ID: 1014048729

View in Genome Browser
Species Human (GRCh38)
Location 6:116926552-116926574
Sequence CTGGCGGCCCAGAGAGTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 156}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014048724_1014048729 -3 Left 1014048724 6:116926532-116926554 CCATTTCTACCAATGGAACACTG 0: 1
1: 0
2: 3
3: 15
4: 162
Right 1014048729 6:116926552-116926574 CTGGCGGCCCAGAGAGTTGGTGG 0: 1
1: 0
2: 3
3: 15
4: 156
1014048722_1014048729 14 Left 1014048722 6:116926515-116926537 CCTTATAGTTCAGGAGTCCATTT 0: 1
1: 0
2: 0
3: 12
4: 185
Right 1014048729 6:116926552-116926574 CTGGCGGCCCAGAGAGTTGGTGG 0: 1
1: 0
2: 3
3: 15
4: 156
1014048720_1014048729 24 Left 1014048720 6:116926505-116926527 CCTAGAAGAGCCTTATAGTTCAG 0: 1
1: 0
2: 0
3: 6
4: 120
Right 1014048729 6:116926552-116926574 CTGGCGGCCCAGAGAGTTGGTGG 0: 1
1: 0
2: 3
3: 15
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014048729 Original CRISPR CTGGCGGCCCAGAGAGTTGG TGG Intronic
900137204 1:1122606-1122628 CTGGCGACTCAGCGAGGTGGGGG + Intergenic
900949550 1:5850613-5850635 CTGGTGGCCCAGAGACCTGGGGG - Intergenic
901469845 1:9448636-9448658 CAGGCAGCCCAGGGAGTGGGAGG + Intergenic
901666306 1:10828151-10828173 CTGGCAGCTCCGAGTGTTGGCGG + Intergenic
901779242 1:11582096-11582118 CTGGGGGCACAGACATTTGGAGG + Intergenic
903365400 1:22802666-22802688 CAGGAGGTCCAGGGAGTTGGGGG - Intronic
905314407 1:37072597-37072619 CTGGCTGGGCAGAGGGTTGGGGG - Intergenic
905446977 1:38033988-38034010 CTGGTGGCCCTGAGAGTTTGGGG + Intergenic
906147878 1:43570643-43570665 CTGGCATCCCAGGGAGTGGGAGG - Intronic
906647079 1:47482999-47483021 CTGTGGCCCCAGAGAGTGGGAGG + Intergenic
910158229 1:84244632-84244654 CTGGTGTCCCAGAGAGTGAGAGG - Intergenic
910431035 1:87159978-87160000 CTGCAGGCCCAGAGAGTTTAAGG - Intronic
913058964 1:115187416-115187438 GTGGTGGCCCAGAGAGGTGGTGG - Intergenic
913965807 1:143376841-143376863 ATGGTGGTGCAGAGAGTTGGGGG - Intergenic
914060181 1:144202449-144202471 ATGGTGGTGCAGAGAGTTGGGGG - Intergenic
914118969 1:144763920-144763942 ATGGTGGTGCAGAGAGTTGGGGG + Intergenic
919490400 1:198198461-198198483 CTGCAGGCCCAGAGAGTTTAAGG + Intronic
919843194 1:201623749-201623771 GTGGAGGCCTACAGAGTTGGGGG + Intronic
921482044 1:215674808-215674830 CTGACGGCCCAAAGATCTGGAGG + Exonic
923190877 1:231619473-231619495 CTGTCTGCCCAGAGACTTGTTGG - Intronic
923621645 1:235584227-235584249 CTAGCAGCCCATACAGTTGGTGG + Intronic
1065140349 10:22714000-22714022 TGGGCGGCCCAGAGGGCTGGGGG + Intronic
1067456890 10:46425514-46425536 TTGGAGGCCCAGAGGGTAGGGGG - Intergenic
1067630313 10:47959125-47959147 TTGGAGGCCCAGAGGGTAGGGGG + Intergenic
1069593175 10:69654483-69654505 TTGGTGGCCCAGAGAGGAGGGGG + Intergenic
