ID: 1014046809

View in Genome Browser
Species Human (GRCh38)
Location 6:116898216-116898238
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014046803_1014046809 21 Left 1014046803 6:116898172-116898194 CCATGGAATTAGTTAAGTGGAGA 0: 1
1: 0
2: 1
3: 6
4: 133
Right 1014046809 6:116898216-116898238 GCCTTTCCAGTGGTGAGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr