ID: 1014046803

View in Genome Browser
Species Human (GRCh38)
Location 6:116898172-116898194
Sequence TCTCCACTTAACTAATTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 133}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014046803_1014046808 20 Left 1014046803 6:116898172-116898194 CCATGGAATTAGTTAAGTGGAGA 0: 1
1: 0
2: 1
3: 6
4: 133
Right 1014046808 6:116898215-116898237 AGCCTTTCCAGTGGTGAGCTGGG 0: 1
1: 0
2: 0
3: 17
4: 139
1014046803_1014046811 26 Left 1014046803 6:116898172-116898194 CCATGGAATTAGTTAAGTGGAGA 0: 1
1: 0
2: 1
3: 6
4: 133
Right 1014046811 6:116898221-116898243 TCCAGTGGTGAGCTGGGGTTTGG 0: 1
1: 0
2: 6
3: 30
4: 279
1014046803_1014046807 19 Left 1014046803 6:116898172-116898194 CCATGGAATTAGTTAAGTGGAGA 0: 1
1: 0
2: 1
3: 6
4: 133
Right 1014046807 6:116898214-116898236 GAGCCTTTCCAGTGGTGAGCTGG No data
1014046803_1014046804 -6 Left 1014046803 6:116898172-116898194 CCATGGAATTAGTTAAGTGGAGA 0: 1
1: 0
2: 1
3: 6
4: 133
Right 1014046804 6:116898189-116898211 TGGAGATAACTAATGATTTCAGG 0: 1
1: 0
2: 1
3: 15
4: 188
1014046803_1014046805 -5 Left 1014046803 6:116898172-116898194 CCATGGAATTAGTTAAGTGGAGA 0: 1
1: 0
2: 1
3: 6
4: 133
Right 1014046805 6:116898190-116898212 GGAGATAACTAATGATTTCAGGG No data
1014046803_1014046806 11 Left 1014046803 6:116898172-116898194 CCATGGAATTAGTTAAGTGGAGA 0: 1
1: 0
2: 1
3: 6
4: 133
Right 1014046806 6:116898206-116898228 TTCAGGGAGAGCCTTTCCAGTGG 0: 1
1: 0
2: 0
3: 21
4: 184
1014046803_1014046809 21 Left 1014046803 6:116898172-116898194 CCATGGAATTAGTTAAGTGGAGA 0: 1
1: 0
2: 1
3: 6
4: 133
Right 1014046809 6:116898216-116898238 GCCTTTCCAGTGGTGAGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014046803 Original CRISPR TCTCCACTTAACTAATTCCA TGG (reversed) Intronic