTTTTGG + Intergenic
934418312 2:93505140-93505162 CAGGTTTGAAACACTCTTTTTGG + Intergenic
934424320 2:93601358-93601380 CAGTTTTAAAACACTCTTTTTGG + Intergenic
934457077 2:94178711-94178733 CAGGTTTGAAACACTCTTTTTGG + Intergenic
934470795 2:94531967-94531989 CAGGTTTGAAACACTCTTTTTGG - Intergenic
936644420 2:114352033-114352055 GAGGATAAAGATTCTATTTTTGG - Intergenic
946081700 2:217125745-217125767 CAGGCTCTAGTCTCTCTTTTTGG - Intergenic
948499066 2:238378411-238378433 AAGGTTAACAACTGTCTTTTTGG + Intronic
1170022729 20:11854062-11854084 CAGGTTAAAAACTCTCTGTGAGG + Intergenic
1171008456 20:21491563-21491585 GAGGATAAAGAGTCTCTATTTGG - Intergenic
1171620956 20:27051350-27051372 CAGTTTTAAAACACTCTTTTTGG + Intergenic
1171672919 20:27830058-27830080 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1171681107 20:27953017-27953039 CAGTTTTAAAACTGTCTTTTTGG + Intergenic
1171692006 20:28116166-28116188 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1171712608 20:28426329-28426351 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1172159584 20:32857180-32857202 AAAGTAAAAGGCTCTCTTTTTGG + Intergenic
1172414593 20:34754413-34754435 CAGGTTATATAGTCTCTTGTTGG - Intronic
1173023586 20:39287708-39287730 CAGGGTACAGCCTCTCTTCTGGG - Intergenic
1175248375 20:57594767-57594789 CAGGTTGCAGACTCTCTGTGGGG - Intergenic
1176481537 21:7299542-7299564 CAGTTTCAAAACGCTCTTTTTGG + Intergenic
1176531877 21:7973266-7973288 CAGTTTTAAAACACTCTTTTTGG - Intergenic
1176532078 21:7977178-7977200 CAGTTTTAAAACACTCTTTTTGG - Intergenic
1176532917 21:7993341-7993363 CAGTTTTAAAACACTCTTTTTGG - Intergenic
1176533136 21:7997589-7997611 CAGATTTAAAACACTCTTTTTGG - Intergenic
1176533337 21:8001504-8001526 CAGATTTAAAACACTCTTTTTGG - Intergenic
1176533544 21:8005419-8005441 CAGTTTTAAAACACTCTTTTTGG - Intergenic
1176533958 21:8013244-8013266 CAGTTTTAAAACACTCTTTTTGG - Intergenic
1176534157 21:8017158-8017180 CAGTTTTAAAACACTCTTTTTGG - Intergenic
1176534471 21:8023453-8023475 CAGTTTTAAAACACTCTTTTTGG - Intergenic
1176534642 21:8026694-8026716 CAGTTTTAAAACACTCTTTTTGG - Intergenic
1176534816 21:8029933-8029955 CAGTTTTAAAACACTCTTTTTGG - Intergenic
1176535018 21:8033846-8033868 CAGTTTTAAAACACTCTTTTTGG - Intergenic
1176535218 21:8037759-8037781 CAGTTTTAAAACACTCTTTTTGG - Intergenic
1176535408 21:8041500-8041522 CAGTTTTAAAACACTCTTTTTGG - Intergenic
1176535578 21:8044741-8044763 CAGTTTTAAAACACTCTTTTTGG - Intergenic
1180400307 22:12412821-12412843 CAGTTTTAAAACACTCTTTTTGG + Intergenic
1180426234 22:15190238-15190260 CAGGTTTGAAACACTCTTTTTGG - Intergenic
1180504294 22:15978824-15978846 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1180508222 22:16041265-16041287 CAGGTTAGAAACACTCTTTTTGG - Intergenic
1180509226 22:16060191-16060213 CAGTTTAGAAACACTCTTTTTGG - Intergenic
1182569180 22:31223431-31223453 CAGGTTACAGACTTAATTTTGGG + Intronic
1182822472 22:33229540-33229562 CAGTTTACTGAGTCTCTTTTCGG - Intronic
1185290021 22:50019193-50019215 GAGGTTACAGACTCTGTTTCTGG - Intronic
1203334283 22_KI270739v1_random:43688-43710 CAGGTTTGAAACACTCTTTTTGG - Intergenic
1202716017 2_KI270715v1_random:3135-3157 CAGTTTTAAAACACTCTTTTTGG + Intergenic
1202716724 2_KI270715v1_random:13355-13377 CAGTTTTAAAACACTCTTTTTGG + Intergenic
1202728710 2_KI270716v1_random:37094-37116 CAGTTTTAAAACACTCTTTTTGG + Intergenic
1202729039 2_KI270716v1_random:41863-41885 CAGTTTTAAAACACTCTTTTTGG + Intergenic
951577398 3:24127654-24127676 AAGGTTAAAGTCTCACTTTCTGG + Exonic
951699813 3:25484739-25484761 CAGCTTAAAGAGTTTCTATTTGG + Intronic
954650596 3:52159580-52159602 AAGGTGTAAGACTCCCTTTTGGG + Intergenic
955639274 3:61064840-61064862 GTGGGTAAAGACTCTCCTTTGGG - Intronic
956467579 3:69534638-69534660 CATGTCACAGACTCTCTTTGGGG + Intronic
958209173 3:90446778-90446800 CAGTTTCAAAACACTCTTTTGGG - Intergenic
958209261 3:90448141-90448163 CAGTTTTGAAACTCTCTTTTTGG - Intergenic
958221507 3:90689446-90689468 CAGTTTTGAAACTCTCTTTTTGG - Intergenic
958286118 3:91748106-91748128 CAGATTTGAAACTCTCTTTTTGG + Intergenic
958404667 3:93739535-93739557 CAGGTTTTAAACACTCTTTTTGG - Intergenic
959080595 3:101796725-101796747 CACTTTAAAGAATCTCATTTAGG - Intronic
960121181 3:113949565-113949587 GATGTTAAAAATTCTCTTTTTGG - Intronic
960650505 3:119943117-119943139 CATTTTAAAGACTTTCTTTAGGG - Intronic
962411997 3:135149303-135149325 CATCTGAAAGAGTCTCTTTTTGG - Intronic
969382810 4:6817002-6817024 GAGGTTAAAGAACCTGTTTTTGG + Intronic
969858185 4:10016592-10016614 CACGTTAAACTCTCTCTGTTTGG + Intronic
970140871 4:12980698-12980720 CTGCTTAAAGATTATCTTTTTGG - Intergenic
970825819 4:20272920-20272942 AAGGCCAAAGACTCTCTTTATGG + Intronic
971157953 4:24103328-24103350 CAGATTAAAGACTCACTTCAGGG + Intergenic
971410312 4:26364060-26364082 CAGATTCAGAACTCTCTTTTAGG + Intronic
971680078 4:29687435-29687457 CAGGTTATAAACTTTGTTTTGGG - Intergenic
971692849 4:29859682-29859704 AAGTTTTCAGACTCTCTTTTGGG + Intergenic
973495402 4:51213874-51213896 CAGTTTTAAAACACTCTTTTTGG + Intergenic
976978446 4:91193135-91193157 GAGGTAAAAGGCTCTGTTTTAGG - Intronic
977403173 4:96561211-96561233 CAGATTAAAGAATTTGTTTTGGG - Intergenic
977639928 4:99345887-99345909 CAAGTTAGACACTTTCTTTTAGG + Intronic
977799406 4:101207986-101208008 CAGATTAAACACACTCATTTAGG + Intronic
979438841 4:120727012-120727034 CATGTTAAAGACTATATTCTAGG + Intronic
980462554 4:133135303-133135325 CCGATCAAAGAGTCTCTTTTGGG - Intergenic
980747433 4:137036766-137036788 CATTTTAAAGACTTTCTTTTAGG - Intergenic
982196954 4:152926024-152926046 GAGGTGCCAGACTCTCTTTTGGG - Intergenic
982844144 4:160228616-160228638 AAGATTAACAACTCTCTTTTTGG + Intergenic
983057281 4:163112907-163112929 CAGCTTTAAGGCTCCCTTTTAGG + Intronic
983384689 4:167045103-167045125 CAAGTTAAAGACTATCTTTTTGG + Intronic
984031345 4:174607599-174607621 AAGGTGCCAGACTCTCTTTTGGG + Intergenic
984481891 4:180314937-180314959 AATGTGAAAAACTCTCTTTTGGG - Intergenic
986975750 5:13391614-13391636 GAGGATAAATATTCTCTTTTGGG - Intergenic
989209042 5:38841985-38842007 CATCTTAAAGATTCACTTTTAGG - Intergenic
992176213 5:74151278-74151300 CAGGTTAAAGGCTGTCTCTGGGG - Intergenic
993864820 5:93180155-93180177 GAGGTCATAGAGTCTCTTTTTGG + Intergenic
994106063 5:95950602-95950624 AAGCTTAATGACTTTCTTTTTGG - Intronic
995279854 5:110321895-110321917 CAACTTAAAGAGTCTATTTTAGG - Intronic
999090065 5:148928143-148928165 CAGGTTCAAGAAAGTCTTTTAGG + Intronic
999709584 5:154305334-154305356 CAGGTTAAAGTCCATCATTTTGG - Intronic
1005814781 6:29541699-29541721 CAGGTAAAAGGCTTTCTTATGGG - Intergenic
1006100542 6:31683529-31683551 TAGGTTAAAGACCCTCTCTCTGG - Intronic
1007759055 6:44121617-44121639 CAGCTTAGTGACTCTCTGTTAGG + Intronic
1008116249 6:47553664-47553686 CAGGTTAAAAACAATTTTTTAGG - Intronic
1008346997 6:50439875-50439897 CAGTTTCTAGACTCTCTTTCAGG - Intergenic
1009011068 6:57842984-57843006 CAGGGAAAAGACTCACCTTTTGG - Intergenic
1009809473 6:68641739-68641761 CCAGTTAAATAATCTCTTTTTGG + Intronic
1009913371 6:69961553-69961575 CAAGTTAAAGTCTATATTTTAGG + Intronic
1012580094 6:100857290-100857312 CTGGATAAAAGCTCTCTTTTTGG + Intronic
1014016041 6:116531216-116531238 CAGGTTAAAGACTCTCTTTTTGG + Intronic
1014578239 6:123100861-123100883 TAAGATAAAGAGTCTCTTTTTGG + Intergenic
1014587443 6:123217088-123217110 CAGATTAATGACTCTCTTTATGG - Intronic
1014979010 6:127924216-127924238 TAGGTGAAAGACACACTTTTGGG + Intergenic
1015505049 6:133976370-133976392 GAGGTGAAAGACTCTTTTATAGG - Intronic
1016387667 6:143544172-143544194 CAGGTCAAAGAATTTCTTTACGG - Intronic
1016487539 6:144558674-144558696 CAGGTTAGAGAATTTCTTTATGG + Intronic
1018448097 6:163876704-163876726 CAGCTTAGACACTGTCTTTTTGG - Intergenic
1019861293 7:3660306-3660328 CAGGTGAAAAGCTCTCTTCTTGG - Intronic
1020486092 7:8722540-8722562 TAGGTTAATGCCTCTTTTTTAGG + Intronic
1024455628 7:49603898-49603920 CTGGTGAAAGACACTCTTGTAGG - Intergenic
1025312682 7:57968894-57968916 CAGTTTTGAAACTCTCTTTTTGG - Intergenic
1025312867 7:57972481-57972503 CAGTTTCAAAACTCTCTTTTTGG - Intergenic
1025514776 7:61621501-61621523 CAGTTTGGAGTCTCTCTTTTTGG + Intergenic
1025533071 7:61914622-61914644 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1025534515 7:61931338-61931360 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1025534534 7:61931511-61931533 CAGGTTGGAAGCTCTCTTTTTGG + Intergenic
1025534764 7:61934029-61934051 CAGGTTTGACACACTCTTTTTGG + Intergenic
1025535528 7:61943494-61943516 CAGGTTAAAAACTCTCTTTTTGG + Intergenic
1025535570 7:61944010-61944032 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1025535699 7:61945535-61945557 CAGGTTGGACACACTCTTTTTGG + Intergenic
1025536009 7:61948766-61948788 CAGGTTTTAAACACTCTTTTTGG + Intergenic
1025536307 7:61952548-61952570 CAGGTTGGAAACACTCTTTTTGG - Intergenic
1025536728 7:61957491-61957513 CAGGTTGGAGACACTCTTTTTGG + Intergenic
1025539121 7:62050341-62050363 CAGTTTGGAGTCTCTCTTTTTGG + Intergenic
1026042368 7:66878697-66878719 CAGTTTAAAGACTCTGATATAGG - Intergenic
1027715556 7:81664760-81664782 AAGGTTAGATACTCTCTTATAGG - Intergenic
1028714278 7:93946769-93946791 CAGGTTAAAAAGTCTCCTTAAGG - Intergenic
1028817596 7:95165178-95165200 CTGGTTATTGACTTTCTTTTGGG + Intronic
1031245544 7:119306941-119306963 CAGGTTAAAAAGTCTCAATTAGG + Intergenic
1031283696 7:119838767-119838789 CCGTTTGATGACTCTCTTTTTGG - Intergenic
1031307642 7:120151945-120151967 AAGGTTTAAGACTCTAATTTGGG - Intergenic
1032029897 7:128474357-128474379 AAGGTTAAAAACTCTCATTCTGG - Intergenic
1032223739 7:130013661-130013683 CAGGAGAAAGACTCTCTTCTGGG + Intergenic
1032664955 7:134026989-134027011 CAGGTTAAAAAAAATCTTTTTGG - Intronic
1032949442 7:136890574-136890596 CAGGATAAAGGCAGTCTTTTGGG - Intronic
1032989020 7:137370332-137370354 CAGATGAAATACTCTGTTTTAGG + Intergenic
1033569522 7:142614231-142614253 CAGAATAAAGACTATATTTTTGG + Intergenic
1034982089 7:155485532-155485554 CAGGTAAAAGGATTTCTTTTTGG + Intronic
1038297841 8:26312448-26312470 CAGCTTATAGCCTCTCTTTAAGG + Intronic
1039046104 8:33450873-33450895 CAAGTTAAAGACTGTTTTGTAGG + Intronic
1039837379 8:41267554-41267576 CAGGTTAAAGACTTTCCTCAGGG - Intronic
1040113159 8:43582922-43582944 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040124938 8:43726521-43726543 CAGGTTGAAAACTTTCTTTTTGG + Intergenic
