ID: 1014020792

View in Genome Browser
Species Human (GRCh38)
Location 6:116586747-116586769
Sequence TATGGTAGTTCAGTGTTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 133}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014020792 Original CRISPR TATGGTAGTTCAGTGTTTCC TGG Intronic
900704089 1:4068028-4068050 TATGGGATTCTAGTGTTTCCTGG - Intergenic
901027748 1:6287854-6287876 TAAGTCAGTTCACTGTTTCCAGG - Intronic
908783289 1:67711428-67711450 AATGGGAGTTCAGGGTTTCTCGG + Intronic
909365969 1:74822578-74822600 TTGGGTAGTTCTGTCTTTCCAGG + Intergenic
913370374 1:118092463-118092485 CAGGGTAGTTCAGTGATCCCAGG - Intronic
913552823 1:119933327-119933349 TATGGGACTTGAGAGTTTCCTGG + Intronic
914405654 1:147369340-147369362 TTGGGAAGTTCTGTGTTTCCAGG - Intergenic
917159365 1:172040526-172040548 TAAGGTAATTCATTCTTTCCTGG + Intronic
917916136 1:179704044-179704066 TTTGGTAAATCAGTGTTTTCTGG - Intergenic
919081291 1:192869167-192869189 TATGTTAATTCATTGTTTACTGG - Intergenic
919149850 1:193682104-193682126 TATGGTATTTCTATGGTTCCAGG - Intergenic
924155661 1:241173908-241173930 TGTGGTAGCTGAGTGTGTCCTGG - Intronic
924187297 1:241506957-241506979 TATGGTTTTTTAGTGTTTTCAGG - Intronic
924617355 1:245623257-245623279 GAAAGTAGTTCAGTGGTTCCTGG - Intronic
1063213314 10:3901130-3901152 TTTGGAGGTTCAGTGTTTCTAGG - Intergenic
1066762843 10:38772468-38772490 TATGGTTATTCAGTTTTCCCAGG + Intergenic
1068020550 10:51577849-51577871 TGTGGTATTTCCGTGCTTCCTGG + Intronic
1069177047 10:65304479-65304501 TATGTTTGTTCAGTATTTCTGGG - Intergenic
1072942074 10:99774500-99774522 TATGTTAGTTCATTTTTTTCTGG + Intergenic
1076126148 10:127975623-127975645 TATGTTAAATCAGTGTTTTCAGG - Intronic
1079838197 11:25362153-25362175 TATGATAGTTCACTAATTCCTGG + Intergenic
1080156725 11:29119879-29119901 TATGTTTGTTCAGTGTTTCCTGG - Intergenic
1080475962 11:32591437-32591459 TATGGTAGTGTAGTGGTACCAGG - Intronic
1086223098 11:84473793-84473815 TATGTTAATTCCGTGTTTCCAGG - Intronic
1087354966 11:97081207-97081229 TCTGGAACTTCAGGGTTTCCAGG - Intergenic
1088946690 11:114520649-114520671 TATGGTAGTTCTGTTTTTAGGGG + Intergenic
1089227723 11:116939704-116939726 TCCTGTAGTTCAGTGTTTCTTGG - Intronic
1091248459 11:134120707-134120729 TCTGGGAGTTCAGTTTTTCATGG + Intronic
1091947830 12:4564396-4564418 TATGGCAGTGCAGGGTTTGCAGG - Intronic
1094174441 12:27526902-27526924 TCTGGAACTTCAGTGTGTCCTGG - Intronic
1094308472 12:29049787-29049809 TATGGTAGTTCTGTTTTTTGAGG - Intergenic
1095507924 12:42917741-42917763 TAAGGTACTTCATTATTTCCTGG + Intergenic
1097823769 12:64154156-64154178 AATTGTTGTTCAGTGTTTACAGG + Exonic