1071368727 10:84928345-84928367 CTGGCTGTCCAGAGTGTGGGAGG + Intergenic
1072682724 10:97518202-97518224 CTTGGGGCCCACAGAGCTGGGGG + Intronic
1073486060 10:103819887-103819909 CTGGGGGCCCAGAGCCTTTGGGG - Intronic
1074912665 10:117925601-117925623 CTGGTGGCCCAGAGAGTGGGAGG - Intergenic
1077501638 11:2912171-2912193 CTGGCTGCCCAGAGTGGTGGTGG + Intronic
1077538447 11:3135398-3135420 CTGGAGGGCCAGAGAGTAAGGGG + Intronic
1079135232 11:17772736-17772758 CTGGGGGCCCAGGGAGATGCTGG + Intronic
1088475636 11:110235885-110235907 CTGGGGGACCAGAGAGTTGTCGG - Intronic
1088849650 11:113694601-113694623 CTGGCTTCCCGGATAGTTGGTGG - Exonic
1089750600 11:120648563-120648585 CTGGCTGCCCAGAGAGAAGCTGG - Intronic
1090397174 11:126426713-126426735 ATCCCGGCCCAGAGAGTAGGAGG - Intronic
1094219029 12:27973919-27973941 CAGGAGGCCCAGAGAGGAGGCGG + Intergenic
1096503297 12:52078559-52078581 CTGGGGCATCAGAGAGTTGGAGG + Intergenic
1100354316 12:93814691-93814713 CTGGAGGCTCAGAGAGTTGGTGG - Intronic
1102255175 12:111410839-111410861 AAGGAGGCCCAGAGAGTTGTGGG - Intronic
1103711779 12:122918092-122918114 CTGGCTGCCCGGGGTGTTGGGGG + Intergenic
1106480362 13:30133079-30133101 CCGAGAGCCCAGAGAGTTGGTGG + Intergenic
1107387366 13:39926405-39926427 CTTGGGTCCCAGGGAGTTGGGGG + Intergenic
1108376000 13:49814757-49814779 CTGGCCTCCCAGAGAGGTGAGGG - Intergenic
1112349758 13:98623006-98623028 CAGGCGGCCCAGAGGAATGGAGG + Intergenic
1112572511 13:100606847-100606869 TGGGCGGCCCAGAGTGTTGTAGG - Intronic
1113335577 13:109373057-109373079 CTGTAGGCTCAGAGGGTTGGAGG + Intergenic
1113513371 13:110872894-110872916 CTGAATGCCCAGAGAATTGGGGG + Intergenic
1118346410 14:64944378-64944400 CTGGAGGCCCAGAGAGTACTAGG - Intronic
1118849395 14:69572753-69572775 CGGGCGGCCCGGAGCGTTGGTGG + Exonic
1120131716 14:80815941-80815963 CTGGAGACCCAGAGGGTGGGAGG + Intronic
1121013369 14:90534572-90534594 CTGTCGGCCTTGAGAGGTGGTGG + Exonic
1121562292 14:94884576-94884598 TTGGAGGCCCAGAGAGGAGGGGG - Intergenic
1121694435 14:95901350-95901372 CTTCCTCCCCAGAGAGTTGGGGG + Intergenic
1122278119 14:100605558-100605580 CGGGTGGCCCAGAGTGTGGGTGG + Intergenic
1122327355 14:100890653-100890675 CTGGCAGCCCAGAGAGCCAGGGG - Intergenic
1124531922 15:30516170-30516192 CTGGGGGCCCTTAGAGTGGGTGG + Intergenic
1124766731 15:32491475-32491497 CTGGGGGCCCTTAGAGTGGGTGG - Intergenic
1127414934 15:58749216-58749238 CTGGCGGCCCCGGGAGGCGGGGG - Intronic
1128092024 15:64925787-64925809 GTGGAGGCTCAGAGAGGTGGAGG + Intronic
1128108728 15:65062897-65062919 CTGGCCTCCCAGAGAGTCTGAGG + Intronic
1128557836 15:68643610-68643632 GTTGGGGCCCAGAGAGCTGGTGG + Intronic
1129055123 15:72813858-72813880 CTAGCTCCCCAGAGACTTGGAGG + Intergenic
1129937571 15:79463425-79463447 TTGGGGGCCCAGGGAGTTGAAGG - Intronic
