ID: 1014031996

View in Genome Browser
Species Human (GRCh38)
Location 6:116716696-116716718
Sequence GAGGCAAAATATCAGTAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 156}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014031996 Original CRISPR GAGGCAAAATATCAGTAGAT AGG (reversed) Intronic
901361190 1:8702532-8702554 CTGGCAAAATAACAGTAGTTCGG + Intronic
901589339 1:10326961-10326983 GATGCCAAAGATCCGTAGATAGG - Intronic
906121035 1:43390828-43390850 GTGCCAACATATCAGTAGGTGGG + Intronic
907734113 1:57095065-57095087 GAGTCTGAATTTCAGTAGATGGG - Intronic
908751275 1:67426134-67426156 GAGGCGAATTTTCAGTTGATAGG - Exonic
911421853 1:97652860-97652882 GAGAGTAAATAACAGTAGATAGG - Intronic
913513281 1:119581753-119581775 TGGGCTAAATATCAGAAGATGGG + Intergenic
913516909 1:119612737-119612759 TGGGCTAAATATCAGAAGATGGG + Intergenic
915680467 1:157577091-157577113 GAGGAAAAAAATAAGAAGATTGG + Intronic
916473817 1:165149294-165149316 GAGGCAAAAGATCAGATGATAGG - Intergenic
917370008 1:174282668-174282690 TAGGCAAAATTTCCTTAGATAGG - Intronic
917911967 1:179657960-179657982 GACACAAAATTTCAGTAGACAGG - Intronic
920832989 1:209481964-209481986 GAGGCAAAAGGTAAGAAGATGGG + Intergenic
923984182 1:239361897-239361919 GAAGAAAAATATTAGTAGTTTGG - Intergenic
924885979 1:248217129-248217151 AAGGAAAAAAATCAGAAGATTGG - Intergenic
1063770465 10:9192938-9192960 GATGCAAAGTTTCATTAGATAGG + Intergenic
1064540481 10:16399932-16399954 GAGGAGAAAAATCAGTAAATAGG + Intergenic
1068401393 10:56532098-56532120 GAGCCAAAATAGCCGGAGATTGG - Intergenic
1068593443 10:58874741-58874763 GAGTAAAAAGATCAGTAAATGGG + Intergenic
1068949976 10:62767080-62767102 GAAGCAAAGTTTCAGGAGATGGG + Intergenic
1071810943 10:89180070-89180092 GAAGCAAGATATCATTAGAGTGG + Intergenic
1074311481 10:112326746-112326768 GAATCAAAATATCTGAAGATGGG - Intergenic
1079769441 11:24440782-24440804 GAGCCAAAATATCTAAAGATTGG - Intergenic
1081452307 11:43183240-43183262 AAGGCAAAATATTAGTTGAATGG - Intergenic
1083927486 11:65817210-65817232 GATGCAAATTGTGAGTAGATAGG - Intergenic
1089036354 11:115397324-115397346 GAGCCAACATATCAGGAGAATGG + Intronic
1089893897 11:121908308-121908330 GAGCCAAAATAATAGAAGATGGG + Intergenic
1093714081 12:22361814-22361836 GAATAAAAATATCAGTGGATGGG + Intronic
1097501350 12:60408332-60408354 CAGGCAAAATATCAGAAGTAAGG - Intergenic
1099576421 12:84389711-84389733 GAAGCATAATATTAGGAGATAGG + Intergenic
1101509220 12:105377613-105377635 AAGGCAAGATATCAGGAGAGAGG + Intronic
1102840992 12:116121754-116121776 GAGGTAAAAAAGCAGTAGGTGGG - Intronic
1103205122 12:119123057-119123079 GAGATAAAATATTAGTTGATTGG - Intronic
1104335676 12:127892541-127892563 AAGTCAAAATATGTGTAGATAGG + Intergenic
1106211097 13:27646518-27646540 GAGTCAACATGTCAGTAGATAGG + Intronic
1107295647 13:38904240-38904262 GAAGCCAAAAATCAGTAGAATGG + Intergenic
1108100663 13:46950981-46951003 GATGCAAAATACAAGTAGGTTGG + Intergenic
1109135617 13:58646204-58646226 GTTGCAAAATTTCAGTACATAGG - Intergenic
