ID: 1014045702

View in Genome Browser
Species Human (GRCh38)
Location 6:116883347-116883369
Sequence GAGTGGTAGAAGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 941
Summary {0: 1, 1: 0, 2: 5, 3: 71, 4: 864}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014045702 Original CRISPR GAGTGGTAGAAGAGGGAAGA GGG (reversed) Intronic
900407794 1:2500083-2500105 GGGGGGTAGTAGAGGGGAGAGGG - Intronic
901300452 1:8196565-8196587 GAGAGGGAGAAGAGGGAGGCAGG - Intergenic
901510921 1:9717692-9717714 GAGGGGTAGCAGAGGAAGGAGGG + Intronic
901636067 1:10670762-10670784 GTGAGGTAGAGGAGGGAGGAGGG - Intronic
901740338 1:11338069-11338091 GAGGGGGAGGAGAGGGAGGAGGG - Intergenic
901741453 1:11344731-11344753 GAATGGCAGAGGAGGGATGAGGG + Intergenic
902038285 1:13473478-13473500 GAGTGGGAGAGTAGGAAAGAAGG + Intergenic
902079165 1:13809361-13809383 CAGTGGTAGAAGAGGAAGGAAGG + Intronic
902306480 1:15543456-15543478 GAGTGGAAGAAGAGGGCATGGGG + Intronic
902783932 1:18721100-18721122 GAGTGGGAGAAGAGGCTGGAGGG - Intronic
902801479 1:18832801-18832823 GAGGGGTATAGAAGGGAAGAGGG - Intergenic
902901322 1:19518302-19518324 GAGGGGTAGAAAATGAAAGAGGG + Intergenic
903834598 1:26195179-26195201 TGGTGGGAGAAGAGGGATGAGGG - Intronic
904040308 1:27580422-27580444 GAGCAGGAGAAAAGGGAAGAGGG - Intronic
904340360 1:29830175-29830197 GGGTGGAGGAAGGGGGAAGAAGG + Intergenic
904376426 1:30085198-30085220 GTGTGGGAGATGAGGAAAGAAGG - Intergenic
904455864 1:30647733-30647755 GGGTGGAGGAAGGGGGAAGAAGG - Intergenic
904601087 1:31672945-31672967 GAGTGTGGGAGGAGGGAAGACGG - Intronic
905038260 1:34930685-34930707 AAAAGGTAGAGGAGGGAAGAGGG - Intergenic
905873827 1:41419597-41419619 GAGGGGTAGAGAAGGGAAGGAGG - Intergenic
906764803 1:48418856-48418878 GAGGGGAAGGAGAGGGAGGAAGG + Intronic
907238182 1:53065516-53065538 GAATGGAGGAAGAGGTAAGAAGG - Intronic
907850645 1:58251673-58251695 GAGAGGTTGAAGAGGGAGGCTGG + Intronic
907924872 1:58946021-58946043 GACTGCTAGATGAGGGAGGAAGG - Intergenic
907933310 1:59019790-59019812 GAGTGGCAGGAGAGTGAGGATGG + Intergenic
907988978 1:59560789-59560811 GTGTGGTGGAAGTAGGAAGAAGG + Intronic
908287310 1:62621136-62621158 GAGAGGAAGAAGAGGGAGGAAGG + Intronic
908376607 1:63548585-63548607 AAGTGGAAGAAGAAGAAAGAGGG - Intronic
908571868 1:65419897-65419919 GAGAGGCAGGAGAGGGAAGGAGG - Intergenic
908792985 1:67801902-67801924 AAGTGGAAGAAAAGGGAGGAAGG + Intronic
910964294 1:92792676-92792698 GAGGGACAGAAGAAGGAAGATGG - Intergenic
911358090 1:96846003-96846025 GAGGGGGAGGAGAGGGAAGTGGG - Intergenic
911995696 1:104763182-104763204 GCGGGTTAGAAGAGGGAGGAAGG - Intergenic
912560518 1:110548271-110548293 GAGGGGCAGAAGTGGGAAGGTGG - Intergenic
912647838 1:111411736-111411758 GGGTGGGAGAAGTGGGAGGAGGG + Intergenic
912706787 1:111920664-111920686 GAGTGGATGAGGAGGGAAGTAGG - Intronic
912713573 1:111966436-111966458 GGGTGGTAGGAGACAGAAGAAGG + Intronic
912770296 1:112457262-112457284 GAGTGGTAGCAGATGGAGAAGGG - Exonic
913498289 1:119448151-119448173 GAGTGATTGAAGAGAGATGAGGG + Intergenic
913705414 1:121417036-121417058 GTGAGGTGGAAGAAGGAAGACGG - Intergenic
914910801 1:151784702-151784724 GTGAGGTAGAACAGAGAAGAGGG - Intronic
914955935 1:152162494-152162516 GACTACTAGAAGGGGGAAGAAGG - Intergenic
915508784 1:156374397-156374419 GAGTGGGGGAAGGGGGAATAGGG - Intronic
915518479 1:156427909-156427931 GAGTGTTAGAAGTGGGGAGGGGG - Intronic
915525527 1:156473798-156473820 GGAAGGAAGAAGAGGGAAGAAGG - Intronic
915690370 1:157682879-157682901 GAGTGGAAGAATGAGGAAGAAGG + Intronic
915816942 1:158977499-158977521 GAATGTGAGAAGAGGGAATATGG - Intergenic
915923714 1:159999336-159999358 GAGAGGTTGAGGAGAGAAGAGGG - Intergenic
916188769 1:162158885-162158907 AAGTGAGAGAAGAGGGAATATGG + Intronic
916189919 1:162168655-162168677 GAGAGGAAGAAAAGGGGAGAAGG - Intronic
916961992 1:169897598-169897620 GAGTAGATGAAGAGTGAAGAGGG - Intergenic
917017003 1:170543424-170543446 GGGCAGGAGAAGAGGGAAGAAGG + Intronic
917139269 1:171818489-171818511 GAGTGGGAGGAGAGTGAAGTGGG - Intergenic
917238133 1:172916895-172916917 GGGTGATGGAAGATGGAAGATGG - Intergenic
917505190 1:175621035-175621057 GAGCGATAGCAAAGGGAAGAGGG - Intronic
918129831 1:181617601-181617623 GAGTGATGGAGGTGGGAAGAAGG - Intronic
918267739 1:182861518-182861540 TAGTGGTAGAAGGGAGAGGAAGG - Intronic
918522954 1:185434965-185434987 GAGAGGGAAGAGAGGGAAGAGGG - Intergenic
919196928 1:194298022-194298044 AAGGAGAAGAAGAGGGAAGAAGG + Intergenic
919230658 1:194769101-194769123 GAGTCGGGGAAGTGGGAAGAAGG + Intergenic
919812346 1:201417051-201417073 GACTGGTAAAAGTGGGAAGGTGG - Intronic
919930230 1:202216624-202216646 GAGAGGTAGTAGAGAGCAGAGGG + Intronic
920184548 1:204151924-204151946 GAGTGGTAGAGGAGGGGCCAGGG + Exonic
920379301 1:205526541-205526563 GAGTGGGAGTAGTGGGATGAGGG + Intronic
920487106 1:206381210-206381232 GAGTGGGGGATGGGGGAAGAAGG - Intronic
920948789 1:210553800-210553822 GAGAGGAAGAGGTGGGAAGAGGG - Intronic
921066839 1:211629321-211629343 GAATGGTGAAAAAGGGAAGATGG + Intergenic
921183019 1:212646188-212646210 GAGTGGGAGAAGGGGGCGGAGGG - Intergenic
921297313 1:213716617-213716639 GAGCTGTAGAAGTGTGAAGAAGG - Intergenic
921315758 1:213888578-213888600 GAAGGGGAGAAGAGGGGAGAGGG + Intergenic
921599130 1:217088871-217088893 GAGGGGTAGAAGGAGGTAGATGG + Intronic
921881916 1:220265336-220265358 GGTTGGTAAAAGAGGCAAGAAGG + Intronic
922022131 1:221716036-221716058 GAAGGGTAGAAGAGGGGAGATGG - Intronic
922970103 1:229729015-229729037 GGAATGTAGAAGAGGGAAGAGGG - Intergenic
923180762 1:231516993-231517015 GAGTGTTAGACGAGGGAAAGGGG - Intergenic
923226019 1:231939660-231939682 GCTTGGAAGAAGAGGGAGGATGG - Intronic
923342807 1:233022043-233022065 GAGTGGGAGAGAAGGGAGGAGGG - Intronic
923438079 1:233987713-233987735 GAGAGAGAGAAGAGGGAAAATGG - Intronic
923482378 1:234397318-234397340 GAGTGGGAGGAGAGGGAGGAGGG + Intronic
923538166 1:234869105-234869127 AAGTGCCAGAAGTGGGAAGATGG - Intergenic
923581763 1:235223756-235223778 AAGTGGTAGAGGAGGTAACAGGG + Intronic
924067159 1:240235823-240235845 CAGAGGAAGAAGAGGGGAGATGG - Intronic
924795162 1:247287613-247287635 GAGGGTTTGAAGGGGGAAGAGGG - Intergenic
924853205 1:247851570-247851592 GAGTGGTAGACAAGGTCAGAGGG + Intergenic
1063524077 10:6768012-6768034 GTGTGGTGGAAGAGGGAGGTGGG + Intergenic
1063986135 10:11504891-11504913 GAGTGGTAAAAGAAGGATGGTGG + Intronic
1064275796 10:13903776-13903798 TAGAGGCAGAAGTGGGAAGATGG + Intronic
1064469605 10:15622276-15622298 GAGAGTGAGAAGTGGGAAGAAGG - Intronic
1064627243 10:17273848-17273870 GAGAGGAGGAGGAGGGAAGAAGG - Intergenic
1064643435 10:17436857-17436879 GGGTGGCAGACAAGGGAAGAGGG - Intronic
1064714293 10:18160749-18160771 AAGTGACAGAATAGGGAAGAGGG - Intronic
1064766784 10:18683299-18683321 GAGAGGTCGAAGCGGGCAGATGG - Intergenic
1065170504 10:23022695-23022717 TAGGGGTAGAAGGGGGAAAAGGG - Intronic
1065354050 10:24821740-24821762 GAGAGGCTGAAGTGGGAAGATGG + Intergenic
1065617933 10:27547770-27547792 GGGTGGTAGAAGAAGGAAGCAGG + Intergenic
1066107019 10:32165248-32165270 GAGTGGGAGGAGAGGGAGGCTGG + Intergenic
1066276614 10:33875196-33875218 GAGTGGGAGGAAGGGGAAGAGGG + Intergenic
1067716630 10:48695429-48695451 GAGTGCTGGAAGAGGGAACCTGG + Intronic
1067856601 10:49799057-49799079 CAGTGACAGAAGAGGGAGGAGGG - Intergenic
1068631469 10:59303057-59303079 GAGTGGTAGGAGAGGGGACCAGG - Intronic
1069646352 10:70001342-70001364 GAGTGGGAGCTGAGGGAAGGGGG - Intergenic
1070079985 10:73176507-73176529 AAGTAATAGAACAGGGAAGATGG + Intronic
1070271961 10:74965240-74965262 GAGGGGAAGAGCAGGGAAGATGG - Intronic
1070381226 10:75882150-75882172 GAGTGGTTGTTGAAGGAAGACGG + Intronic
1070444615 10:76484153-76484175 GAGAGGAAGAAGAAGGAGGATGG - Intronic
1070566940 10:77610719-77610741 GACTGGGAGCAGAGGGAATAGGG + Intronic
1070692699 10:78539355-78539377 GCATGGGAGAACAGGGAAGAAGG - Intergenic
1071009431 10:80920434-80920456 GGCTGGTAGACAAGGGAAGATGG - Intergenic
1071229785 10:83572110-83572132 GAGAGGAAAGAGAGGGAAGAAGG + Intergenic
1071264497 10:83952873-83952895 AAGAGTGAGAAGAGGGAAGAGGG + Intergenic
1071531297 10:86391991-86392013 GAGAGGGAGCAGAGGGAAGCAGG + Intergenic
1071813198 10:89205886-89205908 GACTGATAAAAAAGGGAAGAGGG - Exonic
1071887084 10:89963088-89963110 AATTTCTAGAAGAGGGAAGAGGG + Intergenic
1072448765 10:95522027-95522049 GAGTGGTAGAAAAGTGAAAATGG + Intronic
