ID: 1014032531

View in Genome Browser
Species Human (GRCh38)
Location 6:116722178-116722200
Sequence ATGTGTTAGCAGACGTGTGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 106}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014032528_1014032531 9 Left 1014032528 6:116722146-116722168 CCTGTCACGACTGTTGTTTAGCA 0: 1
1: 0
2: 23
3: 4
4: 55
Right 1014032531 6:116722178-116722200 ATGTGTTAGCAGACGTGTGTTGG 0: 1
1: 0
2: 0
3: 11
4: 106
1014032527_1014032531 23 Left 1014032527 6:116722132-116722154 CCTTGCTTAAATGTCCTGTCACG 0: 1
1: 0
2: 0
3: 4
4: 64
Right 1014032531 6:116722178-116722200 ATGTGTTAGCAGACGTGTGTTGG 0: 1
1: 0
2: 0
3: 11
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014032531 Original CRISPR ATGTGTTAGCAGACGTGTGT TGG Exonic
900299800 1:1971096-1971118 ATGTGTGTGCACACGTGTGCAGG - Intronic
900953008 1:5868837-5868859 ATGTGTGTGCATGCGTGTGTGGG - Intronic
900978214 1:6030824-6030846 ATGTGTAAGTATATGTGTGTAGG + Intronic
904615968 1:31750047-31750069 TAGTGTTAGCAGATGTGTGGAGG - Intronic
906694643 1:47815750-47815772 ATGTGTGTGCACACATGTGTGGG + Intronic
907640834 1:56188692-56188714 ATGTGTAAGCATGTGTGTGTGGG - Intergenic
908857322 1:68445409-68445431 ATGGTTTAGCAGACCTGTCTAGG - Intronic
910342614 1:86204922-86204944 GTGTGTAAGCATATGTGTGTGGG - Intergenic
910649132 1:89545864-89545886 ATGTTTGAGCAGAGGTGTATAGG + Intronic
911789782 1:101998783-101998805 ATGAATTTGCAGAGGTGTGTTGG + Intergenic
915931174 1:160061872-160061894 GTGTGTTGGGAGCCGTGTGTGGG + Intronic
916415901 1:164591730-164591752 TTCTGTTAGCAGACTTGTGCAGG + Intronic
922907278 1:229183784-229183806 ATGTGTGTGCAGATGTGAGTGGG - Intergenic
1068904399 10:62307119-62307141 ATGTGTTAGCAGCTCAGTGTAGG + Intergenic
1070097627 10:73353340-73353362 ATGTGTTAGTGGAAGTGTGCAGG - Intronic
1070191538 10:74115981-74116003 ATGTGTGAGGAGCCCTGTGTGGG - Intronic
1070823568 10:79377312-79377334 ATGTGTGTGCACATGTGTGTGGG + Intergenic
1071219986 10:83454485-83454507 GTGTGTTTGCATGCGTGTGTGGG - Intergenic
1075738168 10:124676869-124676891 TTGTGTTAGCAGATGTTTGAGGG - Intronic
1076415930 10:130288562-130288584 ATGTGTTGGCAGAGATGTTTTGG + Intergenic
1076778777 10:132712421-132712443 ATGTGTGTGCACGCGTGTGTGGG + Intronic
1077167057 11:1147745-1147767 ATGTGTATGCAGGTGTGTGTGGG + Intergenic
1077281038 11:1746027-1746049 ATGTGTGTGCACAAGTGTGTGGG - Intronic
1080625044 11:34021445-34021467 ATGTGTGTGCACACATGTGTAGG - Intergenic
1081994927 11:47357984-47358006 ATGTGTGAGCAGGTGTGTGTGGG - Intronic
1082717203 11:56628652-56628674 ATGTGTTAGCAGAGTTGAGGTGG + Intergenic
1083686567 11:64379693-64379715 GTGTGTAAGCACAAGTGTGTGGG + Intergenic
1083742921 11:64720658-64720680 GTGTGTTAGCAAACATGTGCTGG + Intronic
1087094033 11:94303446-94303468 ATGTATTGGGAGGCGTGTGTTGG - Intergenic
1089080679 11:115773903-115773925 ATGAGTTGGCTGAGGTGTGTGGG + Intergenic
1094726684 12:33126006-33126028 ATGTGTCAGCAGACTTGGGTAGG + Intergenic
1097474385 12:60035139-60035161 ATGTGGTGGCAGATGTGTGCAGG + Intergenic