1100620858 12:96271358-96271380 TTTGCTATATCAGTGTTTCCTGG + Intergenic
1101074423 12:101113732-101113754 TAGGGTAGTACAGTGATTGCTGG + Intronic
1101791391 12:107930835-107930857 AATGTGAGTTCAGTGTTGCCAGG + Intergenic
1102772061 12:115486582-115486604 TTTTGAAGTTCAGTCTTTCCAGG - Intergenic
1103389512 12:120561519-120561541 TAAGCTAGATCAGTGGTTCCAGG - Intronic
1106015845 13:25868279-25868301 TATGCTCATTCAGTGTTTTCTGG - Intronic
1106142618 13:27023984-27024006 TCTGATAATTCAATGTTTCCAGG + Intergenic
1110889778 13:80684634-80684656 TGAGGTAGTTCAGTGTTTTATGG - Intergenic
1112422094 13:99261684-99261706 CATGGGACTTCAGTGGTTCCAGG - Exonic
1115957321 14:38795836-38795858 TATTGTACTGCAATGTTTCCTGG - Intergenic
1123760189 15:23425770-23425792 TCTGCTAATTCAGTGTTTGCAGG - Intergenic
1123792653 15:23737810-23737832 TATGGTAGTTCTATGTTTAGGGG + Intergenic
1129554844 15:76496995-76497017 TATGGTTGTTCATTTTCTCCTGG - Intronic
1135401979 16:22172223-22172245 TCTGGTGGTTCTGTTTTTCCTGG + Intronic
1138773850 16:59696497-59696519 TGGGGTTGGTCAGTGTTTCCAGG + Intergenic
1138803883 16:60069954-60069976 TAAGTTAGTTGATTGTTTCCTGG - Intergenic
1142032603 16:87845999-87846021 TCTGGGAGCTCAGTGTGTCCTGG - Intronic
1145269059 17:21394800-21394822 GCTGGGAGTTCAGTGTTGCCAGG + Intronic
1150505655 17:65696062-65696084 TCTGCTAGGACAGTGTTTCCAGG - Intronic
1155766520 18:29641430-29641452 TATGGTAGATCCATGTTTCTGGG + Intergenic
1159020592 18:63139830-63139852 TATGCTATTTCACTGTTTCGGGG + Intronic
925964128 2:9047746-9047768 TAAGGTAATTCAGTGTTTGTGGG - Intergenic
927145156 2:20160009-20160031 TATGGATGTTCAGTGGTTCCAGG + Intergenic
928278538 2:29923094-29923116 TATGGTAGTTAATACTTTCCTGG + Intergenic
928534640 2:32228190-32228212 TATGGTAGGTCAGGGTACCCTGG + Intronic
929651794 2:43687336-43687358 TATGGCAGTGTAGTGTTCCCTGG + Intronic
935674638 2:105584108-105584130 TGTGGTAGATCAATGTGTCCAGG - Intergenic
936968419 2:118150250-118150272 TATGGTATTTCAGAGATTTCTGG - Intergenic
940460377 2:153957341-153957363 TTTGGTAGTTCGGGGTCTCCAGG - Intronic
942326325 2:174779793-174779815 TGTGGTATTTCCGTGTTTCCAGG - Intergenic
944541545 2:200758180-200758202 TATTCTAGTGCAGGGTTTCCTGG - Intergenic
945655900 2:212623624-212623646 GTTGGTAGTTTTGTGTTTCCAGG - Intergenic
1169986482 20:11450838-11450860 TATGGTCCTTCAGTATTTGCTGG - Intergenic
1175636396 20:60587721-60587743 TTTTTCAGTTCAGTGTTTCCTGG - Intergenic
1179309545 21:40183514-40183536 TTGGGGTGTTCAGTGTTTCCTGG + Intronic
1180278434 22:10668028-10668050 TATGGTTATTCAGTTTTCCCAGG + Intergenic
953128519 3:40114728-40114750 TTTGGTAGTTCAGTGTTAACAGG + Intronic
955246512 3:57229600-57229622 TATCGTAGTGCACTGTGTCCTGG + Intronic
958843534 3:99238050-99238072 TCTGTTATTTCAGTGTTTCAAGG - Intergenic
963001194 3:140683282-140683304 CAGGGTAGCACAGTGTTTCCTGG - Intronic
963371799 3:144410785-144410807 TATGGGTTTTCAGTGTTTTCTGG + Intergenic
964586563 3:158312725-158312747 TATGGTATTTCAGTGTATGTGGG - Intronic
964609229 3:158592985-158593007 TATAGAAGATCAGTGTTTCCTGG - Intronic
966624519 3:182001735-182001757 TCCGGCAGTTCAGTGCTTCCTGG + Intergenic
974035095 4:56811239-56811261 TATGGTAGTTCTCAGTTTTCAGG - Intronic
974518827 4:62954221-62954243 TATCACAGTTCAGTGTTTCTAGG + Intergenic
975980316 4:80150319-80150341 TCAGGGAGTTCATTGTTTCCAGG + Intergenic
978558617 4:110007854-110007876 TATGGTAAATCAGTGGCTCCAGG + Intronic
978691166 4:111512535-111512557 TATGGTATTTCACTGTGTCTAGG - Intergenic
979744008 4:124186752-124186774 TACAGTAGTTCAGGATTTCCTGG + Intergenic
979787384 4:124733188-124733210 TATGATAGTTTAGTTTTTCTGGG + Intergenic
979891930 4:126108311-126108333 TATAGTAGTTAAGTCTTCCCAGG + Intergenic
980083262 4:128366800-128366822 TGTGGGAATTCAGTGTTTACTGG + Intergenic
981312031 4:143306861-143306883 TATTTTAGGTTAGTGTTTCCTGG + Intergenic
983305390 4:165978253-165978275 GTTGGTTGTTCATTGTTTCCAGG + Intronic
983423347 4:167549282-167549304 TAAGGTATTTCACTCTTTCCTGG + Intergenic
983944569 4:173570892-173570914 TATTCTATTTTAGTGTTTCCAGG + Intergenic
985932783 5:3072159-3072181 TATGACAGTTCAGAATTTCCAGG - Intergenic
985983867 5:3496964-3496986 TATGCTGTTTCATTGTTTCCTGG - Intergenic
988286648 5:29227062-29227084 TTTGGTAGTTCATTTTTCCCTGG + Intergenic
994104190 5:95928057-95928079 TTTGGTAGTTGGGTATTTCCAGG + Intronic
995212658 5:109558254-109558276 GATGGTAGTTCAGTCTTGCATGG - Intergenic
996451125 5:123625878-123625900 AATGGTACTTCAGTGGTACCAGG + Intergenic
996482423 5:123989969-123989991 TAATTTAGTTCAGTGTTTACTGG + Intergenic
999356222 5:150934489-150934511 TATGTTATTCCAGTGTTTTCTGG - Intergenic
1000846521 5:166288635-166288657 GATGGTAGTCCAGTTTTTCACGG - Intergenic
1001200870 5:169715321-169715343 TATGGTAGCTCTGTGTTTTGAGG + Intronic
1001207112 5:169774520-169774542 CATGGCAGTTCAGTGTGTGCTGG - Intronic
1002321949 5:178381582-178381604 TATGGGAATTCTGTGTCTCCGGG + Intronic
1005890771 6:30136017-30136039 CCTGGTAATTCAGTGTTTCTAGG + Intergenic
1008342519 6:50384768-50384790 GATGGTAGTTAACTGTATCCTGG - Intergenic
1010511316 6:76724052-76724074 AATGGTAGTTTAATGTTTCCAGG - Intergenic
1012107775 6:95187094-95187116 AATGGTATTTCAATGTTTCAAGG + Intergenic
1012713161 6:102634008-102634030 TCTGATAGTTCAGGGTTTCTTGG + Intergenic