1072637328 10:97186216-97186238 GGATGGGAGAAGAGGGAAGGGGG + Intronic
1072702189 10:97650675-97650697 GAGATGGAGAAGAGGGAAAAAGG + Intronic
1072723222 10:97793688-97793710 GAGAGGAAGAAAGGGGAAGAAGG - Intergenic
1072839102 10:98750737-98750759 GATTGGGAGAAGAGAGAAGAAGG + Intronic
1072911808 10:99508872-99508894 GAGTGGGAGAAGGAGGAGGATGG - Intergenic
1073025361 10:100483397-100483419 CAGAGGTTGAAGATGGAAGAGGG + Exonic
1073073861 10:100811130-100811152 GAGAGGTGGGGGAGGGAAGATGG + Intronic
1073304497 10:102492376-102492398 TGGTGGTAGAAGAGTTAAGAAGG - Intronic
1073605756 10:104894238-104894260 TAGTGTTAGAGGAGGGAAAAAGG + Intronic
1073816190 10:107209973-107209995 GTGGGGGAGAAGAGGGGAGAGGG + Intergenic
1074629829 10:115239940-115239962 GAGTGGGAGTTGAGGGATGAAGG + Intronic
1074704415 10:116118466-116118488 CAGTGGTTGAGGTGGGAAGAAGG - Intronic
1074799371 10:116983830-116983852 GAATGGAAGAAAAAGGAAGATGG + Intronic
1074995911 10:118756861-118756883 GAGAGGTAGAAGAGAAGAGAAGG + Intergenic
1075627369 10:123972631-123972653 GAGAGGTGGAGGAGCGAAGAGGG + Intergenic
1075845540 10:125542390-125542412 GTGAGGGAGAAGAGGGAAGCTGG - Intergenic
1076166504 10:128286720-128286742 GAGCGGGAGAAGAGGGACAAGGG - Intergenic
1076318862 10:129564169-129564191 GAGTGGAAGAAGAAGGGAGGGGG - Intronic
1076318930 10:129564336-129564358 GAAGGGGAGAAGAGGAAAGAGGG - Intronic
1076532457 10:131154129-131154151 GACAGTTAGAAGAGGGAATATGG - Intronic
1076643859 10:131937851-131937873 GAGTGGTAGGAGAGGGTCAAAGG + Intronic
1077531312 11:3096954-3096976 GAGGAGGAGAAGAGGAAAGAGGG + Intronic
1077531322 11:3096986-3097008 GAGGAGGAGAAGAGGAAAGAGGG + Intronic
1077531334 11:3097018-3097040 GAGGGGGAGGAGAGGAAAGAGGG + Intronic
1078211048 11:9269692-9269714 GATTGGTGGAAGATGGTAGAAGG + Intergenic
1078276167 11:9849568-9849590 GAATGGAATAAGAGGGAAGTGGG + Intronic
1078875398 11:15389779-15389801 AAGTGGTAAAAGTGGGAAGTGGG + Intergenic
1078919677 11:15817861-15817883 GATGGGAAGAAGATGGAAGAGGG - Intergenic
1079245754 11:18751038-18751060 GAGTGGTGGAAGAGTCTAGAAGG + Intronic
1079389551 11:20009720-20009742 GTGTGGTTGAAGAGAGGAGAAGG - Intronic
1080005827 11:27405372-27405394 GGGTAGAAGAAAAGGGAAGAAGG - Intronic
1080103760 11:28490032-28490054 GAATAGAAGGAGAGGGAAGAAGG + Intergenic
1080114569 11:28607226-28607248 GAGGGGGAGAGGAGGGAGGATGG - Intergenic
1080146481 11:28991152-28991174 GGGTGGTAGGAGGGAGAAGATGG - Intergenic
1080249683 11:30219032-30219054 GAAGGGTAGAAAAGGGAAGCTGG - Intergenic
1080751615 11:35155826-35155848 GTGCAGTAGAAAAGGGAAGACGG - Intronic
1080944044 11:36951031-36951053 GAATTGTAAAAGTGGGAAGAGGG + Intergenic
1081625823 11:44654529-44654551 GAATGGAGGAAGGGGGAAGATGG - Intergenic
1081641276 11:44755982-44756004 GAGAGATGGAGGAGGGAAGAGGG + Intronic
1082069905 11:47930913-47930935 GAGTTGAAGAAGGAGGAAGAAGG - Intergenic
1083157815 11:60836117-60836139 AAGAGGTACAACAGGGAAGAGGG - Intergenic
1083332865 11:61907101-61907123 GGCTGGGAGGAGAGGGAAGAAGG + Intronic
1083735540 11:64678232-64678254 GATGGGGAGGAGAGGGAAGAGGG - Intronic
1083884912 11:65568310-65568332 CAGTGGGAGAAGAGGGATGCAGG + Intergenic
1083887727 11:65581031-65581053 GAATGGTAGGAGAGGGGAGAAGG - Intronic
1084175380 11:67419994-67420016 GGGTTGCAGGAGAGGGAAGACGG - Intronic
1084596154 11:70118190-70118212 GAGGGGGAGGAGGGGGAAGAGGG - Intronic
1085056299 11:73406078-73406100 GTGGGGAAGGAGAGGGAAGAAGG - Exonic
1085313810 11:75531421-75531443 GAGGGGAAGAAGAGGACAGAGGG + Intergenic
1085542953 11:77289379-77289401 GAGGGGAAAAGGAGGGAAGACGG + Intronic
1085753980 11:79188718-79188740 GAGCAGTAGAAAAGGGAGGAGGG + Intronic
1085951537 11:81338339-81338361 GTATGGCAAAAGAGGGAAGAGGG + Intergenic
1086353117 11:85963645-85963667 GAGTAGTGGAGGAGGGGAGAAGG - Intronic
1086890025 11:92246554-92246576 GAGGAGGAGAAGAAGGAAGAAGG + Intergenic
1087138896 11:94746554-94746576 GAAAGGGAGAAGGGGGAAGAGGG - Intronic
1087307367 11:96502371-96502393 GTGTGGTAGATGAGGGAATATGG - Intronic
1087930011 11:103966190-103966212 GGGTGGAGGAAGAGGGAAGAAGG + Intronic
1088140490 11:106609910-106609932 GTGTGGAAGTAGTGGGAAGAAGG - Intergenic
1088339330 11:108745128-108745150 GAGTGGAAGGAGAAGGGAGAAGG - Intronic
1088482482 11:110307915-110307937 GACGGGTGGAAGAGGGAAAAGGG - Intergenic
1088896431 11:114082173-114082195 GGGTGGCTGAAGAGGGAGGATGG + Intronic
1089590304 11:119536026-119536048 GAGCAGGAGAAGAGAGAAGAGGG + Intergenic
1090679122 11:129034477-129034499 GGGGGATAGAAGAGAGAAGAGGG - Intronic
1090850043 11:130564032-130564054 GAGTATAAGGAGAGGGAAGAGGG + Intergenic
1091079976 11:132657335-132657357 GAGTGGTGGAGGGAGGAAGAAGG + Intronic
1091155530 11:133368195-133368217 GAAAGGTAGAAGGAGGAAGAGGG + Intronic
1091555351 12:1569341-1569363 GTGGGGTTGAAGAGGGAAGAAGG - Intronic
1091699099 12:2648363-2648385 CAGTGGCAGAAGAGGGCAAAAGG - Intronic
1092927010 12:13280446-13280468 GAGGGGCAGAGGTGGGAAGAGGG - Intergenic
1092998654 12:13975036-13975058 GAGTGAAAGAAGAGAGGAGATGG + Intronic
1093025406 12:14240995-14241017 GAGGGGTAGAAGAGTAAAGCTGG - Intergenic
1093091296 12:14924006-14924028 TGGTGATGGAAGAGGGAAGAGGG - Intronic
1093492552 12:19721823-19721845 GGGAAGAAGAAGAGGGAAGAAGG - Intergenic
1094199592 12:27781921-27781943 GAGTGGGATGAGAGGGGAGAAGG + Intronic
1094318521 12:29159171-29159193 GCTAGTTAGAAGAGGGAAGAAGG - Intronic
1095200010 12:39372909-39372931 GATAGGTGGAATAGGGAAGAGGG - Intronic
1096176548 12:49524502-49524524 AAGTGGAGGAAGAGGGCAGAAGG + Intronic
1096309225 12:50505379-50505401 GGGTGGGAGAGGAGGGAAAACGG - Intronic
1096604939 12:52757933-52757955 GAGGGGCAGGAGAGGGAGGAGGG - Intergenic
1096749243 12:53748267-53748289 GAGGGCTTGGAGAGGGAAGAGGG - Intergenic
1096817256 12:54209429-54209451 GAATGGAAGAAGAGAGATGAAGG + Intergenic
1096870815 12:54590940-54590962 GAGAGGAGGGAGAGGGAAGAGGG + Intergenic
1097091390 12:56508153-56508175 GAGGAGAAGAAGAAGGAAGAAGG - Intergenic
1097281906 12:57850188-57850210 GAGGGGTAAATGAGGGAGGAGGG + Intergenic
1097331656 12:58338310-58338332 TTTTGATAGAAGAGGGAAGAAGG - Intergenic
1097864697 12:64550297-64550319 GAAAGGGAGAAGAGAGAAGAGGG + Intergenic
1097973320 12:65658445-65658467 TAGTGGTGGAGGTGGGAAGAAGG - Intergenic
1098232474 12:68386546-68386568 TGGTGGAAGAAGAGAGAAGATGG - Intergenic
1098856725 12:75661165-75661187 AAGTGATAGAAGAGGGGAGAAGG - Intergenic
1099163838 12:79276934-79276956 GAGAAGAAGAAGAAGGAAGAAGG + Intronic
1099418815 12:82426875-82426897 GTGTTGTGGTAGAGGGAAGATGG - Intronic
1100172136 12:91986990-91987012 GGGTGGGAGAAGGTGGAAGAGGG - Intronic
1100251074 12:92824521-92824543 GAGTGTTAGAAGAGTTAAAAAGG - Intronic
1100263054 12:92950649-92950671 GAGGGAGAGAAGAGGGAGGAAGG + Intergenic
1100974337 12:100106607-100106629 TAGGGGTAGGAGAGGGATGAGGG + Intronic
1101054960 12:100903015-100903037 AAGTGGCAGAAGAGGGAAAAGGG - Intronic
1101106756 12:101448133-101448155 GAGTTGTAGAAGAGGGATGATGG - Intergenic
1101193764 12:102361687-102361709 GAGAGGAAGAAGAAGGAAGAAGG + Intergenic
1101460346 12:104884610-104884632 GAGGGGTAGAAGAGGATAAAGGG - Intronic
1101584433 12:106072665-106072687 GGGAGGGAGAAGAGGGAGGAAGG - Intronic
1102394192 12:112574020-112574042 GGGTGGTGGAAGAGGGAAAGGGG + Intronic
1102536756 12:113587682-113587704 GAGTGGGGGAAGTGGGAAGGAGG - Intergenic
1102555005 12:113720947-113720969 GAGTGGGAGAAGGGAGAGGAGGG + Intergenic
1102598814 12:114013101-114013123 GAGTGGGGGAAGGGGGGAGAGGG + Intergenic
1102678146 12:114672360-114672382 GAGGGGGAGAAGAGAGGAGAGGG - Intronic
1102709878 12:114916547-114916569 GAGGGGAAGAAGAAGGAGGAAGG - Intergenic
1103367819 12:120395795-120395817 GAGTGGTTGAAAAGGCAAAATGG - Intergenic
1103618640 12:122171949-122171971 GAGTTGTGGCAGAGGGCAGATGG - Intronic
1103743707 12:123108044-123108066 GACAGGTAGAGGTGGGAAGAGGG + Intronic
1104056890 12:125237375-125237397 GGGTGGTAGGAGAGAGAACAGGG - Intronic
1104582960 12:130024151-130024173 GAGAGGTGGAAGAGAGAGGAGGG + Intergenic
1104849450 12:131864353-131864375 GAGAGGTGGAAGCGGGAGGATGG + Intergenic
1105831874 13:24169721-24169743 GAATGGGAGGTGAGGGAAGAAGG + Intronic
1106777181 13:33019767-33019789 GAGAAGGAGAAGAGGGGAGAGGG + Intronic
1107047995 13:36014217-36014239 GAGGGGTAGAGGAGCCAAGATGG - Intronic
1107456870 13:40563305-40563327 AGGTGGTAGAAGAGAGAAAATGG + Intronic