1099481267 12:83169396-83169418 AAGTATTAGCAGACATGTGCTGG - Intergenic
1101128821 12:101667783-101667805 ATCTGTTGGCAGACCTGTGATGG - Exonic
1101675828 12:106915305-106915327 AGGTGTTTGCAGAAGTGTGGGGG - Intergenic
1106422324 13:29594914-29594936 ATGTGTCATCAGCCGTGGGTGGG - Intronic
1107920690 13:45203694-45203716 TCGTTTGAGCAGACGTGTGTGGG + Intronic
1108375246 13:49808252-49808274 ATGTGATCGCAGACGTGTAACGG - Intergenic
1109289112 13:60451580-60451602 ATATGTGTGCAGAGGTGTGTTGG - Intronic
1110579915 13:77109691-77109713 ATGAGTTAGCAGACTTGTTGCGG + Intronic
1113935442 13:113991879-113991901 ATGTGTGAGCATGTGTGTGTGGG - Intronic
1115705320 14:35992544-35992566 ATGTGTGAGCAGATGGGCGTAGG + Intergenic
1121648698 14:95539264-95539286 CTGTGTTAGGATACCTGTGTTGG + Intronic
1128389903 15:67175740-67175762 ATGTGTGAGCACAGGTGTGGTGG + Intronic
1131236470 15:90701209-90701231 ATATGTTAGCAGCCTTCTGTTGG - Intergenic
1132088743 15:98930034-98930056 ATGTGTTAGCAAATGTCTGCTGG + Intronic
1132710545 16:1264322-1264344 GTGTGTGTGCATACGTGTGTGGG + Intergenic
1141555575 16:84834621-84834643 ATGTGTTATCTGATGTGTGTTGG + Intronic
1142410590 16:89914009-89914031 GTGTGTGCGCATACGTGTGTGGG + Intronic
1152302479 17:79503348-79503370 ATGTGTTAGCAGACGCTTTTGGG - Intronic
1153151785 18:2104458-2104480 ATGTGTTAACAGAGGTGAGTAGG + Intergenic
1156024410 18:32635284-32635306 ATATGTGAGCAGACGTGAATTGG + Intergenic
1160603964 18:80034823-80034845 TTGTGTTCGTGGACGTGTGTCGG + Intronic
1162715396 19:12628293-12628315 GTGTGTTAGAACACTTGTGTGGG - Exonic
926689778 2:15725328-15725350 ATGGGTCAGCTGACGGGTGTGGG - Intronic
929616950 2:43318176-43318198 ATGTGGTAGCACACATCTGTAGG - Intronic
929880709 2:45835038-45835060 GTGTGTTTGCACACGTGGGTGGG + Intronic
932522009 2:72423686-72423708 ATGTGTGAGTAGATGTTTGTAGG - Intronic
937054357 2:118920070-118920092 ATGTGTTGGCAAAAATGTGTAGG + Intergenic
942308716 2:174634148-174634170 CTGTGTTTGCAGACATCTGTGGG - Intronic
943354180 2:186831341-186831363 ATGTGTATGTATACGTGTGTGGG + Intronic
946168602 2:217880162-217880184 ATGTGTAAGGAGACGTGGGGCGG - Intronic
948017805 2:234704124-234704146 TTGTTTCAGCAGAAGTGTGTGGG - Intergenic
948818095 2:240523739-240523761 ATGTGTGAGCATCCCTGTGTCGG - Intronic
1173419008 20:42884062-42884084 ATGTTTAAGCAGAGGTGTCTTGG + Intronic
1174458901 20:50669150-50669172 ATGTGTGAGCATGCATGTGTGGG - Intronic
1184085238 22:42258348-42258370 AGGTGCGAGCAGAGGTGTGTGGG - Intronic
1184706159 22:46214902-46214924 ATGTGTGATCTGAGGTGTGTGGG + Intronic
1184924352 22:47626597-47626619 CTGTGCCAGCAGACATGTGTGGG - Intergenic
950627058 3:14254984-14255006 ATGTGTTTTAAGGCGTGTGTTGG + Intergenic
952072588 3:29656634-29656656 ACCTGTTAGCAGGTGTGTGTGGG + Intronic
952410579 3:33046538-33046560 AGGTGTTAGCAGATTTTTGTGGG - Intronic
955815180 3:62834644-62834666 ATATGTTAGCAGACATATGTAGG - Intronic
958854561 3:99368868-99368890 ATGTGTCTGCAGAGGTATGTTGG + Intergenic
964388329 3:156172900-156172922 AGGTGTTAGCAAAGTTGTGTGGG - Intronic
