ID: 1014035717

View in Genome Browser
Species Human (GRCh38)
Location 6:116765257-116765279
Sequence TGCAGCGAAAGCAACCCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 153}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014035713_1014035717 10 Left 1014035713 6:116765224-116765246 CCTGCGCTGCGTGGGGACTCGGT 0: 1
1: 0
2: 0
3: 12
4: 168
Right 1014035717 6:116765257-116765279 TGCAGCGAAAGCAACCCAGATGG 0: 1
1: 0
2: 0
3: 10
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014035717 Original CRISPR TGCAGCGAAAGCAACCCAGA TGG Intronic
903398300 1:23019638-23019660 TGCAGCGGCAGCAACCGGGACGG + Exonic
904968273 1:34397890-34397912 TGCACCTGAAGCAAACCAGATGG + Intergenic
907509591 1:54948290-54948312 TGCAGAGAAAGGACCCAAGAGGG + Intergenic
908363457 1:63392819-63392841 TGCCCTTAAAGCAACCCAGAAGG - Intronic
908809276 1:67962814-67962836 TGCAGGGACAGAAGCCCAGATGG + Intergenic
911377142 1:97064571-97064593 TGAAATCAAAGCAACCCAGATGG + Intergenic
913157114 1:116110739-116110761 AGCAGGGAAAGCAACCAACAGGG - Intergenic
917601100 1:176574697-176574719 TGCAGAAAAAGTAACCCACAGGG - Intronic
920658794 1:207897885-207897907 TGGAGAGAAAACAACCCAAATGG - Intronic
920789963 1:209080604-209080626 TGCATGGAATGCAAACCAGAAGG - Intergenic
920985492 1:210885156-210885178 TGCAGCAAGATCAACGCAGAAGG + Intronic
923645079 1:235811723-235811745 GACAGGGAAAGCAAACCAGATGG + Intronic
1064355955 10:14618172-14618194 TGAAGTGAAAGCAGCCCTGAAGG - Intronic
1064910287 10:20393934-20393956 TGCAGCTAAAAGAAACCAGATGG + Intergenic
1068951473 10:62782050-62782072 TCCAGCGAGATCAACACAGAAGG + Intergenic
1073575399 10:104618609-104618631 TGCAACGAGAGAAACCCATAAGG - Intergenic
1076146474 10:128126243-128126265 TGCAGCGAACGCGACCCCGCGGG - Exonic
1077314692 11:1913482-1913504 TGCAGCTAAAACAAGACAGAGGG - Intergenic
1080115115 11:28613365-28613387 TGCCACGAAAGAAACCCAGAAGG - Intergenic
1081526293 11:43930029-43930051 CGCAGAGAAAGCAACAGAGAAGG + Intronic
1082106032 11:48222803-48222825 TGCTGGGAAAGGAACCAAGAGGG - Intergenic
1083213279 11:61202721-61202743 TGCACCAAAAGCAAGCCACAAGG + Intergenic
1083216158 11:61221466-61221488 TGCACCAAAAGCAAGCCACAAGG + Intergenic
1083219042 11:61240292-61240314 TGCACCAAAAGCAAGCCACAAGG + Intergenic
1085829711 11:79886456-79886478 TTCAGAGAAAGAAATCCAGAGGG - Intergenic
1087497387 11:98908331-98908353 TCCTGTGAAAGCAGCCCAGAGGG + Intergenic
1088979594 11:114850174-114850196 TGCAGCCAAAGCAAGTCAAATGG + Intergenic
1090259847 11:125311494-125311516 TGCTGTGAAAGCCCCCCAGAAGG + Intronic
1090804921 11:130196911-130196933 TGCTGGGACTGCAACCCAGAAGG - Intronic
1092060451 12:5546417-5546439 TGCAGTGCCAGCACCCCAGATGG - Intronic
1097876002 12:64644077-64644099 TGCAGGGATAGTAAGCCAGATGG + Intronic
1099296910 12:80839653-80839675 TGAAGCTACAGCATCCCAGAGGG - Intronic
1100145065 12:91667723-91667745 AGCAGCTAAATGAACCCAGATGG - Intergenic
1108214229 13:48168200-48168222 TGCAGAGAAATAAACCCAAAAGG + Intergenic
1108234941 13:48393997-48394019 GCCAGCGAGATCAACCCAGAAGG + Intronic