1040125428 8:43732274-43732296 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040125556 8:43733644-43733666 CAGGTTGGAAACACTCTTTTGGG + Intergenic
1040125594 8:43734044-43734066 CAGGTTGGAAATTCTCTTTTTGG + Intergenic
1040125777 8:43735927-43735949 CAGGTTTGAAACTCTTTTTTTGG + Intergenic
1040125804 8:43736270-43736292 TAGGTTGGAAACTCTCTTTTTGG + Intergenic
1040125861 8:43736966-43736988 CAGGTTAGAAACTCTGATTTTGG + Intergenic
1040126707 8:43745955-43745977 CAGGTTGGAGACACTCCTTTTGG + Intergenic
1040127241 8:43751826-43751848 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040127272 8:43752170-43752192 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040127345 8:43753022-43753044 CAGGTTGGATACACTCTTTTTGG + Intergenic
1040127889 8:43759252-43759274 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040128205 8:43763262-43763284 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040128251 8:43763777-43763799 CAGGTTGTAAACACTCTTTTTGG + Intergenic
1040128331 8:43764633-43764655 CAGGTTGGAAACTATCTTTTTGG + Intergenic
1040128550 8:43767027-43767049 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040128892 8:43771324-43771346 CAGGTTGGAAACTATCTTTTTGG + Intergenic
1040128987 8:43772347-43772369 CAGGTTGGAGACACTCTTTTTGG + Intergenic
1040129408 8:43777067-43777089 CAGGTTGGAAACGCTCTTTTTGG + Intergenic
1040129580 8:43779261-43779283 CAGGTTGCAAACACTCTTTTTGG + Intergenic
1040129932 8:43783600-43783622 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040130171 8:43786353-43786375 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040130210 8:43786711-43786733 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040130336 8:43788434-43788456 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040130474 8:43790033-43790055 CTGGTTAAAGACACTGTTTTTGG + Intergenic
1040130562 8:43791055-43791077 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040130947 8:43795888-43795910 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040131422 8:43801406-43801428 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040131698 8:43804475-43804497 CAGGTAGGAAACTCTCTTTTTGG + Intergenic
1040132030 8:43808484-43808506 CATGTTAGAAACACTCTTTTTGG + Intergenic
1040132750 8:43816323-43816345 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040132785 8:43816670-43816692 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040132902 8:43818234-43818256 CAGGTTAGAATCACTCTTTTTGG + Intergenic
1040133026 8:43819743-43819765 CAGGTTAAAAACACTCTTTTTGG + Intergenic
1040133081 8:43820435-43820457 CAGCTTATAAACACTCTTTTTGG + Intergenic
1040133149 8:43821307-43821329 CAGGTTTCAAACACTCTTTTTGG + Intergenic
1040133475 8:43825328-43825350 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040133674 8:43827498-43827520 CAGGTTGAAAGCACTCTTTTTGG + Intergenic
1040134045 8:43831809-43831831 CACGTTAGAAACACTCTTTTTGG + Intergenic
1040134125 8:43832837-43832859 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040134421 8:43836104-43836126 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040134754 8:43840014-43840036 CAGGTTGGAAACCCTCTTTTTGG + Intergenic
1040134883 8:43841558-43841580 CAGGTTGTATACACTCTTTTTGG + Intergenic
1040134953 8:43842398-43842420 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040135298 8:43846378-43846400 CAGGTTGAAAATACTCTTTTTGG + Intergenic
1040135584 8:43849788-43849810 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040135956 8:43854056-43854078 CAGGTTAAAAACACTCTTTTTGG + Intergenic
1040135969 8:43854228-43854250 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040136010 8:43854741-43854763 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040136026 8:43854909-43854931 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040136081 8:43855593-43855615 CAGGTTGGAAACCCTCTTTTTGG + Intergenic
1040136184 8:43856790-43856812 CAGGTTACAAACACTCTTTTTGG + Intergenic
1040136368 8:43858840-43858862 CAGTTTGGAAACTCTCTTTTTGG + Intergenic
1040136592 8:43861530-43861552 CAGGTTGGAAACTCTCTTTTTGG + Intergenic
1040136657 8:43862214-43862236 CAGGTTGCAGACACTCTCTTTGG + Intergenic
1040136686 8:43862556-43862578 CAGGTTGGAGACACTCTTTATGG + Intergenic
1040136763 8:43863419-43863441 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040136819 8:43864105-43864127 CAGGTTAGAAATACTCTTTTTGG + Intergenic
1040137550 8:43872527-43872549 CAGGTTGGAAACGCTCTTTTTGG + Intergenic
1040137649 8:43873896-43873918 CAGGTTGTAAAATCTCTTTTTGG + Intergenic
1040137737 8:43874915-43874937 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040137752 8:43875087-43875109 CAGGTTGAAAACACTCTTTTTGG + Intergenic
1040137858 8:43876271-43876293 GAGGTTGAAGACACTCCTTTTGG - Intergenic
1040138140 8:43879480-43879502 CAGGTTGGACACACTCTTTTCGG - Intergenic
1040138233 8:43880411-43880433 CAGGTTGGAAACACTCTTTTTGG - Intergenic
1040138972 8:43888123-43888145 CAGGTTAAAAACCCTCTTTTTGG + Intergenic
1040139188 8:43890694-43890716 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040139263 8:43891722-43891744 CAGCTTGGAAACTCTCTTTTTGG + Intergenic
1040140131 8:43899964-43899986 CAGGTTAAAAACCCTCTTTTTGG + Intergenic
1040140220 8:43900991-43901013 CAGGTTGAACACACTCTGTTTGG + Intergenic
1040144055 8:43966730-43966752 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040144185 8:43968598-43968620 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040144309 8:43970470-43970492 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040144439 8:43972338-43972360 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040144570 8:43974206-43974228 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040144702 8:43976073-43976095 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040144831 8:43977941-43977963 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040144963 8:43979810-43979832 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040145099 8:43981677-43981699 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040145232 8:43983546-43983568 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040145454 8:44036881-44036903 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040146288 8:44049297-44049319 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040146547 8:44053202-44053224 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040146798 8:44056945-44056967 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040146889 8:44058302-44058324 CAGGTTGAAAACACTCTTTTTGG + Intergenic
1040147015 8:44060172-44060194 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040147188 8:44062721-44062743 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040147361 8:44065270-44065292 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040147611 8:44069010-44069032 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040147700 8:44070366-44070388 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040147826 8:44072234-44072256 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040147917 8:44073591-44073613 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040148010 8:44074947-44074969 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040148136 8:44076817-44076839 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040148269 8:44078686-44078708 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040148402 8:44080558-44080580 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040148529 8:44082426-44082448 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040148701 8:44084976-44084998 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040148793 8:44086333-44086355 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040149166 8:44091944-44091966 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040149338 8:44094495-44094517 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040149429 8:44095851-44095873 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040149521 8:44097206-44097228 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040149652 8:44099074-44099096 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040149825 8:44101623-44101645 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040150489 8:44111492-44111514 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040150662 8:44114042-44114064 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040150751 8:44115398-44115420 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040151301 8:44123555-44123577 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040151471 8:44126105-44126127 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040151643 8:44128654-44128676 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040151769 8:44130522-44130544 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040151976 8:44133583-44133605 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040152069 8:44134939-44134961 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040152161 8:44136295-44136317 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040152418 8:44140034-44140056 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040152508 8:44141390-44141412 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040152631 8:44143261-44143283 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040152803 8:44145809-44145831 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040152893 8:44147163-44147185 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040153144 8:44150906-44150928 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040153237 8:44152262-44152284 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040153408 8:44154810-44154832 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040153497 8:44156164-44156186 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040153749 8:44159909-44159931 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040153918 8:44162459-44162481 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040154045 8:44164327-44164349 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040154137 8:44165683-44165705 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040154230 8:44167039-44167061 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040154323 8:44168396-44168418 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040154415 8:44169752-44169774 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040154541 8:44171620-44171642 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040154922 8:44177231-44177253 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040155014 8:44178587-44178609 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040155267 8:44182329-44182351 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040155360 8:44183685-44183707 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040155450 8:44185042-44185064 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040155621 8:44187593-44187615 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040155746 8:44189461-44189483 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040155869 8:44191329-44191351 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040155961 8:44192685-44192707 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040156052 8:44194041-44194063 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040156145 8:44195399-44195421 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040156236 8:44196755-44196777 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040156567 8:44201691-44201713 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040156954 8:44207305-44207327 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040157046 8:44208661-44208683 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040157251 8:44211722-44211744 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040157551 8:44216139-44216161 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040157643 8:44217495-44217517 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040157769 8:44219363-44219385 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040157859 8:44220719-44220741 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040158032 8:44223268-44223290 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040158123 8:44224624-44224646 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040158440 8:44229333-44229355 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040158532 8:44230688-44230710 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040158625 8:44232044-44232066 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040158718 8:44233400-44233422 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040158890 8:44235950-44235972 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040159106 8:44239181-44239203 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040159278 8:44241730-44241752 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040159770 8:44249046-44249068 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040160018 8:44252783-44252805 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040160222 8:44255845-44255867 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040160508 8:44260100-44260122 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040161014 8:44267580-44267602 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040161266 8:44271322-44271344 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040161394 8:44273195-44273217 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040161856 8:44279998-44280020 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040161946 8:44281353-44281375 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040162038 8:44282709-44282731 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040162291 8:44286451-44286473 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040162555 8:44290358-44290380 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040162757 8:44293248-44293270 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040162886 8:44295117-44295139 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040162978 8:44296474-44296496 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040163105 8:44298345-44298367 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040163198 8:44299701-44299723 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040163290 8:44301057-44301079 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040163380 8:44302413-44302435 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040163634 8:44306151-44306173 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040164061 8:44312443-44312465 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040164268 8:44315508-44315530 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040164649 8:44321123-44321145 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040164740 8:44322479-44322501 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040165024 8:44326735-44326757 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040165228 8:44329796-44329818 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040165401 8:44332346-44332368 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040165491 8:44333702-44333724 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040165665 8:44336251-44336273 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040165837 8:44338800-44338822 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040165966 8:44340668-44340690 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040166057 8:44342024-44342046 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040166310 8:44345768-44345790 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040166403 8:44347125-44347147 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040166765 8:44352574-44352596 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040166928 8:44355123-44355145 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040167308 8:44360733-44360755 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040167399 8:44362089-44362111 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040167527 8:44363960-44363982 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040167618 8:44365316-44365338 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040167711 8:44366671-44366693 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040168046 8:44371602-44371624 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040168220 8:44374152-44374174 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040168634 8:44380276-44380298 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040168883 8:44384014-44384036 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040169006 8:44385883-44385905 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040169215 8:44388944-44388966 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040169548 8:44393880-44393902 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040170275 8:44404585-44404607 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040170403 8:44406453-44406475 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040170493 8:44407809-44407831 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040170585 8:44409166-44409188 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040170710 8:44411035-44411057 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040170802 8:44412391-44412413 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040170925 8:44414261-44414283 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040171044 8:44415959-44415981 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040171134 8:44417315-44417337 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040171225 8:44418671-44418693 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040171432 8:44421731-44421753 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040171685 8:44425475-44425497 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040171815 8:44427343-44427365 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040171940 8:44429213-44429235 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040172193 8:44432956-44432978 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040172321 8:44434825-44434847 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040172492 8:44437376-44437398 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040172827 8:44442311-44442333 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040173002 8:44444862-44444884 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040173741 8:44455760-44455782 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040173868 8:44457629-44457651 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040174115 8:44461366-44461388 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040174367 8:44465108-44465130 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040174460 8:44466464-44466486 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040174585 8:44468333-44468355 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040174677 8:44469690-44469712 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040174930 8:44473433-44473455 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040175296 8:44478883-44478905 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040175387 8:44480240-44480262 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040175478 8:44481596-44481618 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040175686 8:44484658-44484680 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040175945 8:44488395-44488417 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040176220 8:44492475-44492497 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040176314 8:44493831-44493853 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040176681 8:44499280-44499302 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040176773 8:44500636-44500658 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040176865 8:44501991-44502013 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040177038 8:44504541-44504563 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040177426 8:44510149-44510171 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040177595 8:44512702-44512724 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040177686 