ID: 1014022451

View in Genome Browser
Species Human (GRCh38)
Location 6:116606479-116606501
Sequence GCTCTTACTCACCGTAAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014022451_1014022455 19 Left 1014022451 6:116606479-116606501 CCTATCTTACGGTGAGTAAGAGC No data
Right 1014022455 6:116606521-116606543 ATTAAGTGCTACCAACTGGAAGG No data
1014022451_1014022454 15 Left 1014022451 6:116606479-116606501 CCTATCTTACGGTGAGTAAGAGC No data
Right 1014022454 6:116606517-116606539 CACTATTAAGTGCTACCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014022451 Original CRISPR GCTCTTACTCACCGTAAGAT AGG (reversed) Intergenic
No off target data available for this crispr