1107794331 13:44034460-44034482 GAGAGGGAGAAGGAGGAAGAAGG + Intergenic
1109257567 13:60101794-60101816 GAGTGGGAGAAGTGGCAAGATGG - Intronic
1110134105 13:72044060-72044082 GAGTGAGAGAAGAGGGAGTATGG - Intergenic
1110325234 13:74206499-74206521 GAATGGAAGAAAAGAGAAGAAGG - Intergenic
1110347386 13:74464387-74464409 GAGAGGTAGAAAAGAGAAGTGGG + Intergenic
1110716763 13:78714527-78714549 AAGTGGTAGTAGAGGGAGGTGGG + Intergenic
1110718252 13:78732232-78732254 GTGTGGTAAAATGGGGAAGATGG + Intergenic
1111629566 13:90832736-90832758 GAATGGAAAAAAAGGGAAGAGGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1111952876 13:94724059-94724081 GTTTGGTAGAAGAGGGGAGGTGG - Intergenic
1112155299 13:96810319-96810341 AAGGGGTAGAAGAGAGAAGAAGG + Intronic
1112265572 13:97920352-97920374 TCGGGGGAGAAGAGGGAAGATGG - Intergenic
1112850101 13:103695550-103695572 GAGTGGTAGAATTGGAGAGAGGG + Intergenic
1112922939 13:104637637-104637659 TAGGGCTGGAAGAGGGAAGAGGG + Intergenic
1113585232 13:111460084-111460106 GAGGGGGAGAAGGGGAAAGAGGG + Intergenic
1113662746 13:112118236-112118258 GTGTGGTAGAGGAGAGAGGACGG + Intergenic
1114275071 14:21135662-21135684 GAGTGGGAGAAGATGGGAGTGGG - Intergenic
1116225100 14:42140326-42140348 CACTGTTAGAAGAGGGAACAGGG - Intergenic
1116427334 14:44807018-44807040 GAGGGGAAGGGGAGGGAAGAAGG + Intergenic
1117541103 14:56747315-56747337 GTTTGGTAGAAGAGGGAACGAGG + Intergenic
1118064899 14:62180181-62180203 GAGAGGTAGAAGGAGGAAGTGGG + Intergenic
1118821829 14:69350792-69350814 GAATGAGAGAAGATGGAAGAGGG + Intronic
1118932025 14:70251898-70251920 CATTGGAATAAGAGGGAAGATGG - Intergenic
1118953153 14:70453300-70453322 CATTGGAATAAGAGGGAAGATGG + Intronic
1119507150 14:75182772-75182794 GGGTGGGGGAAGAGGGGAGAAGG - Intergenic
1119780890 14:77276229-77276251 GAGTGGTAGACGCAGGAAGCTGG + Exonic
1120540323 14:85742791-85742813 GAGTGTGAGAAGAGAGAAAATGG - Intergenic
1120601321 14:86513708-86513730 GACAGGAAGAAAAGGGAAGAAGG + Intergenic
1120721237 14:87891622-87891644 GAGAGACAAAAGAGGGAAGAAGG + Intronic
1120899888 14:89566789-89566811 GAGGTGGAGAAGAAGGAAGATGG - Intronic
1121069316 14:91002801-91002823 GGCTGAGAGAAGAGGGAAGAGGG - Intronic
1121445614 14:93977017-93977039 GAGTGAAAGAGAAGGGAAGAAGG + Intergenic
1121827825 14:97025296-97025318 CAGGGTTTGAAGAGGGAAGATGG - Intergenic
1122029360 14:98901341-98901363 CAGACATAGAAGAGGGAAGAGGG + Intergenic
1122306885 14:100772162-100772184 GAGTGGGAGAACAGGGAGGCTGG - Intergenic
1122709630 14:103646403-103646425 GAGAGGCTGAAGTGGGAAGATGG - Intronic
1122714368 14:103685475-103685497 GACTGGTAGAAGCAGGCAGAAGG + Intronic
1122861985 14:104586826-104586848 GGGTGTTGGAGGAGGGAAGAGGG + Intronic
1123510417 15:20993024-20993046 TAGAGGGAGAAGAGGAAAGATGG + Intergenic
1123567632 15:21566773-21566795 TAGAGGGAGAAGAGGAAAGATGG + Intergenic
1123603891 15:22004066-22004088 TAGAGGGAGAAGAGGAAAGATGG + Intergenic
1123896498 15:24835902-24835924 GGGAGGCCGAAGAGGGAAGATGG - Intronic
1125639077 15:41214617-41214639 GAATGGTAGGAGATGGAAGGGGG - Intronic
1127479552 15:59365961-59365983 GAAGGGAAGAAGAGGGAAGGAGG - Intronic
1127632796 15:60842140-60842162 GGGTGGTAGAGAAGGGAAGGGGG - Intronic
1127918494 15:63474828-63474850 GAGCAGTAGAAGAGAGAATATGG - Intergenic
1127969469 15:63947081-63947103 GAGAGGTAGCAGAGGGAAAGCGG - Intronic
1128095660 15:64952740-64952762 GAGGAGGAGAAGAGGAAAGAAGG - Intronic
1128245078 15:66127498-66127520 GAATGGTAGAAGAAGAAAGGCGG - Intronic
1128727980 15:70001820-70001842 AAGAGGAAGAAGAGGAAAGAAGG + Intergenic
1129199914 15:73992481-73992503 GAGTAGGAGAAGAGGGGAGGAGG - Intronic
1129210136 15:74063662-74063684 GAGTGGGCAAAGAGGGAAGGAGG - Intergenic
1129403885 15:75301740-75301762 GAGTGGGCAAAGAGGGAAGGAGG + Intergenic
1129442153 15:75589024-75589046 GAGTGGGAGGGGAGGGGAGAGGG + Intergenic
1129806258 15:78461381-78461403 AAATGATAGAAGAGGGAAAAGGG - Intronic
1129842075 15:78750106-78750128 GAGTGGGCAAAGAGGGAAGGAGG + Intergenic
1130225956 15:82058687-82058709 GAGGAGGAGAAGAGGGAGGATGG - Intergenic
1130275058 15:82472182-82472204 GAGTGGGCAAACAGGGAAGAAGG - Intergenic
1130467407 15:84199551-84199573 GAGTGGGCAAACAGGGAAGAAGG - Intergenic
1130496853 15:84473984-84474006 GAGTGGGCAAACAGGGAAGAAGG + Intergenic
1130589702 15:85204149-85204171 GAGTGGGCAAACAGGGAAGAAGG - Intergenic
1130766651 15:86877850-86877872 GAATGTGAGAAGAGAGAAGAAGG - Intronic
1130844729 15:87734143-87734165 GAGTGGATGAAGAGGGATGGAGG + Intergenic
1130964780 15:88689049-88689071 GAGTGGTAGAAGAAGCTATAGGG - Intergenic
1131434517 15:92412347-92412369 GAGGGGAAGAGGAGGGATGAAGG + Intronic
1132129311 15:99260987-99261009 GAGGGGTAGGAGAGGAAAGGAGG - Intronic
1202975995 15_KI270727v1_random:293868-293890 TAGAGGGAGAAGAGGAAAGATGG + Intergenic
1132664770 16:1076331-1076353 GGGTGGGAGAAGAGGGGAGGTGG - Intergenic
1132839283 16:1971015-1971037 GAGTGGGTGCAGAGGGCAGAGGG - Intergenic
1133011414 16:2914042-2914064 GAGTGATAGGAGCGGGAGGAGGG - Intronic
1133046053 16:3088978-3089000 AAGTGGAAGGAGAGGGAAGTGGG + Exonic
1133209019 16:4252695-4252717 GAGAGGCTGAAGGGGGAAGATGG - Intergenic
1133705756 16:8353108-8353130 GAGTTGTAGAAAAGAGAAGAAGG + Intergenic
1133714851 16:8438078-8438100 GAATGGTAGGAGAGGGGCGAGGG - Intergenic
1134215428 16:12313385-12313407 GAGTTGTAGAAGGGGTAAAATGG + Intronic
1134299356 16:12975750-12975772 GACTGGAAAAAGAGGGAAGATGG + Intronic
1134853545 16:17501259-17501281 GAGTGGTAGAAGGAAGAATAGGG - Intergenic
1135013334 16:18903469-18903491 TAGTGGTGGGAGAAGGAAGAAGG - Intronic
1135147989 16:19979733-19979755 GAAAGGGAGAAAAGGGAAGAGGG + Intergenic
1135294821 16:21270057-21270079 AAGTGGGAAAAGAAGGAAGAAGG + Intronic
1135438690 16:22448147-22448169 TAGTGGTGGGAGAAGGAAGAAGG + Intergenic
1135504804 16:23027260-23027282 GTGGGATTGAAGAGGGAAGAAGG + Intergenic
1135694746 16:24575885-24575907 GAGAGGGAGGAGAGGGAGGAGGG + Intergenic
1136071170 16:27788182-27788204 GAGTGGGAGAAGAGGAAAGTTGG - Exonic
1136330489 16:29572763-29572785 TAGTGGTGGGAGAAGGAAGAAGG - Intergenic
1137273273 16:46917027-46917049 GAGGGGTAGAAAAGGGAAAGAGG - Intronic
1138069010 16:53971967-53971989 GAGTGGTGAAGGAGGGAAGGGGG - Intronic
1138070611 16:53989516-53989538 GGGAGGTAGAATAGGGTAGACGG + Intronic
1138333794 16:56235889-56235911 GAGTGGTGGAAGTTGGTAGATGG + Intronic
1139322653 16:66127888-66127910 AAGCGGAAGAAAAGGGAAGATGG + Intergenic
1139424090 16:66868287-66868309 GAAGGATAGAAGAGGGCAGAGGG + Intronic
1139743332 16:69054327-69054349 GAGTAGTAGAAGAGGGCTCAGGG + Intronic
1140058469 16:71546410-71546432 ATGTGATAGAAGAGGAAAGACGG - Intronic
1140317809 16:73916012-73916034 GAGAGGCAGAGGAGGGAGGAGGG - Intergenic
1140417624 16:74787412-74787434 GAGTGGGAACAGGGGGAAGAAGG - Intergenic
1140943608 16:79747090-79747112 GAGAAGGAGACGAGGGAAGAGGG + Intergenic
1140981208 16:80111571-80111593 ATGGGGTAGAAGAGGGCAGAGGG - Intergenic
1141466371 16:84208435-84208457 GAGGGGAGGAAGAGGGCAGAGGG + Intergenic
1141706797 16:85669913-85669935 GAGCGGTAGCTGAGAGAAGAGGG - Intronic
1141891769 16:86930911-86930933 GAGGGGGAGGAGGGGGAAGAAGG - Intergenic
1141999904 16:87658352-87658374 GAGGGGGAGAAGCGGGGAGAAGG - Intronic
1142109503 16:88323686-88323708 GAGTGGCAGAAGTGGGCAGGGGG + Intergenic
1142332120 16:89461891-89461913 GAGTGCCAGAGGAGGGGAGAGGG - Intronic
1142787532 17:2235852-2235874 GTGTGGAAGTAGAGGGGAGAAGG - Intronic
1143361865 17:6377533-6377555 GAGAGGGAGAAGAGGGCAGGGGG - Intergenic
1143855417 17:9844453-9844475 GGGTGGAAGAAGAGGGAGGGTGG + Intronic
1143965687 17:10755266-10755288 GAGCTGTAGCTGAGGGAAGAGGG - Intergenic
1144128941 17:12227249-12227271 GAGTGGGAGAAGTGGGGAGATGG - Intergenic
1144478417 17:15609289-15609311 GAGAGGGAGCAGAGGAAAGAGGG - Intronic
1144508579 17:15855839-15855861 GAGTGGTAGAATGGGGAGGGGGG - Intergenic
1144877926 17:18412039-18412061 GAGTGGAAGAGGGGAGAAGAGGG - Intergenic
1144919873 17:18754422-18754444 GAGAGGGAGCAGAGGAAAGAGGG + Intronic
1145154303 17:20532386-20532408 GAGTGGAAGAGGGGAGAAGAGGG + Intergenic
1145395632 17:22492118-22492140 GAGAGATAGATGAGGGATGATGG + Intergenic
1146689729 17:34865135-34865157 GAGTGATCGCAGAGGGAGGATGG - Intergenic
1146911795 17:36653156-36653178 GGGAGGAAGAAGAGGGAAAAGGG - Intergenic
1147192472 17:38746157-38746179 GAGAGGTGGGAGAGGGAGGAAGG - Intronic
1147305786 17:39563537-39563559 GAGTGGAAGAAGAAGAGAGAGGG - Intronic