8:44514059-44514081 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040177904 8:44517284-44517306 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040178230 8:44522220-44522242 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040178362 8:44524089-44524111 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040178615 8:44527831-44527853 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040178821 8:44530893-44530915 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040178947 8:44532762-44532784 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040179155 8:44535824-44535846 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040179247 8:44537181-44537203 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040179573 8:44542118-44542140 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040179826 8:44545860-44545882 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040179952 8:44547728-44547750 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040180123 8:44550277-44550299 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040180293 8:44552826-44552848 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040180384 8:44554182-44554204 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040180476 8:44555538-44555560 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040180648 8:44558086-44558108 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040181063 8:44564216-44564238 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040181283 8:44567440-44567462 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040181405 8:44569304-44569326 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040181500 8:44570657-44570679 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040181594 8:44572013-44572035 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040181845 8:44575760-44575782 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040181935 8:44577116-44577138 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040182272 8:44582052-44582074 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040182521 8:44585795-44585817 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040182611 8:44587151-44587173 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040183267 8:44596860-44596882 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040183718 8:44603500-44603522 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040183810 8:44604856-44604878 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040184063 8:44608598-44608620 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040184281 8:44611822-44611844 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040184405 8:44613690-44613712 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040184500 8:44615047-44615069 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040184629 8:44616915-44616937 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040184777 8:44619128-44619150 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040184870 8:44620484-44620506 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040184962 8:44621840-44621862 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040185132 8:44624389-44624411 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040185225 8:44625745-44625767 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040185395 8:44628295-44628317 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040185844 8:44634937-44634959 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040186326 8:44642088-44642110 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040186417 8:44643447-44643469 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040186542 8:44645314-44645336 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040186832 8:44649569-44649591 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040186925 8:44650926-44650948 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040187016 8:44652282-44652304 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040187221 8:44655344-44655366 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040187512 8:44659602-44659624 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040187643 8:44661471-44661493 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040187816 8:44664020-44664042 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040187942 8:44665888-44665910 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040188033 8:44667243-44667265 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040188125 8:44668599-44668621 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040188218 8:44669957-44669979 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040188390 8:44672508-44672530 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040188481 8:44673863-44673885 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040188653 8:44676413-44676435 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040188823 8:44678962-44678984 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040188994 8:44681510-44681532 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040189084 8:44682866-44682888 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040189176 8:44684222-44684244 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040189488 8:44688803-44688825 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040189739 8:44692545-44692567 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040189993 8:44696287-44696309 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040190121 8:44698155-44698177 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040190326 8:44701216-44701238 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040190454 8:44703087-44703109 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040190545 8:44704443-44704465 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040190718 8:44706993-44707015 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040191208 8:44714312-44714334 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040191460 8:44718054-44718076 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040191590 8:44719922-44719944 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040191993 8:44725879-44725901 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040192165 8:44728428-44728450 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040192625 8:44735228-44735250 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040193265 8:44744577-44744599 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040193732 8:44751549-44751571 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040194344 8:44760580-44760602 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040194607 8:44764485-44764507 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040194700 8:44765841-44765863 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040194872 8:44768393-44768415 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040195327 8:44775204-44775226 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040195416 8:44776560-44776582 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040195544 8:44778427-44778449 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040195706 8:44780805-44780827 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040195832 8:44782674-44782696 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040196035 8:44785737-44785759 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040196207 8:44788286-44788308 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040196336 8:44790156-44790178 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040196466 8:44792025-44792047 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040196676 8:44795085-44795107 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040197010 8:44800019-44800041 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040197181 8:44802567-44802589 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040197593 8:44808692-44808714 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040197684 8:44810048-44810070 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040197778 8:44811404-44811426 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040197905 8:44813273-44813295 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040198191 8:44817525-44817547 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040198362 8:44820075-44820097 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040198452 8:44821431-44821453 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040198656 8:44824494-44824516 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040198748 8:44825850-44825872 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040198994 8:44829586-44829608 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040199200 8:44832647-44832669 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040199291 8:44834003-44834025 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040199573 8:44838257-44838279 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040199700 8:44840124-44840146 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040199954 8:44843866-44843888 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040200126 8:44846415-44846437 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040200217 8:44847772-44847794 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040200308 8:44849128-44849150 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040200514 8:44852190-44852212 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040200606 8:44853546-44853568 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040200892 8:44857802-44857824 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040201148 8:44861546-44861568 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040201242 8:44862902-44862924 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040201331 8:44864259-44864281 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040201458 8:44866128-44866150 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040201552 