1109345460 13:61110197-61110219 GAAGCAAAACAGCAGGAGATGGG - Intergenic
1110475905 13:75913108-75913130 GATAGAGAATATCAGTAGATGGG + Intergenic
1111299911 13:86335205-86335227 CTGGCAAAATACCACTAGATTGG - Intergenic
1111839670 13:93434280-93434302 CAGGCATAATATCAGTCTATAGG - Intronic
1115581778 14:34767014-34767036 GAGGCAAAAACACAGTGGATGGG + Intronic
1115941279 14:38612658-38612680 AAGGGAAAATATCAGTCAATAGG + Intergenic
1116349736 14:43845482-43845504 GTGTCAAAATATTAGAAGATTGG - Intergenic
1117217302 14:53564848-53564870 GCAGCAAAATATCATTACATAGG + Intergenic
1118464201 14:66016011-66016033 GAGGCAAAGTTTCATGAGATGGG - Intergenic
1121728325 14:96168973-96168995 GTGGCAAAATATCTGGAGGTAGG + Intergenic
1123168548 14:106349357-106349379 GAGTCACCATATCAGTAGACAGG - Intergenic
1124051417 15:26200319-26200341 GAGGCTAAATATTGGTAGAGAGG + Intergenic
1130336524 15:82961454-82961476 AAGGTAAAGAATCAGTAGATTGG - Intronic
1131786454 15:95917501-95917523 TAGGCAAAATCTCAGAAGATTGG + Intergenic
1134261880 16:12657473-12657495 GAAGCAAAATATTACTAAATTGG - Intergenic
1134416891 16:14051823-14051845 GAGGCAAGATAAAAGAAGATTGG - Intergenic
1137490212 16:48926109-48926131 AAGGCAAAAGAGCAGTAGGTAGG - Intergenic
1140033053 16:71353788-71353810 GAGGTGAAATAGCAGTAGCTGGG - Intergenic
1142394413 16:89823562-89823584 GAGGGAAATTATCAGTAACTGGG - Intronic
1144247288 17:13379615-13379637 GAAGCCAAATATCAGTTGATTGG + Intergenic
1144779378 17:17800134-17800156 GAGGCAAAAAATCACTAACTGGG - Intronic
1145753412 17:27372077-27372099 GAGGAAAAAATTCACTAGATGGG - Intergenic
1147846871 17:43410691-43410713 GAGGCAAACTCTCAGGAGAAGGG + Intergenic
1147855780 17:43478769-43478791 GAGGCTAAATATCATTAGGGAGG + Intergenic
1149151282 17:53567085-53567107 TAGGAAAAATATCAGTATAGAGG - Intergenic
1149281792 17:55112975-55112997 GAAGAGAAATTTCAGTAGATTGG + Intronic
1149395892 17:56243394-56243416 GAGCCAAACTATCACTAGCTTGG - Intronic
1149692950 17:58593550-58593572 GATCCAAAATACCAGTAGGTGGG - Exonic
1150544507 17:66140654-66140676 GAGCAAAAATAACAGTAAATGGG - Intronic
1152221172 17:79067964-79067986 AAGGCAAAATATCAGTATCTGGG + Intergenic
1156888399 18:42162208-42162230 TAGTCAAAATAAAAGTAGATTGG - Intergenic
1157475060 18:48018663-48018685 GAGGCAGAATATCAATAAAATGG - Intergenic
1158243183 18:55401056-55401078 AAGGCAAAATCTCAGTATCTTGG - Intronic
1159529618 18:69639123-69639145 GAGGCATAATAGCAGAAGTTAGG + Intronic
1166750888 19:45163515-45163537 GAGGCAAAATAACTGAAGGTGGG + Intronic
1167659551 19:50788498-50788520 CAGCCAATACATCAGTAGATAGG + Intergenic
932158345 2:69438203-69438225 GAGGCACAATCTCTGTAGGTGGG + Intergenic
932534601 2:72579847-72579869 GAGGCCAAATATAATTATATAGG + Intronic
936264599 2:110993318-110993340 GTGGGAAAATATCAGAAGAGTGG - Intronic
937519322 2:122692304-122692326 GAGGAAAAATATCAATAGATTGG - Intergenic
938474271 2:131592299-131592321 GAGGCAAATTATAACTTGATCGG - Intergenic
942325865 2:174776813-174776835 GAGCCAAGATAGCAGGAGATAGG + Intergenic