1147308999 17:39583031-39583053 GGGAGGTAGAAAAGGGATGAGGG + Intergenic
1147675378 17:42201870-42201892 GAGGGAAAGAAGAGGGATGAAGG + Intronic
1147917536 17:43897716-43897738 GAGTGGAAGAATGAGGAAGAGGG - Intronic
1148019220 17:44542415-44542437 GGTTGGAAGCAGAGGGAAGATGG - Intergenic
1148162075 17:45455959-45455981 GAGTGGCAGGAGAGAGGAGATGG - Intronic
1148486864 17:47996297-47996319 TAATGGCAGAAGAGGGCAGAGGG - Intergenic
1148563421 17:48619389-48619411 GAGAGGGAGAAGAGAGAAGCCGG - Intronic
1149304630 17:55335827-55335849 GGGAGGGAGCAGAGGGAAGAGGG - Intergenic
1149360463 17:55889617-55889639 AAGAGGAAGAAGAGGGAAGCTGG - Intergenic
1149876611 17:60240419-60240441 GAATGGCAGAAGTGGGGAGAGGG + Intronic
1150393308 17:64802607-64802629 GAGTGGCAGGAGAGAGGAGATGG - Intergenic
1150500124 17:65643002-65643024 GTGTGGTGGAAGAGGGGATAAGG - Intronic
1150628620 17:66859880-66859902 GAGGTGGAGAAGAAGGAAGAAGG - Intronic
1150947615 17:69765406-69765428 GAGAGGGAGGGGAGGGAAGAAGG - Intergenic
1151411447 17:73932982-73933004 GAGAGGGGGGAGAGGGAAGAGGG - Intergenic
1151511112 17:74560785-74560807 GAGTGGGAGAAGCAGGAAGCAGG + Intergenic
1152655248 17:81516438-81516460 GTGTGGGAGAAGAGGGAGGTGGG - Intronic
1153079213 18:1201504-1201526 GTATGGCAGAAGGGGGAAGAAGG - Intergenic
1153272729 18:3339319-3339341 GTCTGGTAGAAGCGGGAGGATGG - Intergenic
1153304490 18:3619590-3619612 GACTGGAAGAAGAGGAGAGAAGG - Intronic
1153366381 18:4261564-4261586 GAGAGGTGGAATAGGGACGAAGG - Intronic
1153406309 18:4744159-4744181 GAAGGGTAGAAGGGGGATGAGGG + Intergenic
1153445533 18:5168409-5168431 GTATTGTAGAAGAGGAAAGATGG + Intronic
1153547971 18:6229008-6229030 AAGTGGTAGAAGAAAGAAAATGG + Intronic
1154193840 18:12252057-12252079 GAGAGGTGGGAGAGGGCAGAGGG - Intergenic
1154318373 18:13324521-13324543 CAGTGGCAGAACGGGGAAGAGGG + Intronic
1155393315 18:25360284-25360306 GAGAGAAAGAAGACGGAAGAAGG - Intergenic
1156432068 18:37085797-37085819 GAGAGGGAGGAGAGGGAAAAAGG - Intronic
1156524970 18:37758324-37758346 GAGAGACAGAAGAGAGAAGAGGG + Intergenic
1156750198 18:40443987-40444009 GAGTGGAAAAACAGGAAAGAGGG + Intergenic
1156899600 18:42285747-42285769 GAGTGGTAGAGCAGGAAGGATGG + Intergenic
1157421934 18:47554989-47555011 GTGTGGAAGGTGAGGGAAGAGGG - Intergenic
1157801138 18:50622301-50622323 GAAAGGGGGAAGAGGGAAGAAGG + Intronic
1157844661 18:50992187-50992209 GAGTGGAAGAAGGGGCCAGAAGG + Intronic
1157879145 18:51303527-51303549 GACTGGTAGATGAGGGAGGTCGG + Intergenic
1157992242 18:52510927-52510949 AAAAGCTAGAAGAGGGAAGAGGG + Intronic
1158219313 18:55133830-55133852 GAGAGGCAGAAGAGTGAAGGAGG + Intergenic
1158310108 18:56149023-56149045 AAGAGGAAGAAGAAGGAAGAGGG + Intergenic
1158586268 18:58738103-58738125 GAGTGGGGGAAGGGAGAAGAGGG - Intronic
1158986996 18:62827889-62827911 GACTGGAAGAAAAGGGAACAGGG - Intronic
1159504967 18:69324743-69324765 GAGGAGGAGAAGAGGGAACAAGG + Intergenic
1159805214 18:72948697-72948719 GAGGTTTAGAAGAGGGAAAAAGG + Intergenic
1160280301 18:77484030-77484052 GGGTGCTTGAAGTGGGAAGAAGG + Intergenic
1160860021 19:1233771-1233793 GAGGGGCAGAAGCGGGAGGAGGG + Intronic
1161258896 19:3324720-3324742 TAGTGGGAAGAGAGGGAAGAAGG - Intergenic
1161370607 19:3908859-3908881 GAGAGGAAGATGAGGGAAGGAGG - Intronic
1161459912 19:4390434-4390456 GAGAGGAAGAAGAGGTGAGAGGG + Intronic
1161814325 19:6490307-6490329 GAGGGAGAGAAGAGGGAGGAAGG - Intergenic
1162080482 19:8214939-8214961 GAGGGGGAGGAGAGGGAGGAGGG + Intronic
1162516738 19:11152764-11152786 GAGGGGTGGAAGAAGGAGGAGGG + Intronic
1162789735 19:13056597-13056619 GAGTGGAAGGACAGGCAAGAGGG - Intronic
1163113042 19:15173001-15173023 AAGAGGAAGAAGAAGGAAGAGGG - Intronic
1163144748 19:15372960-15372982 GACTGGGAGAAGAGGGACGGAGG + Exonic
1163350974 19:16776993-16777015 GAGGGAAAGGAGAGGGAAGAGGG + Intronic
1163779772 19:19240120-19240142 GAGGGGCAGGAGTGGGAAGAAGG - Intronic
1163933823 19:20423906-20423928 CAGGGAAAGAAGAGGGAAGAAGG + Intergenic
1164322149 19:24158944-24158966 GAAAGGGAGAATAGGGAAGAAGG - Intergenic
1165069760 19:33248516-33248538 GAGAGGGAGAGGAGGGAGGATGG + Intergenic
1165114498 19:33521078-33521100 GAGTGGTCGTAGTGGGAGGAAGG - Intronic
1165120760 19:33556963-33556985 CAGTGGCAGCAGAGGGAAGGAGG - Intergenic
1165277427 19:34767161-34767183 GTGTGACAGAAGTGGGAAGACGG + Intronic
1165371695 19:35411639-35411661 GTGTGGTATTAAAGGGAAGAAGG - Intergenic
1165417360 19:35702974-35702996 GAGTGGGACAAGAGAGAAAAGGG + Intergenic
1165565071 19:36718665-36718687 GAATGGTAGAAGGGGGTTGATGG - Intronic
1165796573 19:38523437-38523459 GAGAGGGAGAGGAGGTAAGAGGG - Intronic
1166541407 19:43608133-43608155 CAGTGGTATCAGAGGAAAGAGGG + Intronic
1166662951 19:44659087-44659109 GAGTGGGAGAAGAGCGTATAGGG + Intronic
1166792491 19:45406186-45406208 GACTGGGAGAAGCGGGAAAATGG - Intronic
1167019257 19:46861547-46861569 GAGGGGTGGAAGGGGGAAGGGGG - Intergenic
1167130542 19:47582326-47582348 GAGAGGAAGAGGAGGGAAGGAGG - Intergenic
1167608174 19:50492822-50492844 GGGAGGAAGAAGAGGAAAGAGGG + Intergenic
1167651776 19:50734890-50734912 GAGGGAGAGAAGAGGGCAGAGGG - Intergenic
1167671968 19:50858740-50858762 GAGTCAAAGAAGAGGGAAGGAGG - Intronic
1167707010 19:51087036-51087058 GAGTGATTGAAGAGCTAAGAGGG + Intergenic
1167874592 19:52401121-52401143 GGGTGGGTGAAGAGGGAAAATGG - Intronic
1167890751 19:52537237-52537259 GAGGAGTAATAGAGGGAAGAAGG + Intronic
1167898779 19:52602454-52602476 GAGAAGTAATAGAGGGAAGAAGG + Intronic
1167921256 19:52785182-52785204 GAGAAGTAATAGAGGGAAGAAGG - Intronic
1167940306 19:52941400-52941422 GAGAAGTAATAGAGGGAAGAAGG - Intronic
1168110201 19:54188173-54188195 GAGAGGGAGAGGAGGGGAGAGGG - Intronic
1168249432 19:55133332-55133354 GAGAGGGAGAGGAGGGAGGAAGG + Intronic
1168433798 19:56302294-56302316 GAGGGAGAAAAGAGGGAAGAAGG - Intronic
925242060 2:2339962-2339984 GAGTGGAAGATGAGGACAGAGGG - Intergenic
925689373 2:6505618-6505640 GTGGGGTAGAGGAGGGAAGAGGG - Intergenic
925925654 2:8668264-8668286 GAATGGTAGACGATGGATGAAGG + Intergenic
926081934 2:9994476-9994498 GGATGGAAGATGAGGGAAGAGGG - Intronic
926472281 2:13275772-13275794 TGGGGGTAGAAAAGGGAAGAAGG - Intergenic
926756279 2:16238685-16238707 GAATGAAAGGAGAGGGAAGAAGG - Intergenic
926854770 2:17242939-17242961 GAGTGGGGAAAGTGGGAAGAAGG - Intergenic
927106049 2:19827026-19827048 GAGTGTTAGCAGAGATAAGAAGG + Intergenic
927408339 2:22797400-22797422 GAGTGAAAGAAGAGGCAAGCAGG + Intergenic
927703122 2:25280468-25280490 GAGAGTGAGAACAGGGAAGAAGG - Intronic
928413482 2:31072017-31072039 GTGTGGGAGAAAAGAGAAGAGGG + Intronic
928669408 2:33585350-33585372 CCGTGGCAGAAGAGGCAAGATGG - Exonic
928948070 2:36789934-36789956 CAGTGGTAACAGAGGGGAGAAGG - Intronic
929115269 2:38438683-38438705 GAATGGCAGGAGGGGGAAGATGG - Intergenic
929750320 2:44705265-44705287 GAGAGGGAGAGGTGGGAAGAGGG - Intronic
929778885 2:44944773-44944795 GAGGGGAAGGAGAGGGAGGAGGG - Exonic
929828051 2:45325371-45325393 GTGTGGTAGGAGTGGGAAAATGG + Intergenic
929837468 2:45418711-45418733 GAGTTGTGCAAGAGGAAAGAAGG + Intronic
930136154 2:47905807-47905829 GAGTGGGAGAGGGGGGAGGAAGG + Intergenic
930288109 2:49459473-49459495 GAAAGGAAGAAGAGGGAAGAAGG + Intergenic
930463026 2:51708078-51708100 AAGTATAAGAAGAGGGAAGAAGG - Intergenic
930535268 2:52637988-52638010 AAGTGGAAGAAGAAGGAAGAAGG - Intergenic
930624886 2:53685995-53686017 GACAGATAGAAGAGGCAAGAGGG + Intronic
931330081 2:61271692-61271714 GAGGGGAAGAAGGGGGAAGGAGG + Intronic
931597695 2:63967766-63967788 AAGGGGTAGCAGAGGGATGAGGG + Intronic
931869030 2:66439848-66439870 CAGTGCTAAGAGAGGGAAGAGGG - Exonic
932029457 2:68168457-68168479 GAGTGTGGGAAGAGGGAAGCTGG + Intronic
932627971 2:73314076-73314098 GAGGAGTAGAAAAGAGAAGAGGG + Intergenic
932817575 2:74874192-74874214 CAGTAGTATAAGAGGGAAGAGGG + Intronic
933428884 2:82149460-82149482 GTGAGGTTGAAGAGAGAAGAGGG + Intergenic
933441107 2:82315400-82315422 GAGGGGGAGGAGAAGGAAGAGGG - Intergenic
933478182 2:82819212-82819234 GAGTGGTATAAGAGTGAGGATGG - Intergenic
933855710 2:86412260-86412282 GAAAGGGAGAAGAAGGAAGAAGG - Intergenic
934733308 2:96672956-96672978 GAGAGGGAGAGAAGGGAAGATGG + Intergenic
934745428 2:96756486-96756508 GTGTGGATGATGAGGGAAGAAGG - Intergenic
934962314 2:98687503-98687525 GAAAGTGAGAAGAGGGAAGAAGG - Intronic
935029963 2:99312162-99312184 GAGTGGTTGAAGAGGTGAGAGGG - Intronic