8:44867483-44867505 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040201930 8:44873094-44873116 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040202055 8:44874962-44874984 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040202268 8:44878192-44878214 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040202357 8:44879547-44879569 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040202448 8:44880903-44880925 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040202700 8:44884645-44884667 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040202791 8:44886002-44886024 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040203036 8:44889574-44889596 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040203126 8:44890930-44890952 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040203217 8:44892286-44892308 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040203306 8:44893642-44893664 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040203639 8:44898578-44898600 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040203922 8:44902834-44902856 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040204195 8:44906914-44906936 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040204324 8:44908782-44908804 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040204461 8:44910819-44910841 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040204666 8:44913879-44913901 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040204791 8:44915747-44915769 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040204883 8:44917103-44917125 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040204975 8:44918457-44918479 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040205237 8:44922363-44922385 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040205331 8:44923718-44923740 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040205424 8:44925074-44925096 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040205548 8:44926942-44926964 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040205639 8:44928298-44928320 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040205731 8:44929655-44929677 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040205894 8:44932033-44932055 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040205985 8:44933390-44933412 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040206077 8:44934746-44934768 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040206362 8:44939002-44939024 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040206491 8:44940871-44940893 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040206583 8:44942227-44942249 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040206754 8:44944776-44944798 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040206847 8:44946132-44946154 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040206939 8:44947488-44947510 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040207030 8:44948844-44948866 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040207123 8:44950201-44950223 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040207246 8:44952070-44952092 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040207486 8:44955633-44955655 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040207707 8:44958857-44958879 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040207834 8:44960725-44960747 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040207997 8:44963104-44963126 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040208122 8:44964972-44964994 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040208374 8:44968717-44968739 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040208460 8:44970073-44970095 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040208553 8:44971429-44971451 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040208645 8:44972785-44972807 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040208739 8:44974142-44974164 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040208832 8:44975498-44975520 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040209128 8:44979919-44979941 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040209251 8:44981787-44981809 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040209625 8:44987400-44987422 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040209716 8:44988756-44988778 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040209807 8:44990112-44990134 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040209980 8:44992658-44992680 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040210154 8:44995207-44995229 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040210245 8:44996563-44996585 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040210335 8:44997919-44997941 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040210460 8:44999787-44999809 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040210677 8:45003011-45003033 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040210801 8:45004879-45004901 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040210977 8:45007429-45007451 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040211311 8:45012361-45012383 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040211435 8:45014230-45014252 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040212082 8:45023740-45023762 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040212174 8:45025096-45025118 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040212300 8:45026965-45026987 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040212472 8:45029516-45029538 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040212982 8:45036992-45037014 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040213272 8:45041246-45041268 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040213642 8:45046695-45046717 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040213815 8:45049244-45049266 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040213940 8:45051112-45051134 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040214110 8:45053661-45053683 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040214203 8:45055017-45055039 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040214294 8:45056373-45056395 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040214420 8:45058244-45058266 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040214595 8:45060796-45060818 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040214767 8:45063345-45063367 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040214939 8:45065894-45065916 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040215064 8:45067762-45067784 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040215237 8:45070312-45070334 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040215329 8:45071668-45071690 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040215500 8:45074217-45074239 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040215592 8:45075572-45075594 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040216532 8:45089522-45089544 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040216623 8:45090879-45090901 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040216794 8:45093428-45093450 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040216889 8:45094783-45094805 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040217062 8:45097332-45097354 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040217320 8:45101075-45101097 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040217445 8:45102944-45102966 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040217781 8:45107877-45107899 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040218193 8:45114007-45114029 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040218320 8:45115876-45115898 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040218412 8:45117232-45117254 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040218583 8:45119781-45119803 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040218755 8:45122330-45122352 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040219038 8:45126579-45126601 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040219210 8:45129128-45129150 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040219335 8:45130996-45131018 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040219462 8:45132864-45132886 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040219555 8:45134219-45134241 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040219681 8:45136087-45136109 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040219774 8:45137443-45137465 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040220027 8:45141181-45141203 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040220118 8:45142537-45142559 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040220211 8:45143893-45143915 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040220307 8:45145249-45145271 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040220767 8:45152052-45152074 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040220969 8:45155113-45155135 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040221058 8:45156469-45156491 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040221233 8:45159019-45159041 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040221482 8:45162761-45162783 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040221574 8:45164117-45164139 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040221705 8:45165986-45166008 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040221955 8:45169729-45169751 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040222047 8:45171085-45171107 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040222257 8:45174146-45174168 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040222351 