943682538 2:190783312-190783334 GAGGAAGAAAATGAGTAGATGGG - Intergenic
944153464 2:196586937-196586959 GTGGCATAATATCAGTGGAGTGG - Intronic
944376578 2:199052152-199052174 GGTGCAAATTATCAGTAAATTGG + Intergenic
946498319 2:220218739-220218761 GAAGGAAAATTTCAGAAGATGGG + Intergenic
1169721709 20:8684929-8684951 CAGGACAAATATCAGTGGATGGG + Exonic
1170615706 20:17948435-17948457 CAGGCAAAATAAAATTAGATAGG - Intronic
1170756196 20:19209462-19209484 GAGACCAAATGTTAGTAGATGGG - Intergenic
1174875055 20:54218275-54218297 GAGGCTAAGTATCTATAGATAGG + Intronic
1174942389 20:54943718-54943740 GAGGCAAAACATTTTTAGATAGG + Intergenic
1176251438 20:64122775-64122797 CAGGCAAAACATTATTAGATAGG + Intergenic
1179372551 21:40819774-40819796 GAGGCACAATATGAGTGGAATGG - Intronic
949688613 3:6608208-6608230 GAAAAAAAATCTCAGTAGATGGG - Intergenic
951337200 3:21438217-21438239 GAGGCAAAAAAGTAGTATATGGG - Intronic
952542105 3:34377503-34377525 GGGCAAAAATATCATTAGATAGG + Intergenic
956516560 3:70055367-70055389 GATTAAAAATATAAGTAGATTGG - Intergenic
957779338 3:84798305-84798327 CAGGTAAAATCTCAGAAGATTGG + Intergenic
960010705 3:112831946-112831968 CAGTGAAAATATCAGTAGAAAGG + Intronic
961560819 3:127728392-127728414 GAGGAAAAATAAGAATAGATGGG - Intronic
964069456 3:152614041-152614063 GAGCCAAAGTATCACAAGATGGG + Intergenic
965257845 3:166439550-166439572 GAGACAGCACATCAGTAGATAGG - Intergenic
971572773 4:28234455-28234477 GAGACAAATTATCAGTAAAGTGG - Intergenic
972016979 4:34259628-34259650 GAGGAAAAATATTTTTAGATTGG + Intergenic
974698850 4:65411625-65411647 GAGGAAAAATACCAATAGGTTGG + Intronic
976088708 4:81432801-81432823 GAAGAAAAATATTAGTAGAATGG - Intronic
978273632 4:106921527-106921549 AAGGCAAAATATGACTAAATGGG + Intergenic
981891572 4:149744682-149744704 GACACAAAATATCAGCAAATGGG + Intergenic
983001154 4:162416218-162416240 GAGGCAAAATATTAAGTGATTGG + Intergenic
983744132 4:171173726-171173748 GAGGTAAAATATCTGTATACTGG - Intergenic
983873473 4:172849246-172849268 GAGCCAAAATATCTGAAGAAGGG + Intronic
986936913 5:12900490-12900512 GTGGAAAAATATCAATAGACTGG + Intergenic
987430053 5:17821575-17821597 CTGGAAAAATATCAGAAGATAGG + Intergenic
990050344 5:51492351-51492373 GCAGCAAAATAGCAGTAGAAAGG - Intergenic
992399079 5:76395171-76395193 GAGGCAAAATGGCAGTTAATTGG + Intergenic
992714254 5:79493997-79494019 GAGGCAAGAAATAATTAGATTGG - Intronic
993627941 5:90248400-90248422 GAGGCAAAAAATCAGGAAATAGG - Intergenic
994840390 5:104917158-104917180 TGAGCAAAATATCAATAGATTGG + Intergenic
995863734 5:116668154-116668176 GAGGGACTATATCAGTGGATAGG - Intergenic
999882924 5:155887109-155887131 GGGCGAAAATATCAGTAGAATGG + Intronic
1003967504 6:11266964-11266986 GGAGCAAAGTATCAATAGATGGG + Intronic
1004288709 6:14346990-14347012 GAGGCATAATATCAATACAAAGG - Intergenic
1006278810 6:33029702-33029724 GAGGGAAAATATCAGGGGAAAGG - Intergenic
1009429619 6:63551489-63551511 GAGACAAAATATTTGTACATAGG - Intronic
1012202968 6:96428835-96428857 GAGGCAAAATATCTCTACAAAGG - Intergenic