935157805 2:100498752-100498774 GACTACTAGAAGAGGGAAGGAGG - Intergenic
935401900 2:102668798-102668820 GAATGGTAGAAGGTGGAGGAGGG - Intronic
935949544 2:108316343-108316365 GAGTGGGAGAGGTGGGAAGAAGG - Intergenic
936521528 2:113214841-113214863 GGGTGGTGGAAGTGGGAGGATGG + Intergenic
937553699 2:123128461-123128483 GAGTTCTAGAAGAGTGAATAAGG + Intergenic
937571994 2:123374779-123374801 GAGTGGTAGAATACGAAACAGGG + Intergenic
937921802 2:127136547-127136569 GGGTGGGAGACGGGGGAAGACGG + Intergenic
939055428 2:137359552-137359574 GGGTGGTAGAATAGAGATGACGG + Intronic
939571788 2:143848498-143848520 GAGTGAGAAAAGAGGGAAGGAGG - Intergenic
939606625 2:144262695-144262717 GAAAGGTAGGGGAGGGAAGAGGG + Intronic
940336684 2:152536134-152536156 GTGGGCTAGAAGAGGGGAGAGGG - Intronic
941473782 2:165923074-165923096 GAGACTTAGAAGAGGGAGGATGG + Intronic
941809207 2:169738935-169738957 GAGGGGGAGGAGAGGGAAGGAGG - Intronic
941836846 2:170031675-170031697 GACTACTAGAAGAGGGAAGGAGG - Intronic
941953316 2:171178469-171178491 GAGTCAATGAAGAGGGAAGATGG - Intronic
942301095 2:174563330-174563352 GAGAGGTTGAGGAGGGATGATGG + Intronic
942406791 2:175664404-175664426 GAAGTGTAGAAGAGGGATGAAGG + Intergenic
943040537 2:182799460-182799482 GAGTGAAACAAGAGAGAAGAAGG + Intergenic
943325505 2:186492891-186492913 GAGAGGAAGAAGAGGCAAAAAGG - Intronic
943809297 2:192164189-192164211 AAGTGGTAGAAGAGGAGAGTAGG - Intronic
944290085 2:197995285-197995307 GAGTGGAAGAAGAGAAAAGGAGG - Intronic
944405329 2:199377586-199377608 GAGTGCAGGAAGAGGGAAGAAGG + Intronic
945586637 2:211673186-211673208 CAGTGTGAGAAGATGGAAGATGG - Exonic
946179987 2:217943180-217943202 TAGTGGTTGGAGAGGGCAGAGGG + Intronic
946228264 2:218276422-218276444 GAGGGGTAGACTAAGGAAGAAGG + Intronic
946343368 2:219087069-219087091 GAGTGGGAGTAGAGAAAAGAAGG - Intronic
946399375 2:219460669-219460691 GAGGGGGAGGAGAGGGGAGAGGG - Intronic
946431447 2:219628947-219628969 GAGTGGGAGGAGAGGGTGGATGG - Intronic
946569070 2:221001344-221001366 GAGTGGGAGAGGAGAGGAGAAGG - Intergenic
947013083 2:225587703-225587725 GACAGGTAGAACAGGGCAGAAGG + Intronic
947042776 2:225942489-225942511 GAGAAGGGGAAGAGGGAAGAGGG + Intergenic
947277386 2:228407943-228407965 GAGTGGTAGAAGAGAGCATGTGG - Intergenic
947323764 2:228952238-228952260 GAGAGGGAGAAGAGGGAGGGCGG + Intronic
948056189 2:235010800-235010822 GGGTTCTAGAAGAGGGAGGAAGG - Intronic
948056207 2:235010869-235010891 GGGTTCTAGAAGAGGGAGGAAGG - Intronic
948056255 2:235011073-235011095 GGGTTCTAGAAGAGGGAGGAAGG - Intronic
948091777 2:235301715-235301737 GAGGGGGAGAAGGGGGAAGGGGG - Intergenic
948174592 2:235933280-235933302 GAGAGGAGGAAAAGGGAAGATGG + Intronic
1168740556 20:187411-187433 GACTAATAGAAGAGGGAAGGAGG + Intergenic
1169210872 20:3765717-3765739 GAGTGGGAGAAGGGGGAGGCAGG - Intronic
1169791364 20:9413863-9413885 GAGGGGTGGAGGAGGGAGGATGG - Intronic
1169858777 20:10130672-10130694 CAGTGGTAGAAGTTAGAAGAGGG - Intergenic
1169997889 20:11579231-11579253 GAGTGGAGGAAGAGGGAATCAGG - Intergenic
1171034625 20:21705506-21705528 GGGTGGTGGAAGAGGGCCGAGGG + Intergenic
1171452538 20:25246666-25246688 GAGTGGTAGAAGTGGTCATAGGG + Intergenic
1171496651 20:25561026-25561048 GAGAGGGAGAGGAGGGGAGAGGG - Intronic
1172427152 20:34863203-34863225 GAGTGGTAGAAGGGGAGAGAGGG - Intronic
1172875097 20:38159204-38159226 GAGTGAAAGAAGAGGAAAGAAGG + Intronic
1173167837 20:40698547-40698569 GGGTGGTAGAAGAGGTAGAATGG - Intergenic
1173427882 20:42958395-42958417 GAATGGTGGGAAAGGGAAGAAGG + Intronic
1173443242 20:43096144-43096166 GAGTAGAAGAAGGGGGAACAGGG - Intronic
1173689534 20:44949498-44949520 GAGAGGAAGCAGAGGGAACATGG + Intronic
1173759886 20:45550135-45550157 GAGTGTGATAAGTGGGAAGATGG + Intergenic
1174882425 20:54294825-54294847 GACTTGGAGAAGAGGGAAGTGGG - Intergenic
1176119904 20:63449719-63449741 TCCTGGGAGAAGAGGGAAGAGGG + Intronic
1177049695 21:16217556-16217578 GATTAGTGGAAGATGGAAGATGG - Intergenic
1177177119 21:17712258-17712280 GGGTGGTAGAAGGAAGAAGAGGG - Intergenic
1177548870 21:22595409-22595431 GAGTGAGAAAAGAGGGAATAAGG + Intergenic
1177681047 21:24371595-24371617 GAGTGGTAGAGGAGGGGCGAGGG - Intergenic
1177887262 21:26761861-26761883 GAGTTGCAGGAAAGGGAAGAGGG + Intergenic
1178246902 21:30961617-30961639 CATTGGGAGATGAGGGAAGAAGG - Intergenic
1178789270 21:35683784-35683806 GAGTGGGTGAAGGTGGAAGAGGG - Intronic
1179273486 21:39869555-39869577 GAGGGGGAGAAGAGGGCAGGAGG - Intronic
1179454730 21:41491259-41491281 GAGAGGTTGAAGTGGAAAGATGG - Intronic
1180156154 21:45978125-45978147 GAGGGGGAGAGGAGGGAAGGGGG + Intergenic
1180156216 21:45978352-45978374 GAGGGGGAGAGGAGGGAAGAGGG + Intergenic
1180616494 22:17131709-17131731 GGGTGTTGGAAGTGGGAAGATGG - Exonic
1181119526 22:20656710-20656732 GAGTGGTAGAAAAGGAAGCAGGG - Intergenic
1181886878 22:26028548-26028570 GAGTGCTAGGAGAGGGAGGAAGG - Intronic
1181901551 22:26160323-26160345 GAGAGGAAGTAGAGGGAAGGAGG + Intergenic
1181950602 22:26550931-26550953 GAGTGGTTCAAGAGGGAAAAAGG + Intronic
1182550874 22:31100170-31100192 GAGAGGGAGAAGGGGGCAGAGGG - Intronic
1182961434 22:34479075-34479097 GAGTGGAGGAAGGAGGAAGAGGG - Intergenic
1183068793 22:35381875-35381897 GTGTTGTAGAACAGGGAAGCAGG + Intronic
1183354556 22:37351207-37351229 GAGGGAGAGAAGAGAGAAGAGGG - Intergenic
1183717722 22:39543641-39543663 GAGTGGTGGAGGAGGGGAGGTGG + Intergenic
1184291792 22:43501341-43501363 GAAAGATAGAAGAGGGGAGAAGG - Intronic
1184421437 22:44384868-44384890 GAGGGGCAGGAGAGGGGAGATGG + Intergenic
1184421449 22:44384901-44384923 GAGTGGGGGGAGATGGAAGAGGG + Intergenic
1184518560 22:44978726-44978748 GTGTAGTAGAAGAGGAAAAAAGG - Intronic
1184663044 22:45974378-45974400 CAGCGGTAGAAGGGGGAAGCTGG - Intronic
949195591 3:1302490-1302512 GAGAGAGAGAAGAGGGAGGAAGG + Intronic
949284375 3:2383730-2383752 GAGAGGGAGAAGAGAGAAGAGGG - Intronic
949284377 3:2383746-2383768 GAGAGGGAGAAGAGAGGAGAGGG - Intronic
949634771 3:5970618-5970640 GAGTGGGGGAGAAGGGAAGAAGG - Intergenic
950005235 3:9687172-9687194 GAATCTTAGAAGAGGGGAGAGGG + Intronic
950119395 3:10471559-10471581 GAGTGGGAGGAGAGGGAGGGAGG + Intronic
950307466 3:11927588-11927610 GAGAGATAGAAGAGGGATAAGGG + Intergenic
950431345 3:12952854-12952876 AGGTGGCAGAAGAGGGATGAGGG + Intronic
950626133 3:14248513-14248535 GAGTGGTTCAAAAGGGTAGAGGG - Intergenic
951216204 3:20027660-20027682 GAGTGGGAAAAGAAGGAGGAAGG + Intergenic
951551184 3:23876706-23876728 GAGTTGTAGACAAGGGAGGAGGG + Intronic
951623161 3:24628948-24628970 GAGAGGAAGATGAGGGTAGAAGG - Intergenic
951706320 3:25547426-25547448 CAGTAGTGGAAGGGGGAAGATGG - Intronic
952152125 3:30605097-30605119 TGGTGGCAGAAGAGGGAATAGGG + Intergenic
952482165 3:33772654-33772676 GATTGGGAGAAGAGGGAAGCAGG + Intergenic
952826551 3:37529744-37529766 GAGAGGTTGAAGAGACAAGAGGG + Intronic
952954355 3:38548001-38548023 GAGTGGTAGCAGAGGACCGAGGG - Intergenic
953282079 3:41568858-41568880 GAGTGTTTGAAGTGGGAAGGAGG - Intronic
953685415 3:45074417-45074439 AAGTGGTGGAAGTAGGAAGAAGG + Intergenic
954271349 3:49512134-49512156 GGGAGGCTGAAGAGGGAAGAAGG - Intronic
954619108 3:51985718-51985740 GAGTGGTGGGAGAGGAAAGACGG - Intronic
954696890 3:52432339-52432361 GAGTGATGCAAGAGGGAAGAAGG + Intergenic
954819383 3:53312358-53312380 GTGTGGTAGAAGAGGAGACACGG - Exonic
954852254 3:53613338-53613360 TACAGGAAGAAGAGGGAAGAGGG - Intronic
954916147 3:54149973-54149995 GAGGGGGAGGGGAGGGAAGAAGG - Intronic
955307393 3:57848145-57848167 GAGGAGAAGAAGAAGGAAGAAGG - Intronic
956258154 3:67306563-67306585 ATGTGGTAGAAGAGGGTATAAGG + Intergenic
956713075 3:72055523-72055545 GAGAGGAAGAAGAGGGACCATGG + Intergenic
957282798 3:78175093-78175115 GAGGTGAAGGAGAGGGAAGAAGG - Intergenic
957319506 3:78611350-78611372 GAGAGGTTGAAGAGAGAGGATGG + Intronic
957668515 3:83268929-83268951 GACTACTAGAGGAGGGAAGAAGG - Intergenic
957997280 3:87706482-87706504 GAGTGGGAGATGTGGGAAGATGG - Intergenic
959280046 3:104325807-104325829 GACTGGCAGAAAAGAGAAGATGG - Intergenic
959579098 3:107965900-107965922 GAGGGGTAAGAGAGTGAAGAGGG + Intergenic
960269634 3:115659620-115659642 GAGAGAGAGAAAAGGGAAGAGGG + Intronic
960961798 3:123076036-123076058 TGCTGGTAGCAGAGGGAAGATGG + Intronic
961057513 3:123801576-123801598 GATTGCTAGAGGAGGGAAAAGGG - Intronic
961905615 3:130260039-130260061 GACTGGCAGATGAGGGGAGAGGG + Intergenic