8:45175502-45175524 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040222566 8:45178727-45178749 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040222658 8:45180082-45180104 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040222862 8:45183143-45183165 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040222954 8:45184498-45184520 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040223047 8:45185854-45185876 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040223371 8:45190783-45190805 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040223544 8:45193333-45193355 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040223637 8:45194689-45194711 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040223762 8:45196557-45196579 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040223927 8:45198478-45198500 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040224053 8:45200346-45200368 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040224258 8:45203408-45203430 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040224383 8:45205276-45205298 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040224506 8:45207145-45207167 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040224757 8:45210888-45210910 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040224846 8:45212244-45212266 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040225056 8:45215303-45215325 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040225230 8:45217853-45217875 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040225321 8:45219206-45219228 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040225494 8:45221755-45221777 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040225585 8:45223111-45223133 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040225837 8:45226852-45226874 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040225929 8:45228208-45228230 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040226060 8:45230076-45230098 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040226235 8:45232626-45232648 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040226360 8:45234495-45234517 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040226491 8:45236363-45236385 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040226696 8:45239426-45239448 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040226789 8:45240783-45240805 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040226881 8:45242139-45242161 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040227219 8:45247072-45247094 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040227427 8:45250133-45250155 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040227885 8:45256938-45256960 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040228172 8:45261195-45261217 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040228300 8:45263063-45263085 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040228506 8:45266124-45266146 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040228598 8:45267480-45267502 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040228689 8:45268837-45268859 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040228816 8:45270705-45270727 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040229444 8:45280060-45280082 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040229746 8:45284479-45284501 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040229872 8:45286347-45286369 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040230255 8:45291958-45291980 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040230383 8:45293828-45293850 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040230592 8:45296895-45296917 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040230686 8:45298251-45298273 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040230985 8:45302667-45302689 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040231167 8:45305380-45305402 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040231259 8:45306736-45306758 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040231552 8:45310994-45311016 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040231689 8:45313032-45313054 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040231862 8:45315582-45315604 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040231951 8:45316938-45316960 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040232045 8:45318295-45318317 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040232171 8:45320163-45320185 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040232458 8:45324416-45324438 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040233115 8:45334122-45334144 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040233206 8:45335478-45335500 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040233332 8:45337346-45337368 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040233582 8:45341083-45341105 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040233887 8:45345438-45345460 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040233981 8:45346795-45346817 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040234072 8:45348151-45348173 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040234373 8:45352575-45352597 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040234497 8:45354443-45354465 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040234622 8:45356310-45356332 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040234713 8:45357665-45357687 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040234807 8:45359019-45359041 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040234933 8:45360887-45360909 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040235026 8:45362243-45362265 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040235203 8:45364792-45364814 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040235332 8:45366660-45366682 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040235582 8:45370398-45370420 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040235704 8:45372267-45372289 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040235831 8:45374136-45374158 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040235958 8:45376004-45376026 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040236092 8:45377874-45377896 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040236264 8:45380423-45380445 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040236391 8:45382291-45382313 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040236562 8:45384840-45384862 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040236782 8:45388065-45388087 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040236906 8:45389933-45389955 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040237297 8:45395706-45395728 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040237422 8:45397575-45397597 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040237766 8:45402675-45402697 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040237861 8:45404031-45404053 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040237983 8:45405901-45405923 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040238272 8:45410160-45410182 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040238364 8:45411516-45411538 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040238456 8:45412872-45412894 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040238753 8:45417130-45417152 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040238971 8:45420355-45420377 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040239190 8:45423579-45423601 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040239281 8:45424935-45424957 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040239573 8:45429345-45429367 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040239701 8:45431213-45431235 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040239828 8:45433082-45433104 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040239919 8:45434438-45434460 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040240010 8:45435795-45435817 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040240137 8:45437664-45437686 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040240229 8:45439020-45439042 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040240437 8:45442082-45442104 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040240697 8:45445819-45445841 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040240823 8:45447687-45447709 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040240949 8:45449557-45449579 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040241041 8:45450913-45450935 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040241167 8:45452781-45452803 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040241257 8:45454137-45454159 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040241590 8:45459071-45459093 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040241851 8:45462977-45462999 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040241948 8:45464331-45464353 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040242039 8:45465687-45465709 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040242386 8:45470780-45470802 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040242477 8:45472136-45472158 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040242647 8:45474685-45474707 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040242775 8:45476555-45476577 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040242902 8:45478424-45478446 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040243076 8:45480977-45480999 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040243246 8:45483526-45483548 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040243375 