1013576873 6:111492345-111492367 GATGCAAAATCTCAGAAGCTAGG + Intergenic
1014031996 6:116716696-116716718 GAGGCAAAATATCAGTAGATAGG - Intronic
1015512810 6:134055888-134055910 GTGGAAAAATATCAGAAAATTGG - Intergenic
1017789302 6:157782096-157782118 GGGGGAAACTAACAGTAGATAGG - Intronic
1018266463 6:162029614-162029636 GAGGCAAAATCCCAGCAGAGAGG - Intronic
1020400510 7:7771351-7771373 AAGGTAAAATATCAATATATTGG + Intronic
1020865366 7:13554354-13554376 GAGGCAAAATGGTAGCAGATTGG - Intergenic
1023122972 7:36927895-36927917 GAGTTCAAATATCAGTAAATAGG + Intronic
1024410673 7:49037759-49037781 GAGTCAAAGAATCACTAGATGGG + Intergenic
1024485112 7:49909355-49909377 GAGCCAAAATATGAGTAATTAGG + Intronic
1027990784 7:85358384-85358406 GAAGCAAAATATCACTTAATAGG + Intergenic
1028313493 7:89369447-89369469 CAGGCAACATATGAGTGGATTGG - Intergenic
1032732193 7:134654821-134654843 GAGGCACCATTTCAGTAGAGTGG + Intronic
1033725406 7:144110671-144110693 GAGGAATCATCTCAGTAGATAGG + Intergenic
1034194737 7:149237792-149237814 CAGGCACAATATCAGGACATAGG - Intergenic
1035128043 7:156624748-156624770 GATGCAAAATTTCAGTTAATAGG + Intergenic
1041879554 8:62733872-62733894 GAAGCAAGAAATCAATAGATAGG - Intronic
1041898373 8:62953047-62953069 GAGGCAAAATTACAGTATCTGGG + Intronic
1042015950 8:64311607-64311629 GAAGTAAAAATTCAGTAGATTGG + Intergenic
1042249516 8:66741803-66741825 TAGGCACAGTACCAGTAGATGGG + Intronic
1042456545 8:69011532-69011554 GAGGGAAAATATAAGAAAATCGG - Intergenic
1043339297 8:79218202-79218224 GAGGGGAAATAGCAGAAGATTGG + Intergenic
1044043715 8:87402561-87402583 GAGGCAAAATATCAATTGTGTGG + Intronic
1044811483 8:96068268-96068290 GTGGCAAAATATTACTAGAAGGG - Intergenic
1046480121 8:114805802-114805824 GATGAAAAATCTCAGAAGATGGG - Intergenic
1050867929 9:10527763-10527785 GAGCCATTATATCAGCAGATGGG + Intronic
1051907942 9:22117937-22117959 GACGTAAAATCTCATTAGATTGG - Intergenic
1056207230 9:84331924-84331946 GTGGCAAAATATCTGTGGAGTGG + Intronic
1056422632 9:86444259-86444281 GAGACACAATATCTGTAGAAGGG - Intergenic
1058830902 9:108815434-108815456 CAGGCCAAATATCAGCAGACAGG - Intergenic
1185925307 X:4139418-4139440 GAGGTAAAAGATGAGAAGATTGG - Intergenic
1185955126 X:4480966-4480988 GAAGCAAAATATCACTAGCTAGG + Intergenic
1188387572 X:29580106-29580128 GAGGGAAAATACCAGTAAAAAGG - Intronic
1191182600 X:57579228-57579250 GGGGAAAAATATCAGCACATTGG - Intergenic
1191214994 X:57924447-57924469 GGGGGAAAATATCAGCACATTGG + Intergenic
1191998012 X:67117241-67117263 GAGACAAAATAGAGGTAGATTGG + Intergenic
1194777079 X:97978430-97978452 AAGGCACAACATCAGTAGAAAGG - Intergenic
1197629420 X:128841378-128841400 GAAGCAAAATAACAGTTGTTCGG + Intergenic
1198764889 X:140070463-140070485 GTGGCAAAATATTAGCAGAGTGG + Intergenic
1199276267 X:145946010-145946032 GAGGTCAAATAGCAGTACATTGG - Intergenic
1199728617 X:150608749-150608771 GAGACAAAATTTCAGTTAATAGG - Intronic
1201673197 Y:16549296-16549318 GAGGCATCAGATAAGTAGATAGG + Intergenic