1108236730 13:48416177-48416199 CCCAGCGAAATCAACGCAGAAGG + Intronic
1109902898 13:68796274-68796296 CCCAGCAAAATCAACCCAGAAGG - Intergenic
1110573578 13:77031564-77031586 TGCAGAGAAAGGACCCCAGACGG + Intergenic
1111351995 13:87043387-87043409 TCCAGCGAGATCAACGCAGAAGG + Intergenic
1111529692 13:89520679-89520701 TGCAGAGAAGAGAACCCAGAAGG + Intergenic
1116388189 14:44358683-44358705 TGCAGCTAGAGCAAACCAGGTGG - Intergenic
1116432661 14:44865182-44865204 TGCAGTGACAGTAACCCAAAGGG - Intergenic
1126375381 15:47991909-47991931 TGAAGCAAAGGCAAACCAGAAGG + Intergenic
1129836136 15:78707753-78707775 TGCAGGGACAGCAACTAAGAAGG + Intronic
1133290813 16:4719832-4719854 TGCAGAAAAAGAAACCCAAATGG + Intronic
1135016765 16:18930113-18930135 TGCAGGGAAGGCATTCCAGATGG - Intergenic
1135322400 16:21505966-21505988 TGCAGGGAAGGCATTCCAGATGG - Intergenic
1136333877 16:29599096-29599118 TGCAGGGAAGGCATTCCAGATGG - Intergenic
1141666420 16:85467931-85467953 TGCATCGAAAGCTACACAGAGGG + Intergenic
1141753680 16:85976944-85976966 TGGAGGGAAGGAAACCCAGAAGG - Intergenic
1142686714 17:1581374-1581396 TGCAGAGAAAGCAGCCCAGGAGG + Intronic
1149537931 17:57446792-57446814 TGCAGCAGAAGGAACCCACACGG + Intronic
1150877858 17:68989508-68989530 TGCAGCGAATACTACACAGAAGG - Intronic
1151099124 17:71535603-71535625 TGAAGAGGAAGCAAACCAGATGG - Intergenic
1151703314 17:75754462-75754484 TTAAGCAAAAGCCACCCAGAGGG + Intronic
1152414199 17:80148142-80148164 TGCAGCAAAGATAACCCAGACGG + Intergenic
1152768900 17:82155712-82155734 TGCTGGGAAAGGAGCCCAGACGG - Intronic
1153505253 18:5790181-5790203 TGCAGCAAGATCAACACAGATGG - Intergenic
1153717953 18:7869591-7869613 TCCAGCGAGATCAACACAGAAGG - Intronic
1155864288 18:30945151-30945173 TGCATCCAAAGCATCCCAGAAGG + Intergenic
1158373072 18:56831580-56831602 CCCAGCGAGACCAACCCAGAAGG + Intronic
1160125901 18:76171203-76171225 TGCAGAGAACGCTACCCACATGG + Intergenic
1160324015 18:77924724-77924746 TGCAGAGAAAGGAACTGAGAAGG + Intergenic
1161763084 19:6188677-6188699 TGCAGGGAAGCCAACCGAGATGG + Intronic
1163849469 19:19655079-19655101 TGCAGCAAAGGTCACCCAGATGG - Intronic
1164528523 19:29029463-29029485 TGCAGAGAAAGAGATCCAGAGGG + Intergenic
1165221072 19:34317169-34317191 TGCTGGGAAAGGAACACAGACGG - Intronic
1166868934 19:45858852-45858874 TGGAGAAAAAGCAACACAGATGG - Intronic
926017023 2:9462261-9462283 TGAAGAGAAAGCAACCCTGGTGG - Intronic
926782277 2:16484362-16484384 TGCTGTGAAAGCCACCCTGAAGG - Intergenic
927578796 2:24223135-24223157 TGTAGCTAAGGCAACCAAGAAGG + Intronic
928241580 2:29591421-29591443 AGCACCGAAAGCAAGACAGAGGG + Intronic
929715475 2:44305234-44305256 ATCAGGGAAAGCAACCCTGATGG - Intronic
931197354 2:60064991-60065013 TGCAGCAAAAGCAACCTCCAGGG - Intergenic
931954015 2:67397650-67397672 TGCAGTAAAAGTAACCCCGAGGG + Exonic
934763298 2:96867957-96867979 GCCAGAGAAAGCAAACCAGAGGG + Intronic
935378881 2:102429719-102429741 TGCAGCGAAAGCAGTCCTGAGGG - Intronic
937825142 2:126360650-126360672 GGCAGGGAAAGAAAGCCAGAAGG + Intergenic