967933375 3:194706941-194706963 GTGTGTCAGCAGACGTGTGCTGG - Intergenic
968950051 4:3685958-3685980 ATATGTGTGCACACGTGTGTGGG - Intergenic
974651549 4:64759723-64759745 ATGAGGTAGCAGACGAGTGGAGG - Intergenic
978324394 4:107535592-107535614 ATATGTTAGGAGATGTGTCTTGG - Intergenic
978953177 4:114585801-114585823 ATCTGTTAGCAAAGGGGTGTTGG + Intergenic
980897214 4:138871562-138871584 ATGTGTGTGCATGCGTGTGTAGG + Intergenic
982878605 4:160680517-160680539 TTGTGATATCAGAAGTGTGTTGG + Intergenic
986194339 5:5524363-5524385 ATGTGCTTGTAGACGTGTGTGGG - Intergenic
987170561 5:15253011-15253033 ATGTATTAGGAGAGGTGTGACGG + Intergenic
995741650 5:115362295-115362317 ATGTGTTTCCAGTTGTGTGTGGG + Intergenic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
1001632881 5:173189411-173189433 ATTTCTTAGCAGAGGTGTGCTGG + Intergenic
1001648996 5:173302092-173302114 ATGTGTGAGCATCCGTGTGCTGG + Intergenic
1001822617 5:174721580-174721602 ATCTGCTAGCAGCGGTGTGTTGG + Intergenic
1003467463 6:6394480-6394502 ATCTGTAAGCAGACTTGTTTTGG - Intergenic
1006833003 6:36980148-36980170 AGGTGTGAGCAGATGTCTGTTGG - Intronic
1007098228 6:39227623-39227645 ATTTGCTGGCAGCCGTGTGTGGG - Intronic
1007742653 6:44022238-44022260 ATGTGTCAGCTGATGTGTTTGGG + Intergenic
1009480087 6:64146309-64146331 ATGTGTCACCAGAAGTGTGTGGG + Intronic
1014032531 6:116722178-116722200 ATGTGTTAGCAGACGTGTGTTGG + Exonic
1014172425 6:118293271-118293293 AAGTATTAGCAGAGGTATGTTGG + Intronic
1016912022 6:149208533-149208555 AACTGTCAGGAGACGTGTGTGGG + Intergenic
1017588049 6:155948070-155948092 TTGTGTGAGCAGACAAGTGTGGG - Intergenic
1018638525 6:165885825-165885847 ATGTGTATGCATATGTGTGTTGG + Intronic
1020729259 7:11860996-11861018 ATGTGTGAGTATATGTGTGTAGG - Intergenic
1022417957 7:30194469-30194491 ATGTGTTTGTACAGGTGTGTAGG + Intergenic
1028844786 7:95467602-95467624 ATGTTTTTGCACATGTGTGTAGG - Intergenic
1033982943 7:147188231-147188253 ATGGGTTTGCAGATGTGTGTGGG + Intronic
1035288311 7:157820500-157820522 ATGTGTAAGAATGCGTGTGTTGG - Intronic
1035288316 7:157820592-157820614 ATGTGTAAGAATGCGTGTGTGGG - Intronic
1035432439 7:158832142-158832164 ATGTGTGTGCACACATGTGTAGG + Intergenic
1035538274 8:408753-408775 ATGTGGTAGGACACGTGGGTGGG - Intronic
1046188685 8:110759997-110760019 AAATCTTAGCAGACATGTGTTGG + Intergenic
1046338091 8:112816137-112816159 ATGTCTCAGCAGATGTGTCTTGG + Intronic
1049508891 8:143018141-143018163 ACGGGTGAGCAGACGTGTTTGGG - Intronic
1050735769 9:8761058-8761080 ATGTGTCAGCAGATGACTGTGGG + Intronic
1050997157 9:12234807-12234829 AAATGTTAGCAGTTGTGTGTGGG + Intergenic
1052171636 9:25405056-25405078 ATTGCTTAGCAGACTTGTGTGGG - Intergenic
1189746614 X:44174819-44174841 ATTTGCTAGCAGCCGTGTGAGGG - Intronic
1192780070 X:74284898-74284920 ATGTGTAAGCAGATCTGTGCAGG - Intergenic
1195868374 X:109458280-109458302 ATCTGGTAGCAGACTTGGGTTGG + Intronic
1197734361 X:129839813-129839835 ATGTGTTAGCAGAGGAGTGGAGG - Intronic
1200068286 X:153515403-153515425 ACCTCTTAGCAGACATGTGTGGG - Intergenic