8:45485395-45485417 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040243504 8:45487262-45487284 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040243632 8:45489131-45489153 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040243725 8:45490486-45490508 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040243897 8:45493036-45493058 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040244128 8:45496436-45496458 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040244221 8:45497791-45497813 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040244313 8:45499147-45499169 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040244405 8:45500503-45500525 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040244547 8:45502552-45502574 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040244638 8:45503909-45503931 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040244769 8:45505777-45505799 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040245018 8:45509516-45509538 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040245318 8:45513935-45513957 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040245774 8:45520736-45520758 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040245944 8:45523283-45523305 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040246070 8:45525151-45525173 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040246380 8:45529568-45529590 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040246514 8:45531436-45531458 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040246606 8:45532792-45532814 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040246826 8:45536016-45536038 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040246922 8:45537372-45537394 CAGGTTGGAGACACTCTTTTTGG + Intergenic
1040247014 8:45538728-45538750 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040247139 8:45540597-45540619 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040247268 8:45542470-45542492 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040247394 8:45544338-45544360 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040247519 8:45546206-45546228 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040247643 8:45548074-45548096 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040247769 8:45549943-45549965 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040247976 8:45553008-45553030 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040248102 8:45554876-45554898 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040248365 8:45558786-45558808 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040248541 8:45561336-45561358 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040248792 8:45565073-45565095 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040249038 8:45568810-45568832 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040249164 8:45570677-45570699 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040249291 8:45572547-45572569 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040249464 8:45575096-45575118 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040249593 8:45576964-45576986 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040249763 8:45579511-45579533 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040249854 8:45580867-45580889 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040249984 8:45582737-45582759 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040250110 8:45584606-45584628 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040250280 8:45587155-45587177 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040250370 8:45588511-45588533 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040250494 8:45590379-45590401 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040250623 8:45592248-45592270 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040250750 8:45594116-45594138 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040250964 8:45597340-45597362 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040251091 8:45599208-45599230 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040251217 8:45601078-45601100 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040251344 8:45602946-45602968 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040251474 8:45604814-45604836 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040251602 8:45606683-45606705 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040251724 8:45608552-45608574 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040251815 8:45609907-45609929 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040251909 8:45611263-45611285 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040252040 8:45613134-45613156 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040252258 8:45616361-45616383 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040252350 8:45617717-45617739 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040252480 8:45619588-45619610 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040252733 8:45623325-45623347 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040252860 8:45625193-45625215 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040252987 8:45627061-45627083 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040253080 8:45628417-45628439 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040253173 8:45629774-45629796 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040253299 8:45631642-45631664 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040253390 8:45632998-45633020 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040253608 8:45636225-45636247 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040253732 8:45638093-45638115 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040254071 8:45643026-45643048 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040254164 8:45644382-45644404 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040254296 8:45646250-45646272 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040254422 8:45648119-45648141 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040254549 8:45649991-45650013 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040254675 8:45651860-45651882 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040254893 8:45655086-45655108 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040255017 8:45656955-45656977 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040255144 8:45658823-45658845 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040255273 8:45660694-45660716 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040255404 8:45662563-45662585 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040255495 8:45663917-45663939 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040255621 8:45665786-45665808 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040255746 8:45667654-45667676 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040255997 8:45671391-45671413 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040256125 8:45673260-45673282 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040256220 8:45674617-45674639 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040256350 8:45676487-45676509 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040256473 8:45678355-45678377 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040256600 8:45680225-45680247 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040256727 8:45682094-45682116 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040256819 8:45683450-45683472 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040256944 8:45685319-45685341 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040257163 8:45688543-45688565 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040257380 8:45691767-45691789 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040257596 8:45694992-45695014 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040257726 8:45696861-45696883 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040257853 8:45698729-45698751 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040257944 8:45700084-45700106 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040258034 8:45701440-45701462 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040258126 8:45702796-45702818 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040258255 8:45704664-45704686 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040258466 8:45707717-45707739 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040258590 8:45709586-45709608 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040258685 8:45710941-45710963 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040258812 8:45712809-45712831 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040258902 8:45714165-45714187 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040259285 8:45719772-45719794 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040259411 8:45721641-45721663 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040259501 8:45722997-45723019 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040259623 8:45724867-45724889 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040259805 8:45727579-45727601 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040259930 8:45729448-45729470 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040260057 8:45731317-45731339 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040260184 8:45733185-45733207 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040260309 8:45735055-45735077 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040260439 8:45736923-45736945 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040260566 8:45738793-45738815 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040260691 8:45740661-45740683 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040260816 8:45742529-45742551 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040260909 