962069352 3:132017283-132017305 GAGTGAGAGAAGATGGGAGAAGG + Intronic
962123312 3:132587252-132587274 GAGTTCCAGAAGAGGCAAGAGGG - Intronic
962282339 3:134061353-134061375 CATTGGCAGAAGAGAGAAGAAGG - Intergenic
962480375 3:135792813-135792835 CAGTGGAAGATGAGGGAAGCTGG - Intergenic
963076674 3:141353562-141353584 GAAGGGGAGAAGGGGGAAGAAGG + Intronic
963275566 3:143326440-143326462 GAGGGAGAGAAGAGGGAGGAAGG - Intronic
963363572 3:144306168-144306190 TATTGGTAGAAGTGGTAAGAGGG + Intergenic
964344005 3:155737886-155737908 GAGGGAGAGAAGAGGGAAGTGGG + Intronic
965172168 3:165279838-165279860 GAGGAGAAGAAGAGAGAAGAAGG - Intergenic
965369818 3:167847998-167848020 GAGGGTTAGGAGAGGGGAGATGG - Intergenic
965603488 3:170477284-170477306 GAGAGGGAGAAGTGGGAAGGTGG + Intronic
965899945 3:173627196-173627218 GAGTGGGAGGAATGGGAAGATGG - Intronic
966402543 3:179562687-179562709 CAGTGGGAGAAGAAGGAGGAAGG - Intergenic
966433557 3:179858438-179858460 GAGAGAGAGAAAAGGGAAGAGGG - Intronic
966886064 3:184378846-184378868 GAACGGTAGGAGATGGAAGACGG - Intronic
966891889 3:184413250-184413272 GAGGGGTTGAAGAGGAAGGATGG - Intronic
967727290 3:192873537-192873559 GAATGGTAGGAGTGGGATGAAGG - Intronic
967936313 3:194730659-194730681 GACTGGCAGAGAAGGGAAGAGGG + Intergenic
968168282 3:196486715-196486737 GAGAGGTGGAAGAAGGAAAAAGG + Intronic
968246259 3:197152370-197152392 GAGTAGTAGAACAGGTAACATGG - Intronic
968439832 4:617645-617667 GAGGGGTAGAAGGGAGATGAAGG - Intergenic
968616152 4:1578785-1578807 GAGGGGGAGAGGAGAGAAGAGGG + Intergenic
968744447 4:2352424-2352446 GAGGCGTGGAAGAGGGAAGAAGG + Intronic
968937071 4:3617143-3617165 GAGAGGGATAGGAGGGAAGAAGG - Intergenic
968937118 4:3617268-3617290 GAATGGGATGAGAGGGAAGAAGG - Intergenic
968978661 4:3835056-3835078 GAGAGAGAGAAGAGGGAAGGAGG + Intergenic
969607860 4:8211359-8211381 GAGGGGGAGAGGAAGGAAGAGGG - Intronic
969607871 4:8211392-8211414 GAGGGGGAGAGGAAGGAAGAGGG - Intronic
970066673 4:12102809-12102831 GAGTGTGAGAAAAGGGAAAATGG - Intergenic
970334059 4:15014836-15014858 TAGTGGAAGCACAGGGAAGATGG + Intronic
970589923 4:17550628-17550650 GAGAGGGAGGAGAGGAAAGAAGG + Intergenic
970914891 4:21321580-21321602 GAGGGGTAGGAGGAGGAAGAGGG + Intronic
971102202 4:23480013-23480035 AATTGGTAGAAGAAGGAAGTTGG - Intergenic
971272468 4:25163480-25163502 GAGTAATAAAAGAGGGAAGCTGG - Intronic
971702612 4:29998049-29998071 GACTGGTAGTAGAAGGGAGAAGG + Intergenic
971820843 4:31552544-31552566 GAATGGTAGAAAAAGGGAGATGG + Intergenic
972746345 4:41935782-41935804 AGGTGGGAGAAGAGGAAAGAAGG - Intronic
973589227 4:52423942-52423964 GAGAGAGAGAAGAGGAAAGAGGG + Intergenic
974491859 4:62573557-62573579 GTTTGGCATAAGAGGGAAGATGG + Intergenic
974958612 4:68673228-68673250 GAGGGTTTGAAGAGGGAAGGGGG - Intergenic
974999293 4:69200454-69200476 GTTTGCTAGAAAAGGGAAGAAGG - Exonic
975006489 4:69294773-69294795 GTTTGCTAGAAAAGGGAAGAAGG + Exonic
975603288 4:76125805-76125827 GAGAGGGAGAAGAGGGAGAAAGG + Intronic
975822172 4:78282820-78282842 GAGGGAGAGAAGTGGGAAGATGG + Exonic
976443722 4:85106612-85106634 AAGTGGGAAAAGAGGGAGGAAGG - Intergenic
976507394 4:85864101-85864123 GACTGGCAGAGAAGGGAAGATGG + Intronic
976547925 4:86359403-86359425 GAGGGGTAGCAGAGGGAGGGAGG - Intronic
976794154 4:88913415-88913437 AAGTAGTAGTAGAGGGAAGAGGG + Intronic
977886968 4:102263027-102263049 GAGTAATAGAAAATGGAAGATGG - Exonic
978627837 4:110707660-110707682 GAGTAGTAAGAGAGGGTAGAGGG - Intergenic
978644723 4:110916102-110916124 GAGTGGGAGGAGAGGTCAGAGGG + Intergenic
979728381 4:123992100-123992122 GAGTGGCAGAACAGTCAAGAAGG + Intergenic
981032941 4:140144127-140144149 CAGGGGTAGAAGTGGGTAGAAGG - Intronic
981308549 4:143272181-143272203 CAATGGTAGAAGAGGGCCGAGGG - Intergenic
981348879 4:143705130-143705152 GTGTGAAAAAAGAGGGAAGAGGG + Intergenic
981474357 4:145173559-145173581 GTGTGGTAGAGAAGGGAAGTGGG - Intronic
981624735 4:146742673-146742695 GAGGAGTAGAAGAGGAAAGAAGG - Intronic
982717447 4:158823879-158823901 GACTGAGAGTAGAGGGAAGATGG + Intronic
983379837 4:166978700-166978722 GAGAAGGAGAAGAAGGAAGACGG + Intronic
983795160 4:171853356-171853378 GAGTGTAAGAAGGGGAAAGAAGG - Intronic
983995170 4:174174191-174174213 GAGTGGAAGAGGAGAGAATATGG + Intergenic
984118238 4:175709225-175709247 GAGGAGGAGAAGAGGGAGGAAGG - Intronic
984825069 4:183916855-183916877 GATAGGAAGTAGAGGGAAGAGGG - Intronic
984858906 4:184219717-184219739 GAAGGGAAGAAAAGGGAAGAAGG + Intronic
984859094 4:184220366-184220388 GAAGGGAAGAAAAGGGAAGAAGG + Intronic
985402541 4:189606730-189606752 GAGAGGGAGAAGGAGGAAGATGG - Intergenic
986127183 5:4893998-4894020 GTGTGGCACAAGAGGAAAGAGGG + Intergenic
986190392 5:5491570-5491592 GAGAGGGAGAAGATGAAAGACGG + Intergenic
986231392 5:5867465-5867487 GAGGGGTAGAAGTGGGAAGATGG - Intergenic
986490724 5:8286905-8286927 GAGAGGGAGGAGAGGGAGGAAGG - Intergenic
986695815 5:10353750-10353772 GAGAGGAAGGAGAGGGGAGAGGG - Exonic
986920021 5:12668815-12668837 GAGCAGTAGAAATGGGAAGAGGG + Intergenic
987011455 5:13770329-13770351 AAGGGCAAGAAGAGGGAAGAGGG + Intronic
987049645 5:14138768-14138790 GAGAGGTAGAAGAGGGAATTAGG - Intergenic
987367996 5:17167161-17167183 GAGTGTCAGAGGAGGAAAGATGG + Intronic
987772185 5:22319791-22319813 GAGTGATGGAAGTGGGAAGAGGG + Intronic
987917926 5:24240327-24240349 GAGAGGAAGACGTGGGAAGAAGG + Intergenic
988543326 5:32132911-32132933 GAGTGGGAGAAGGAGGAAAAAGG - Intronic
989294962 5:39814566-39814588 GGGAGGTAGAAGAGGAAAGAGGG + Intergenic
989411911 5:41129301-41129323 GAGAGAAAGAAGAAGGAAGAAGG - Intergenic
989427656 5:41315322-41315344 GAGGGAGAGAAAAGGGAAGAAGG + Intronic
990047587 5:51453126-51453148 GAGTGGTAGCACAGTGAAAAAGG + Intergenic
990522787 5:56595775-56595797 CAGTGGTTGAAGAGTGAAGGAGG - Intronic
990755864 5:59069184-59069206 GAGAGGTATAAGGAGGAAGATGG - Intronic
990889911 5:60636677-60636699 TAGTGGAAGAAGAAAGAAGAAGG - Intronic
991286917 5:64988027-64988049 GAGTCCTAGAATAGAGAAGAAGG - Intronic
991481923 5:67090291-67090313 GAGGGGGAGAAGTGGGGAGAGGG - Intronic
991666759 5:69006981-69007003 GAGGGGCACAGGAGGGAAGAAGG + Intergenic
992112704 5:73511234-73511256 AAGAAGCAGAAGAGGGAAGAGGG - Intergenic
993017428 5:82550963-82550985 GAGTGGGAGAAGAGGATAGGTGG - Intergenic
993463861 5:88220209-88220231 GAAGGGAAGAAAAGGGAAGAGGG + Intronic
993484208 5:88462520-88462542 ATGTGGTAGAGGAGGGAAGCAGG + Intergenic
994920781 5:106040182-106040204 TAGAGGTAGAAGAGGGAATGAGG + Intergenic
995243177 5:109908355-109908377 GATAGGCAGCAGAGGGAAGATGG - Intergenic
995679537 5:114701502-114701524 ATGGGGTAGAAGAGGGAAGGTGG - Intergenic
995706880 5:114995972-114995994 GAGTGGTTGGCGATGGAAGAAGG + Intergenic
995735851 5:115298373-115298395 GAGAAGGAGAAGAGAGAAGAAGG + Intergenic
995904018 5:117101662-117101684 GAGTGGCTGAAGAGTGAAGCTGG - Intergenic
996516325 5:124373404-124373426 GAGTGGTAATAGAAAGAAGATGG - Intergenic
996533247 5:124548565-124548587 TAGTGGTGGAAGTGGGAAGGAGG - Intergenic
996837472 5:127809750-127809772 GTAATGTAGAAGAGGGAAGATGG + Intergenic
997098740 5:130944039-130944061 GAGAGGTACCAGAGGAAAGAGGG + Intergenic
997214044 5:132095704-132095726 GCGTGATAGAGGTGGGAAGAGGG - Intergenic
997414847 5:133718614-133718636 GACAGGGAGAAGAGGGAAAAAGG + Intergenic
997476354 5:134144756-134144778 GAGGGGTAGAGCAGGGCAGAGGG - Intronic
998216749 5:140243281-140243303 TGGAGGGAGAAGAGGGAAGAGGG - Intronic
998495549 5:142585535-142585557 TAGTGATAGAAGAGGGAAGCTGG - Intergenic
998495824 5:142588473-142588495 GAGAGAGAGAAGAGAGAAGAGGG - Intergenic
998889948 5:146735339-146735361 GGGTGGGAGAAGAGAGTAGAAGG - Intronic
999090510 5:148931949-148931971 TAGTGGCAGAATAGGGAGGAAGG - Intronic
999197457 5:149792108-149792130 GAGTGGTGGAAAGGGGAACACGG + Intronic
999452866 5:151691506-151691528 GAGTGGTTGGAGAGGGCAGTGGG - Intergenic
1000041250 5:157486682-157486704 GAGTGCCAGCAGAGGGAGGAGGG - Intronic
1000091068 5:157930100-157930122 GAGGGGAAGAAGGGGGAGGAAGG + Intergenic
1000346958 5:160322258-160322280 GGTTGGGAAAAGAGGGAAGAGGG - Intronic
1000644476 5:163744320-163744342 GACTGATAGAAGCGGGTAGAAGG - Intergenic
1001084188 5:168688413-168688435 GAGAGGGAGGAGAGGGATGAGGG - Intronic
1001088642 5:168720575-168720597 GAATGGTAGGAGAAGGAAGGGGG + Intronic
1001127347 5:169031671-169031693 GAGTAGTAGGAGATGGGAGACGG + Intronic
1001189546 5:169615694-169615716 GAGAGGGAGAAGAGTGAAGGAGG - Intergenic