943282266 2:185950671-185950693 CCCAGCGAGATCAACCCAGAAGG - Intergenic
943542048 2:189228154-189228176 TGCAGCAAAAGCAATTCTGAAGG + Intergenic
944155319 2:196601539-196601561 TGCAGTCCAGGCAACCCAGATGG - Intergenic
945628344 2:212238472-212238494 TCCAGCGAGATCAACACAGAAGG - Intronic
946864771 2:224032859-224032881 TGCACAGAAAGAATCCCAGAAGG + Intronic
1173322006 20:41997085-41997107 AGCAGCCAAAGAAACTCAGAAGG - Intergenic
1174963984 20:55190083-55190105 TTGAGCGAAAGCAGCTCAGATGG + Intergenic
1175220848 20:57415494-57415516 TGCAGCAGAAACAACTCAGAGGG + Intergenic
1176413458 21:6461322-6461344 TGCAGGGAGAGCTACCCTGAAGG + Intergenic
1178196289 21:30348443-30348465 TGCAGAGAGAGGAACCCAGCTGG + Exonic
1179688955 21:43069645-43069667 TGCAGGGAGAGCTACCCTGAAGG + Intronic
1180613870 22:17114904-17114926 TGGAGAGAAAGCAGCCCTGAAGG + Exonic
1181169754 22:21001463-21001485 TGCTGCCCAAGCACCCCAGAGGG + Intronic
1182938661 22:34252629-34252651 TGCAGCTAAAGCAATGCTGAGGG - Intergenic
1183928514 22:41223001-41223023 GGCAGGGAAGGCAGCCCAGAGGG + Intronic
1184670725 22:46011233-46011255 GGCAGAGAAAGCAACCGAGCGGG + Intergenic
951795581 3:26534389-26534411 CCCAGCGAGATCAACCCAGAAGG - Intergenic
954259736 3:49429826-49429848 AGCAGTGAAAGAAACCCAAAGGG - Intergenic
955399425 3:58581073-58581095 TCCAGGGAAAGCCACACAGAAGG - Intronic
957699932 3:83696074-83696096 TGCAGCAAAAGCAGCCCTAAGGG + Intergenic
957779908 3:84805638-84805660 TGCAGGCCAAGCAACCCAGTTGG - Intergenic
961646754 3:128396936-128396958 GGCACTGAAAGCAGCCCAGATGG - Intronic
963437876 3:145294740-145294762 TGCAGATAAAGAAACACAGATGG - Intergenic
964089563 3:152858232-152858254 TGGTGCCTAAGCAACCCAGAAGG + Intergenic
964133163 3:153313779-153313801 TGCAGAGAAAGATTCCCAGATGG - Intergenic
966273696 3:178140249-178140271 AGCAGCGGAGGGAACCCAGAGGG + Intergenic
967887165 3:194341240-194341262 TGCACCTACAGCAACCCCGAGGG - Exonic
968256710 3:197280832-197280854 TGCAGCTGTAGCAACACAGAAGG - Intronic
976846445 4:89493528-89493550 TCCTGGGAAAGCAACCCAGTAGG + Intergenic
977084534 4:92576539-92576561 TGCAGCTCAAGCAAGGCAGAAGG - Intronic
979040761 4:115790360-115790382 TGCAGCAAAAGCAACCCTAAGGG - Intergenic
980835539 4:138187259-138187281 TGAAGGGAAACCAACCTAGAAGG - Intronic
984469495 4:180149079-180149101 GGCAGGGATAGCAACACAGAAGG + Intergenic
984635111 4:182101968-182101990 TGCAGCCTAAGCATCCCAGAGGG + Intergenic
996090476 5:119346216-119346238 TGCTGCAAAATCAACCGAGAGGG + Intronic
997877408 5:137561601-137561623 TGCATGGAAAGTAACCCACAGGG + Intronic
999626880 5:153530431-153530453 TGCAGGGCAAGAAACCAAGATGG - Intronic
1001571599 5:172733796-172733818 TGCAGCCACAGCATTCCAGAGGG + Intergenic
1001635850 5:173209778-173209800 TACAGAGCAAGCAACCCAGTAGG - Intergenic
1001858481 5:175033037-175033059 TGCAGCCAAAGCAACCCCTTTGG - Intergenic
1004306448 6:14505911-14505933 TTCAGAGGAAGCAGCCCAGAGGG - Intergenic
1006116042 6:31776721-31776743 TGCAGCAGAAGCAACGCTGAGGG + Exonic
1007298028 6:40843333-40843355 TGCAGACAAGGAAACCCAGAGGG + Intergenic