8:45743885-45743907 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040261038 8:45745754-45745776 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040261167 8:45747622-45747644 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040261293 8:45749490-45749512 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040261417 8:45751359-45751381 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040261542 8:45753227-45753249 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040261668 8:45755095-45755117 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040262170 8:45762570-45762592 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040262299 8:45764440-45764462 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040262424 8:45766308-45766330 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040262676 8:45770045-45770067 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040262802 8:45771915-45771937 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040263057 8:45775653-45775675 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040263183 8:45777523-45777545 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040263312 8:45779392-45779414 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040263443 8:45781261-45781283 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040263569 8:45783129-45783151 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040263816 8:45786866-45786888 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040263941 8:45788734-45788756 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040264068 8:45790602-45790624 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040264196 8:45792470-45792492 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040264288 8:45793825-45793847 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040264539 8:45797563-45797585 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040264664 8:45799432-45799454 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040264790 8:45801302-45801324 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040264914 8:45803169-45803191 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040265044 8:45805039-45805061 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040265169 8:45806907-45806929 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040265299 8:45808775-45808797 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040265427 8:45810643-45810665 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040265680 8:45814381-45814403 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040265804 8:45816249-45816271 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040265929 8:45818118-45818140 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040266058 8:45819988-45820010 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040266184 8:45821858-45821880 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040266308 8:45823729-45823751 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040266433 8:45825598-45825620 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040266557 8:45827467-45827489 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040266688 8:45829336-45829358 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040266812 8:45831206-45831228 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040266937 8:45833075-45833097 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040267060 8:45834945-45834967 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040267187 8:45836814-45836836 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040267313 8:45838682-45838704 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040267691 8:45844291-45844313 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040267817 8:45846158-45846180 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040267948 8:45848026-45848048 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040268076 8:45849894-45849916 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040268202 8:45851762-45851784 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040268332 8:45853630-45853652 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040268549 8:45856854-45856876 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040268678 8:45858723-45858745 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040268803 8:45860592-45860614 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040268954 8:45862799-45862821 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040269088 8:45864759-45864781 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040269337 8:45868500-45868522 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040269463 8:45870369-45870391 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040269843 8:45875974-45875996 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1040270234 8:45931805-45931827 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1040297633 8:46167482-46167504 CAGGTTGGAAACACTCTTTTTGG - Intergenic
1041504871 8:58585419-58585441 AAAGTTAAAGACTTCCTTTTTGG + Intronic
1045879397 8:107020514-107020536 CAGGTCACAGCCTCTCCTTTAGG - Intergenic
1046293545 8:112193495-112193517 CATTTTAAAAACTGTCTTTTTGG + Intergenic
1047686296 8:127307893-127307915 CAGGTTAGAAACTCACTTTAGGG + Intergenic
1048492553 8:134907483-134907505 CAGGTAAAAGACTATACTTTGGG - Intergenic
1049899900 9:149469-149491 CAGGTCAATGACTGTCTTCTCGG + Intronic
1050098164 9:2089455-2089477 CTGGGTAACGACTCTATTTTTGG + Intronic
1050393888 9:5175486-5175508 CATTTTAAAGACTTTGTTTTGGG - Intronic
1051576674 9:18623618-18623640 CAGATTAATGACTCAATTTTTGG - Intronic
1051591679 9:18782516-18782538 AAGGCTAAAGACTTTCTTTACGG + Intronic
1053711559 9:40815128-40815150 CAGTTTAGAAACACTCTTTTTGG + Intergenic
1054422023 9:64947004-64947026 CAGTTTAGAAACACTCTTTTTGG + Intergenic
1055085320 9:72307934-72307956 CAGGTGAAAGTCACTATTTTAGG + Intergenic
1055456312 9:76475357-76475379 AATGTTACAGATTCTCTTTTTGG - Intronic
1056015520 9:82382413-82382435 AAGCTTAAATACTCTCTTTACGG + Intergenic
1057006079 9:91561259-91561281 CAGGTTCAAGCCACTCTTCTTGG - Intergenic
1203420296 Un_KI270372v1:454-476 CAGTTTGGAGTCTCTCTTTTTGG - Intergenic
1203420147 Un_KI270374v1:338-360 CAGTTTGGAGTCTCTCTTTTTGG + Intergenic
1203381348 Un_KI270435v1:49110-49132 CAGTTTTAAAACGCTCTTTTTGG + Intergenic
1203385040 Un_KI270438v1:29417-29439 CAGTTTTAAAACACTCTTTTTGG + Intergenic
1188838050 X:34982984-34983006 CAGGTAAAGGACTCCCTATTCGG + Intergenic
1189528396 X:41851575-41851597 CAGGCTAAAGACATTCTTTCGGG - Intronic
1191228752 X:58076501-58076523 CAGGTTGGAAACACTCTTTTTGG - Intergenic
1191269852 X:58451083-58451105 CAGGTTGAAAACTCTCATCTTGG + Intergenic
1193466227 X:81851051-81851073 CAGTTTAAAGAATTTCCTTTAGG - Intergenic
1196386131 X:115153402-115153424 TATGTTAAAATCTCTCTTTTAGG + Intronic
1199132513 X:144208319-144208341 CAGGGTACAGACTCTCTCCTGGG - Intergenic
1201064615 Y:10084140-10084162 CAGTTTAGAATCTCTCTTTTTGG - Intergenic
1201776233 Y:17668803-17668825 CAGGTTGAAAACCCTCTTTTAGG - Intergenic
1201776287 Y:17669656-17669678 CAGGTTTGAAACACTCTTTTTGG - Intergenic
1201776547 Y:17671950-17671972 CAGATTAAAAACACTCTTTTTGG - Intergenic
1201776559 Y:17672125-17672147 CAGGTTAAAAACACTGTTTTTGG - Intergenic
1201776716 Y:17673653-17673675 CAGGTTGGAAACACTCTTTTTGG - Intergenic
1201776773 Y:17674163-17674185 CAGGTTGGAAACACTCTTTTTGG - Intergenic
1201776791 Y:17674333-17674355 CAGGTAAAAGACACTCTTTCTGG - Intergenic
1201776950 Y:17676188-17676210 CAGGTTGGAAACACTCTTTTTGG - Intergenic
1201777202 Y:17679125-17679147 CAGGTTGAAAACACTCTTTTTGG - Intergenic
1201777270 Y:17679811-17679833 CAGGTTCAAAACATTCTTTTTGG - Intergenic
1201777302 Y:17680152-17680174 CAGGTTGAAAACTCTCTTTCTGG - Intergenic
1201777347 Y:17680667-17680689 CAGGTTAAAGACACTCTCCTTGG - Intergenic
1201777381 Y:17681016-17681038 CAGGTTGGAAACTCCCTTTTTGG - Intergenic
1201777529 Y:17682716-17682738 CAGGTTCAAGACACTTTTTTTGG - Intergenic
1201777595 Y:17683415-17683437 CAGGTTAGAAACACTCTTTTTGG - Intergenic
1201777659 Y:17684093-17684115 CAGGTTGCAAACACTCTTTTTGG - Intergenic
1201778907 Y:17696684-17696706 CAGGTTAAAAACAATCTTTTTGG - Intergenic
1201778969 Y:17697345-17697367 CAGGTTGGAAACACTCTTTTTGG - Intergenic
1201779103 Y:17698712-17698734 CAGGTTGGAAACACTCTTTTTGG - Intergenic
1201779209 Y:17699922-17699944 CAGGTTGGAAACACTCTTTTTGG - Intergenic
1201779609 Y:17704877-17704899 CAGGTGGAAAACACTCTTTTTGG - Intergenic
1201779622 Y:17705047-17705069 CAGGTTGGAAACACTCTTTTTGG - Intergenic
1201821933 Y:18200945-18200967 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1201821946 Y:18201115-18201137 CAGGTGGAAAACACTCTTTTTGG + Intergenic
1201822347 Y:18206070-18206092 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1201822453 Y:18207280-18207302 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1201822587 Y:18208647-18208669 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1201822649 Y:18209308-18209330 CAGGTTAAAAACAATCTTTTTGG + Intergenic
1201823899 Y:18221899-18221921 CAGGTTGCAAACACTCTTTTTGG + Intergenic
1201823963 Y:18222577-18222599 CAGGTTAGAAACACTCTTTTTGG + Intergenic
1201824029 Y:18223276-18223298 CAGGTTCAAGACACTTTTTTTGG + Intergenic
1201824176 Y:18224976-18224998 CAGGTTGGAAACTCCCTTTTTGG + Intergenic
1201824210 Y:18225325-18225347 CAGGTTAAAGACACTCTCCTTGG + Intergenic
1201824255 Y:18225840-18225862 CAGGTTGAAAACTCTCTTTCTGG + Intergenic
1201824287 Y:18226181-18226203 CAGGTTCAAAACATTCTTTTTGG + Intergenic
1201824355 Y:18226867-18226889 CAGGTTGAAAACACTCTTTTTGG + Intergenic
1201824607 Y:18229804-18229826 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1201824765 Y:18231659-18231681 CAGGTAAAAGACACTCTTTCTGG + Intergenic
1201824783 Y:18231829-18231851 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1201824840 Y:18232339-18232361 CAGGTTGGAAACACTCTTTTTGG + Intergenic
1201824997 Y:18233867-18233889 CAGGTTAAAAACACTGTTTTTGG + Intergenic
1201825009 Y:18234042-18234064 CAGATTAAAAACACTCTTTTTGG + Intergenic
1201825269 Y:18236336-18236358 CAGGTTTGAAACACTCTTTTTGG + Intergenic
1201825323 Y:18237189-18237211 CAGGTTGAAAACCCTCTTTTAGG + Intergenic