1014020792 6:116586747-116586769 TATGGTAGTTCAGTGTTTCCTGG + Intronic
1017618237 6:156267575-156267597 TATGAGAGTTAATTGTTTCCAGG - Intergenic
1017867458 6:158456219-158456241 TCTGGTGGTTAAGTCTTTCCTGG + Intronic
1021386852 7:20041366-20041388 AATGATAATTCAGGGTTTCCTGG - Intergenic
1024139668 7:46449110-46449132 TCTGGAAGCTCATTGTTTCCAGG + Intergenic
1025050686 7:55731568-55731590 TTTGCTAGTTCAGTATTTGCTGG + Intergenic
1029697735 7:102225380-102225402 TATGGCAGGTTAGTGTATCCTGG + Intronic
1041378684 8:57228701-57228723 TATGGTACCTCAATGCTTCCAGG - Intergenic
1043309838 8:78844337-78844359 CAGGGTAGTTCAGTACTTCCAGG + Intergenic
1043858563 8:85289256-85289278 TAAGATAATTCAGAGTTTCCAGG + Intergenic
1046577232 8:116045686-116045708 TATGGTTGCTCAGTGTTACATGG + Intergenic
1047958342 8:129992958-129992980 TCTGGTAGCATAGTGTTTCCTGG + Intronic
1047961579 8:130015746-130015768 AATGGAAGTTCAGTGTTAGCGGG - Intronic
1048110256 8:131460463-131460485 TATTGGAGATCAGTGTTTCTGGG + Intergenic
1050197649 9:3105153-3105175 TATGGTATTACAGTTTTTCTAGG - Intergenic
1050654239 9:7808265-7808287 TATTCTAGTTCAGTTTTCCCAGG + Intronic
1050851811 9:10297040-10297062 TATGGTAAATCTGAGTTTCCAGG + Intronic
1053268371 9:36732625-36732647 GATTGTAGTTCAGGTTTTCCTGG + Intergenic
1053694610 9:40624520-40624542 TATGGTTATTCAGTTTTCCCAGG + Intergenic
1054270226 9:63015599-63015621 TATGGTTATTCAGTTTTCCCAGG - Intergenic
1054305855 9:63423743-63423765 TATGGTTATTCAGTTTTCCCAGG + Intergenic
1054404601 9:64747725-64747747 TATGGTTATTCAGTTTTCCCAGG + Intergenic
1054438224 9:65233217-65233239 TATGGTTATTCAGTTTTCCCAGG + Intergenic
1054492180 9:65788731-65788753 TATGGTTATTCAGTTTTCCCAGG - Intergenic
1056723256 9:89089548-89089570 TATGGTGGTTCAGTGTGTCGGGG - Intronic
1058702099 9:107609685-107609707 GATGGGAGTTCAGGGCTTCCAGG - Intergenic
1186640141 X:11446985-11447007 TATGGAAATTCAGTGTCTTCTGG - Intronic
1188471118 X:30540430-30540452 TATGGTAGTTCTATTTTTCAAGG - Intergenic
1190406163 X:50090026-50090048 TTTGGTAGGTCAGCTTTTCCTGG + Intronic
1192458057 X:71294113-71294135 TATGGTTGTTTAGTTTTTCCGGG + Intronic
1194117714 X:89922971-89922993 TCAGATATTTCAGTGTTTCCAGG + Intergenic
1194685139 X:96904925-96904947 AATGATAGTTCAGGGTTTCTTGG - Intronic
1195631140 X:107056598-107056620 TTTGGTAGTTGTGTGTTTCTAGG + Intergenic
1196633775 X:117975736-117975758 CATGGTAGTGAAGTGTTTCCAGG + Intronic
1197470343 X:126860571-126860593 TATGGATGTTCAGTTTTCCCAGG - Intergenic
1200470497 Y:3580129-3580151 TCAGATATTTCAGTGTTTCCAGG + Intergenic
1201192417 Y:11456434-11456456 TATGGTTATTCAGTTTTCCCAGG + Intergenic