1011311328 6:85982568-85982590 TGCAGCGAAAGCAGTTCTGAGGG - Intergenic
1012803136 6:103860301-103860323 TGCAGTGCAATCAAGCCAGAAGG + Intergenic
1012983217 6:105851530-105851552 TGCCCCCAAAGCAACGCAGATGG + Intergenic
1014035717 6:116765257-116765279 TGCAGCGAAAGCAACCCAGATGG + Intronic
1015178948 6:130341121-130341143 TGCTGTGAAAGAAACACAGAGGG + Intronic
1015407052 6:132849609-132849631 TGCAGCCACAGCAACCTAGGAGG + Intergenic
1016165003 6:140930468-140930490 TCCAGAGGATGCAACCCAGATGG - Intergenic
1017571900 6:155754191-155754213 TGTAGAGAAAGGAACCCAGTGGG + Intergenic
1021412565 7:20345036-20345058 TAGAGAGAAAGAAACCCAGATGG + Intronic
1022343850 7:29494522-29494544 TGCAGAGAATTCATCCCAGAAGG - Intronic
1022879420 7:34570460-34570482 TCCTGGGAAAGCAACCCAGCGGG + Intergenic
1028213679 7:88106170-88106192 TACAGGGAATGGAACCCAGAAGG - Intronic
1040968912 8:53112887-53112909 CCCAGCGAGATCAACCCAGAAGG - Intergenic
1041323415 8:56637712-56637734 CCCAGCGAGATCAACCCAGAAGG - Intergenic
1048569646 8:135640937-135640959 TGCTGTGAAAGCAATTCAGATGG + Intronic
1049027803 8:140008414-140008436 TGCAGAGAAAACAGCCCAGTCGG - Intronic
1049429981 8:142557436-142557458 TGCACACATAGCAACCCAGATGG - Intergenic
1051365009 9:16315809-16315831 TTCTGCCAAAGGAACCCAGATGG - Intergenic
1051423904 9:16915479-16915501 TGCAGAGACAGGAACCCAGAGGG - Intergenic
1055908283 9:81318442-81318464 TGGGGCGACAGAAACCCAGAGGG - Intergenic
1058734696 9:107883566-107883588 TGCAGAGACAGCAACCTGGAAGG + Intergenic
1059088742 9:111334044-111334066 ACCAGCGAGATCAACCCAGAAGG + Intergenic
1059777551 9:117490807-117490829 TGCAGCCAAAGCACCCCACAGGG + Intergenic
1061980785 9:134102320-134102342 GGGAGGGAAAGCAACCTAGAGGG - Intergenic
1062428358 9:136516325-136516347 TGTAGCCATAGCAACCCAGTCGG - Intronic
1062606190 9:137349910-137349932 TGCAGCGAAACCACCCCCGGGGG + Intronic
1186281262 X:7995412-7995434 TGCAGCCAAAGGAACCCGAAAGG - Intergenic
1186298787 X:8176875-8176897 TGCTGCCAAATAAACCCAGAGGG - Intergenic
1186332813 X:8554193-8554215 TCCAGCGAGAACAACACAGAAGG + Intronic
1186515868 X:10165672-10165694 TTTAGCCAAATCAACCCAGAAGG - Intronic
1186779605 X:12899648-12899670 TGCAGGGGAAGCAACCTAGTCGG + Intergenic
1186935102 X:14441255-14441277 TGCATATAAAGAAACCCAGAAGG + Intergenic
1188761653 X:34039922-34039944 TGCAGCAAAAACAAAGCAGATGG + Intergenic
1193574390 X:83181690-83181712 TTCAGGGAAAAGAACCCAGAAGG - Intergenic
1194961154 X:100236875-100236897 CCCAGCGAGATCAACCCAGAAGG - Intergenic
1196319868 X:114273540-114273562 TGCAAAGAAAGAAACCAAGATGG - Intergenic
1196752178 X:119127953-119127975 TCCAGCAAAGGCGACCCAGAAGG - Intronic
1197104354 X:122696011-122696033 TGCAGCAAAAGCAACCTTAAAGG + Intergenic
1197906146 X:131428010-131428032 TGCAGCGAGATCAATACAGAAGG + Intergenic
1199718630 X:150525694-150525716 TGCAGCCACAGCCACTCAGAAGG - Intergenic
1199876107 X:151929658-151929680 TGCAGTGAAAGCGATCCAGGTGG + Intergenic
1200580272 Y:4941601-4941623 CCCAGCGAGATCAACCCAGAAGG + Intergenic
1201302906 Y:12525614-12525636 TGCTGGGAAAGCAATGCAGAAGG + Intergenic