1002702118 5:181131480-181131502 GAGAGGTAGACTAGGGAGGAAGG + Intergenic
1002717286 5:181235465-181235487 GAGTGCTGGAAAAGGGAAGGGGG - Exonic
1003280062 6:4683403-4683425 GAGTGGTACAAATGGGGAGAAGG + Intergenic
1003335499 6:5168129-5168151 CAGTGGGAGAAGAGAGAGGAAGG + Intronic
1003754390 6:9100461-9100483 GAGAGGAAGGAGAGGGAGGAAGG - Intergenic
1004235065 6:13868036-13868058 GAGAGGTAGATTAGGAAAGAGGG + Intergenic
1004250784 6:14021726-14021748 GAGGGGGAGGGGAGGGAAGAAGG - Intergenic
1004297111 6:14422877-14422899 GAATGAGAAAAGAGGGAAGAAGG - Intergenic
1004743448 6:18486508-18486530 ATGTGTTAGAAGAGGGAAGATGG + Intergenic
1004847776 6:19664343-19664365 GAGTGGTAGGAGAGGAAATTGGG - Intergenic
1004899514 6:20181392-20181414 GAGGGGAAGAAGAAGGCAGAAGG - Intronic
1005494200 6:26374635-26374657 GAGCTGTAGAGGAGGGAAGCTGG + Intronic
1005498670 6:26411418-26411440 GAGCTGTAGAAGAGGGAGGCTGG + Intronic
1005690853 6:28304062-28304084 GAGTGGTAGAAGAGGGTCACAGG - Intergenic
1005741825 6:28798943-28798965 GTTTGGTTGAAGAGGCAAGATGG + Intergenic
1006722764 6:36169354-36169376 GAGAGGAAGCAGAGGAAAGATGG - Intergenic
1006728587 6:36218101-36218123 GAGTGGGGGAAGAGAGAAAAAGG - Intronic
1006924638 6:37647757-37647779 GTGTGGGAGAACAGGGGAGAAGG + Intronic
1007359095 6:41342555-41342577 GAGTGGAAGGACAGGGGAGAGGG - Intronic
1007630653 6:43271510-43271532 GAGGGGTAGAAGAGTGAAGCTGG - Intronic
1007923925 6:45635715-45635737 GAGCGGCAGTAGAGGAAAGAAGG + Intronic
1008121610 6:47622954-47622976 AATTGGTAGAAGAGGGAGTAGGG - Intronic
1009339333 6:62533929-62533951 GAGACCTAGAAGAGGGAAGTTGG - Intergenic
1010196878 6:73248426-73248448 GAGAGGAAGGAGGGGGAAGAAGG - Intronic
1010301705 6:74267975-74267997 GTGTGGTAGAACAGGGAAGATGG + Intergenic
1010339465 6:74731362-74731384 GAGTGGGAGAAAAGGGAACCAGG - Intergenic
1010425479 6:75724558-75724580 AACTGGAAGAAGAGAGAAGATGG + Intergenic
1010567259 6:77431384-77431406 AAGTTGCAGAAGAGGAAAGATGG - Intergenic
1010784030 6:79979030-79979052 CTGTGCTAGATGAGGGAAGATGG - Intergenic
1010840782 6:80647443-80647465 GAGTTGTAGAAGACAGAAGGAGG + Intergenic
1011137606 6:84116962-84116984 GAAGGGAAGAAAAGGGAAGAAGG - Intergenic
1011275944 6:85631407-85631429 GAGTGGGGAAAGAGGTAAGAAGG + Intronic
1011716029 6:90105998-90106020 GAGCTTCAGAAGAGGGAAGAAGG + Intronic
1011717041 6:90117343-90117365 GAGAGAGGGAAGAGGGAAGAAGG - Intronic
1011726853 6:90218464-90218486 GGGTGGGGGAAGAGGAAAGAGGG - Intronic
1012861520 6:104565830-104565852 GAGTGGAAGAAGAGGGAAGCAGG - Intergenic
1012966309 6:105677651-105677673 GAGAAGCAGAAGATGGAAGAAGG - Intergenic
1013026031 6:106272559-106272581 GAGTTGTAGAGGAAGGAGGAAGG - Intronic
1013273781 6:108564313-108564335 TAGTGGAAGAAGAGGGAAAAGGG + Intronic
1013273850 6:108565209-108565231 AAGTGATAAAAGAGGTAAGAAGG + Intronic
1013300703 6:108802702-108802724 GAATGATAAAACAGGGAAGAGGG + Intergenic
1013544229 6:111140004-111140026 GAGTGGGAAGAGTGGGAAGAGGG + Intronic
1014045702 6:116883347-116883369 GAGTGGTAGAAGAGGGAAGAGGG - Intronic
1014074160 6:117217426-117217448 GACTGGTAGGTGGGGGAAGAAGG - Intergenic
1014481501 6:121944015-121944037 GAGAGGTAGAAAAGGAAGGATGG - Intergenic
1014545852 6:122734467-122734489 GTGTGGTGACAGAGGGAAGATGG + Intergenic
1014848727 6:126313507-126313529 CAGTGTCAGAGGAGGGAAGAGGG - Intergenic
1015485628 6:133766797-133766819 GAGTGTAAGAAGAGGGAAAAAGG + Intergenic
1015547866 6:134379991-134380013 GAGGAGGAGAAGAAGGAAGAAGG - Intergenic
1016032075 6:139348138-139348160 GAGAGTCAGAAGGGGGAAGACGG + Intergenic
1016045665 6:139477927-139477949 GCAAGGTAAAAGAGGGAAGAAGG + Intergenic
1016071138 6:139740459-139740481 GAAAGGAAGAAGAAGGAAGAAGG - Intergenic
1016154188 6:140783278-140783300 GAGTGTAACAAGAGGGAAGGAGG + Intergenic
1016305688 6:142681340-142681362 GAGTGATAGAAGAGAGGACAGGG + Intergenic
1016347588 6:143130865-143130887 GAGGGGTGGAGGTGGGAAGAGGG - Intronic
1016451026 6:144182407-144182429 GTGTGGTAAAGGAGGGAAGGGGG - Intronic
1016950257 6:149572903-149572925 GAGAGGCAGAGGAGGGTAGATGG - Intronic
1017081490 6:150673651-150673673 GAGAGGGAGGGGAGGGAAGAGGG - Intronic
1017390155 6:153929427-153929449 GAGGGGTGGTAGAGGGAGGAGGG - Intergenic
1017453323 6:154575007-154575029 GAGTGGTTGGTGGGGGAAGAAGG + Intergenic
1018202969 6:161412144-161412166 GAGTGGAAGAATAGTGAGGAAGG - Intronic
1018420151 6:163634135-163634157 AAGTTATGGAAGAGGGAAGAAGG + Intergenic
1018589937 6:165408742-165408764 GCCAGGGAGAAGAGGGAAGAAGG + Intronic
1018674360 6:166206185-166206207 CAATGCCAGAAGAGGGAAGAGGG - Intergenic
1018839423 6:167507838-167507860 GGTGGGTAGAAGAGGGAACAGGG - Intergenic
1018950242 6:168374297-168374319 CAGTGGCAGAAGAGGGATGGCGG - Intergenic
1019074371 6:169376206-169376228 AAGTGGTAGAAGGGGAGAGATGG - Intergenic
1019508412 7:1404943-1404965 GAGAGGGAGGAGAGGGAAGAGGG + Intergenic
1019853941 7:3585693-3585715 GTTTGGTAGGGGAGGGAAGAAGG + Intronic
1020014905 7:4825184-4825206 CAGTTCTAGAAGAGGGCAGAGGG + Intronic
1020026025 7:4900723-4900745 GGGTGGCAGAAGAGGGGATATGG - Intergenic
1020240395 7:6390007-6390029 GAGTAGGAGAGGAGGGAAGGAGG - Intronic
1020850708 7:13348887-13348909 AAGTGGTAAAAGAAGGAAGAGGG + Intergenic
1021292678 7:18865383-18865405 GAGTGGTAAAAGAGAGAAGGGGG + Intronic
1021697127 7:23286348-23286370 GAGTGGAAGGAGGGGGGAGAGGG - Intergenic
1021797224 7:24268461-24268483 GAGTGGAGAAAGAGGCAAGAAGG - Intergenic
1022559274 7:31332578-31332600 GAGTTGAAGAAGAGTGAACAAGG + Intergenic
1022592484 7:31678856-31678878 GCCTGGTCGAAGAGGTAAGATGG + Intergenic
1022625269 7:32029571-32029593 GGGTGGGAGGAGAGGAAAGAAGG + Intronic
1022730454 7:33018336-33018358 GAAGGGTAAAAAAGGGAAGAGGG - Intronic
1022850497 7:34256873-34256895 GAGTCAGAGAAGAGGGAACAAGG - Intergenic
1023006784 7:35878766-35878788 GAAGCGTAGAAGAGGGAAAATGG + Intronic
1023175254 7:37429800-37429822 GAATGGAACTAGAGGGAAGAGGG + Intronic
1023278995 7:38550681-38550703 GAGTGGTGGGAGAGGGAGGAGGG - Intronic
1023542184 7:41277443-41277465 GTCTGGGAGAAGAAGGAAGAAGG - Intergenic
1023693448 7:42818728-42818750 GAGAAGGAGAAGAAGGAAGAAGG + Intergenic
1023878820 7:44307236-44307258 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023878830 7:44307276-44307298 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1024028101 7:45431463-45431485 GAGTGGGAGAAGAGGGAGAGGGG + Intergenic
1024133062 7:46376140-46376162 GTGAGGTAGAATGGGGAAGATGG + Intergenic
1024180625 7:46890290-46890312 GAGAGCTGGAAGAGGGAAAATGG + Intergenic
1024432114 7:49301023-49301045 GACTGGCAGAGAAGGGAAGATGG + Intergenic
1024721396 7:52140828-52140850 GAGTGGTAGAAGAGGTCAGAGGG - Intergenic
1025002742 7:55331123-55331145 GAGTGGGAGGGGAGGGAAGTTGG - Intergenic
1026305246 7:69134735-69134757 GAGAGGAAGAGGAGGAAAGAGGG - Intergenic
1028127878 7:87135278-87135300 GAATGATAGAAGATGGAAAAAGG - Intergenic
1028896497 7:96047595-96047617 GAGTGGTTGCAGAGTGAAAAGGG + Intronic
1029519482 7:101051054-101051076 TCATGGCAGAAGAGGGAAGAAGG + Intronic
1029548115 7:101222058-101222080 GAGGGGTTGAAGATGGGAGAGGG + Intronic
1029875059 7:103741802-103741824 GAGGGGGAGAAGAGCCAAGATGG + Intronic
1030508649 7:110455944-110455966 GAGAGAGAGAAGAGAGAAGAGGG + Intergenic
1030511169 7:110483731-110483753 GAGTGATAGATGAAAGAAGAGGG - Intergenic
1030799096 7:113827311-113827333 GAGGAGTAGAAGAGAGAAAATGG + Intergenic
1031348050 7:120693569-120693591 AAGTGGAGGAAGAGGGAAAAAGG + Intronic
1031361328 7:120852210-120852232 GTGGGGTAGAAAAGGTAAGAAGG + Intronic
1031621133 7:123935232-123935254 GAGTGATTGAAGATGCAAGAAGG - Intronic
1031886989 7:127253365-127253387 GAGCGGTAGAAGAAGGAATATGG + Intergenic
1032012027 7:128352891-128352913 GAGAAGTAGGAGAAGGAAGAGGG - Intronic
1032149662 7:129417324-129417346 GAGTGGAAGATGAGGTCAGAGGG + Intronic
1032530407 7:132615286-132615308 GAGTGGTGGCAGAGGGAGCAGGG + Intronic
1032961682 7:137042489-137042511 GAGAGAGAGAAGAGGGAAGAGGG - Intergenic
1033136151 7:138786128-138786150 GAGGTGGAGAAGAGGGAAGCTGG - Intronic
1033910427 7:146257303-146257325 GAGTGGTATAGGAAGAAAGATGG + Intronic
1034422069 7:150995646-150995668 CAGGGGTGGGAGAGGGAAGAGGG - Intronic
1034582321 7:152055968-152055990 GGGTTGTGGAAGGGGGAAGATGG - Intronic
1034928516 7:155142097-155142119 GAGAGGGAGAAGAGGGAGGGAGG - Intergenic
1035419667 7:158717150-158717172 GAGGAGGAGAAGAAGGAAGAAGG - Intergenic
1035419693 7:158717283-158717305 GAGGAGGAGAAGAAGGAAGAAGG - Intergenic
1035419753 7:158717611-158717633 GAGGAGGAGAAGAAGGAAGAAGG - Intergenic
1035419768 7:158717685-158717707 GAGGAGGAGAAGAAGGAAGAAGG - Intergenic
1035587674 8:788147-788169 GTGTGGTAGAAGATGGGTGAAGG + Intergenic
1035628582 8:1091782-1091804 GAGGGGTAGGAGTGGGGAGAGGG - Intergenic
1036505376 8:9350022-9350044 GGGTGGGAGAGGAGAGAAGAGGG + Intergenic
1036535520 8:9646978-9647000 GAGAGGTAGCAGAGCAAAGATGG + Intronic
1036962834 8:13264584-13264606 GAGCGGGAGAGGAGGGAAGGAGG + Intronic
1037061027 8:14509821-14509843 AAGTGGCAGGAGAGAGAAGAGGG + Intronic
1037373390 8:18203921-18203943 GACTGGCAGAGAAGGGAAGATGG - Intronic
1037591736 8:20318073-20318095 GAGAGAAGGAAGAGGGAAGAGGG - Intergenic
1038093282 8:24278654-24278676 AAGTGGTAGAAAGGGGAACATGG + Intergenic
1038253443 8:25927645-25927667 GAGTGTTAGAAGAGGGGACAGGG + Intronic
1038259600 8:25981296-25981318 CAGTGCTAGGTGAGGGAAGATGG - Intronic
1038652756 8:29420692-29420714 GAGTGGGAGAAGAGGGAGACAGG + Intergenic
1039088763 8:33806028-33806050 GAGTGGGACAAGGAGGAAGAGGG - Intergenic
1039407852 8:37328236-37328258 GAGAGAGAGAAGAAGGAAGAAGG - Intergenic
1039511131 8:38092787-38092809 GACTGGCAGAAAAGGGAAAATGG + Intergenic
1040818007 8:51529251-51529273 GAGTGGGAGAAGGGATAAGAGGG - Intronic
1041603616 8:59753510-59753532 GAGTGGTGGAAGGGGAATGAGGG + Intergenic
1041846154 8:62331126-62331148 GGGTGGAAGAGGAGGGAGGAAGG - Intronic
1042157862 8:65864642-65864664 GAGGGTTTGAAGGGGGAAGAGGG - Intergenic
1042386038 8:68175555-68175577 GAGTGGAAGAAAAAGGCAGAAGG + Intronic
1042507240 8:69573695-69573717 GAGATGTAGAAGTGGAAAGAGGG - Intronic
1042574542 8:70203375-70203397 TACTGGTAGAAGAAGGGAGAGGG - Intronic
1043398184 8:79858454-79858476 GATAGGAAGAAGAGTGAAGATGG - Intergenic
1044167337 8:89002979-89003001 AATTGGTAGAAAATGGAAGAGGG + Intergenic
1044372814 8:91433259-91433281 GGGTGGCAAAAGAGGGAGGAGGG + Intergenic
1044789437 8:95832692-95832714 GTGTGGGAGAAGGGGGCAGATGG + Intergenic
1044844802 8:96370372-96370394 GAGTGGTAGAAGGGTGAATGAGG - Intergenic
1046223428 8:111245090-111245112 GCGTGGTAGCAGAGGGTGGATGG + Intergenic
1046470589 8:114668524-114668546 GAGAGGTCAAAGATGGAAGATGG + Intergenic
1046617643 8:116495080-116495102 CAGTGGGAGAAGAGGGTACAAGG - Intergenic
1046798625 8:118399502-118399524 GACTGGTAGATGAGGGAGGCAGG + Intronic
1046945629 8:119971681-119971703 GAGGGGCAGAAGCGGGGAGAAGG + Intronic
1047081069 8:121460906-121460928 GAGAGGTAGAAGAGAGCTGAGGG - Intergenic
1047416229 8:124666828-124666850 GAGTTTTCAAAGAGGGAAGAGGG + Intronic
1047647686 8:126886163-126886185 GTGTTTAAGAAGAGGGAAGAAGG - Intergenic
1048357780 8:133667581-133667603 GAGTGGGAGGAGGAGGAAGAGGG - Intergenic
1049566498 8:143341816-143341838 AAGAGGAAGAAGAAGGAAGAAGG - Intronic
1049856405 8:144864689-144864711 GTGTGGTAGAAGAGGGACTATGG + Intergenic
1050230990 9:3525986-3526008 GAGGGGTGGGGGAGGGAAGAGGG + Intronic
1050315681 9:4398528-4398550 GGGTGGAAGAAGAAAGAAGAAGG - Intergenic
1050365749 9:4872219-4872241 TAGGGTTAGAAGAGAGAAGAGGG + Intronic
1050742617 9:8839766-8839788 CAGTGGGAGAAATGGGAAGAAGG + Intronic
1051263719 9:15290775-15290797 GAGTGGCAGAAGGGGAAAGCAGG - Intronic
1051386577 9:16515473-16515495 GTGGGATAGAACAGGGAAGAGGG - Intronic
1051417980 9:16862756-16862778 GAGTAGTAGAAGAGAAAAGAGGG - Intronic
1052020033 9:23515212-23515234 GACTGGTAGAAGAGGGTTGGGGG + Intergenic
1052477518 9:28979358-28979380 GGGTGGTAGAAAAGGTAAAAAGG + Intergenic
1052938080 9:34110107-34110129 GAGTGGGAGCAGGGGGAAGAAGG + Intronic
1052970407 9:34373800-34373822 GAGGGGGAGAGGAGGGAGGAAGG + Intronic
1053096178 9:35329855-35329877 CCATGGCAGAAGAGGGAAGAGGG + Intronic
1053288976 9:36867695-36867717 GAGAGATAAAAGAGGGAGGAAGG - Intronic
1053527885 9:38847935-38847957 CAGTGCTAAAACAGGGAAGAGGG - Intergenic
1054200106 9:62072371-62072393 CAGTGCTAAAACAGGGAAGAGGG - Intergenic
1054454076 9:65420545-65420567 GAGAGGGATAGGAGGGAAGAAGG + Intergenic
1054530504 9:66178578-66178600 GGGGGGTAGATGGGGGAAGAGGG - Intergenic
1054638249 9:67515989-67516011 CAGTGCTAAAACAGGGAAGAGGG + Intergenic
1055548222 9:77404891-77404913 GACTGGTAAAAGAGGGGAGCAGG + Intronic
1056241976 9:84656809-84656831 GTGTGGAAGAAGATGGAAGGTGG + Intergenic
1056523371 9:87420554-87420576 GAGAGAGAGAAGAGGGAACAAGG + Intergenic
1057369441 9:94456935-94456957 GGGTGGGAAAAGAGGGAAGAAGG - Intronic
1057723792 9:97554268-97554290 GTGAGGTAGAAGAGTGAAGCAGG + Intronic
1057745234 9:97745858-97745880 TAGTGGGTGAAGAGGAAAGAGGG - Intergenic
1057858401 9:98620614-98620636 GGGTAGCAGAAGAGGTAAGAAGG + Intronic
1059502318 9:114765823-114765845 GAGCGGGAGAGGAGTGAAGAGGG - Intergenic
1060188572 9:121578358-121578380 TAGGGGGAGAGGAGGGAAGAGGG - Intronic
1060257728 9:122047315-122047337 GACTAGGAGATGAGGGAAGAAGG + Intronic
1060675880 9:125514154-125514176 TAGGTGAAGAAGAGGGAAGAGGG - Intronic
1061131866 9:128712994-128713016 TGGTGGTAGCAGTGGGAAGATGG + Intronic
1061255657 9:129453353-129453375 GAGGGGTGGAAGAGGGGGGATGG + Intergenic
1061466039 9:130780589-130780611 GAGAGGGAGATGAGGGAAGAGGG - Intronic
1185688228 X:1948141-1948163 AAGTGGTAGGAGAGGGTAGAAGG + Intergenic
1185688305 X:1948375-1948397 GAGGGGAGGAAGAGGGGAGAGGG + Intergenic
1185688341 X:1948485-1948507 GAGGGGGAGGAGAGGGTAGAAGG + Intergenic
1185688517 X:2133680-2133702 AAGTGGTAGGAGAGGGTAGAAGG + Intergenic
1185688619 X:2134007-2134029 GAGGGGGAGGAGAGGGTAGAAGG + Intergenic
1186532851 X:10314690-10314712 GAGAGGCAGGAGAGGGAAGGTGG + Intergenic
1186684133 X:11906811-11906833 GAGTGCTAGAAGAAGAAAGAAGG - Intergenic
1186851091 X:13580869-13580891 GAATGATATAAGATGGAAGATGG - Intronic
1187073579 X:15912248-15912270 TAGTGATAGTAGAGGGAACAGGG + Intergenic
1187571534 X:20508619-20508641 TAGTGGTAGAAGATGCCAGATGG + Intergenic
1187830249 X:23374013-23374035 GAGTAGAAGAAGTGGGAAGGGGG + Intronic
1187951553 X:24475706-24475728 GAAAGGTAGAAGACGGAAGGAGG + Intronic
1190089680 X:47426987-47427009 GAAAGGGGGAAGAGGGAAGAGGG - Intergenic
1190098191 X:47499594-47499616 GGAGGGAAGAAGAGGGAAGATGG + Intergenic
1190237505 X:48628311-48628333 GGGTGGAGGGAGAGGGAAGAAGG + Intergenic
1190291758 X:48997645-48997667 GAGAGATAGAAAAGGGGAGAGGG + Intronic
1190427539 X:50346881-50346903 GAGTGGTAGGAAAGGGGAAAGGG + Intronic
1190444017 X:50504933-50504955 GAGTGGAGGAGGAGGGAAAAGGG - Intergenic
1190713877 X:53088212-53088234 GACTGGGAGAAGTGGGTAGAGGG - Exonic
1190723652 X:53172102-53172124 GAGAGGAAGAAGAGGGAGGGAGG + Intergenic
1191719797 X:64219992-64220014 GGGTGGTACAAGAGTCAAGAAGG + Intergenic
1191775229 X:64806784-64806806 GAGTAGTAGAAGAGGTCAGAGGG + Intergenic
1191976503 X:66877762-66877784 GAGTGGGAGAAGGGAGAGGAGGG - Intergenic
1192742880 X:73910798-73910820 GAGAGGCTGAAGTGGGAAGATGG - Intergenic
1192873793 X:75208538-75208560 GTGTGGTAGATGGGGGAATATGG + Intergenic
1193727237 X:85056899-85056921 GGGAGTTAGAAGTGGGAAGAAGG - Intronic
1193819015 X:86139424-86139446 TAGTAGTAGAAAAGGGAAGAGGG - Intergenic
1194992930 X:100564111-100564133 CAGTGGAGGAAGAGGGAAGAGGG + Intergenic
1195679288 X:107531719-107531741 GTGTGGTAGCAGAGGGTGGAGGG - Intronic
1196196247 X:112840905-112840927 GAGGGGTGGACGAGGGAGGAAGG + Intergenic
1197286160 X:124597533-124597555 GAGGGATAGAGGATGGAAGATGG + Intronic
1197651604 X:129071542-129071564 GAGGGGGAAAAGAGGGAGGAAGG + Intergenic
1197705470 X:129631534-129631556 GAGTGGAAGAGGAGGGTACAGGG + Intergenic
1199390419 X:147271582-147271604 GAGTGGTAGGAGAAGGTATAGGG + Intergenic
1200045882 X:153400903-153400925 GCGGGGTAGAAGAGGCAAGAGGG - Intergenic
1201146591 Y:11068046-11068068 GGGAGGGAGAAGAAGGAAGAGGG + Intergenic
1201146605 Y:11068095-11068117 GAGAGGGAGAAGAAGGAAGAGGG + Intergenic
1201254001 Y:12089203-12089225 GCATGGTGGAAGAAGGAAGAAGG - Intergenic
1201888817 Y:18919175-18919197 AAGGTGTAGAAGAAGGAAGAAGG + Intergenic
1202330536 Y:23748037-23748059 GAGAGAGAGAAGAGGAAAGAGGG - Intergenic
1202347830 Y:23953616-23953638 GAGAGAGAGAAGAGGAAAGAGGG - Intergenic
1202368740 Y:24183510-24183532 GAGTGGACAAACAGGGAAGAAGG + Intergenic
1202502045 Y:25486607-25486629 GAGTGGACAAACAGGGAAGAAGG - Intergenic
1202522943 Y:25716475-25716497 GAGAGAGAGAAGAGGAAAGAGGG + Intergenic
1202540233 Y:25922024-25922046 GAGAGAGAGAAGAGGAAAGAGGG + Intergenic