1129969913 15:79769179-79769201 CAGGCGGCCCTGAGGGATGGAGG - Intergenic
1132544507 16:527201-527223 CTGGCGGCCAAGAGCGGCGGTGG - Intergenic
1138599521 16:58046434-58046456 CTGGGGGCACAGGGAGCTGGAGG - Exonic
1141156018 16:81597668-81597690 CTGGAGCCCCACGGAGTTGGTGG - Intronic
1143136686 17:4716261-4716283 AGGGCGCCCCAGAGAGATGGAGG + Intronic
1149330544 17:55576867-55576889 CTGGGAGCACAGAGAGTAGGAGG + Intergenic
1151969254 17:77449474-77449496 CTGGGGGGCCAGAAAGCTGGGGG + Intronic
1152340263 17:79720513-79720535 ATGGTGGCACAGAGAGCTGGAGG + Intergenic
1152421121 17:80193709-80193731 CTGGCCACTCAGAGAGCTGGGGG + Intronic
1159221385 18:65468564-65468586 CTGGCAGTCCAGAAAATTGGAGG - Intergenic
1160078839 18:75703934-75703956 CTGGGGTCACAGAGACTTGGGGG + Intergenic
1160078867 18:75704046-75704068 CTGGAGGCACAGAGACTTGGAGG + Intergenic
1160153547 18:76413634-76413656 GTGGCAGCCCAGATATTTGGGGG - Intronic
1160788361 19:912170-912192 GGGGCGGACCAGGGAGTTGGGGG + Intronic
1160877464 19:1303535-1303557 CTGGCCTCCCAGAGTGCTGGGGG + Intergenic
1161288124 19:3479141-3479163 CTGGGGGCCCAGAGAGGGGAGGG + Intronic
1161366415 19:3882156-3882178 CTGGATGCCATGAGAGTTGGGGG + Intronic
1161847425 19:6719711-6719733 CTGGAAGTCCAGAGACTTGGAGG - Intronic
1162128326 19:8511171-8511193 CTGTCTGCCCCTAGAGTTGGGGG + Intronic
1162753177 19:12841113-12841135 ATGGCGGCCCAGACAGTGGTTGG - Intronic
1163742568 19:19024914-19024936 CTTCCGGCAGAGAGAGTTGGTGG + Exonic
1164157393 19:22604899-22604921 CTAGCAGCCTAGAGACTTGGAGG + Intergenic
1165173047 19:33906733-33906755 ACGGCGGCCCACAGAGGTGGTGG - Intergenic
1165490863 19:36121884-36121906 CTGACGGCCCAGAGTGTTTGTGG + Intronic
1167026624 19:46924291-46924313 CTGCGGGCCCCGAGAGATGGAGG + Intronic
1167366756 19:49058556-49058578 CTGGGGACCCAGAAAGATGGGGG - Exonic
1202699585 1_KI270712v1_random:154334-154356 ATGGTGGTGCAGAGAGTTGGGGG - Intergenic
927250628 2:20992235-20992257 CTGGCCTCCCAGAGAGCTGAGGG + Intergenic
928118466 2:28564710-28564732 CTGGCCTCCCAGGCAGTTGGGGG - Intronic
934170529 2:89537822-89537844 ATGGTGGTGCAGAGAGTTGGGGG - Intergenic
934280831 2:91612142-91612164 ATGGTGGTGCAGAGAGTTGGGGG - Intergenic
942248235 2:174026338-174026360 CTGGCTGCCCACAGGGTTGGTGG - Intergenic
945983975 2:216339897-216339919 CAGGAGGCCCAGAGAGATGGTGG - Intronic
947839294 2:233197475-233197497 CTGGCAGGGCAGAGAGATGGTGG - Intronic
948559797 2:238844936-238844958 TTGGCCTCCCAAAGAGTTGGGGG + Intergenic
948903828 2:240968555-240968577 CTGGGGGCACAGCGAGTGGGGGG + Intronic
1169009257 20:2236687-2236709 CTGGCTGCGCAGGGAGATGGGGG + Intergenic
1169455625 20:5749974-5749996 CTGTAGGCCCAGGTAGTTGGGGG - Intergenic
1169564716 20:6841394-6841416 CTGGAGGCAGAGAGATTTGGAGG + Intergenic
1171239270 20:23551840-23551862 CTGGAGATGCAGAGAGTTGGGGG + Intergenic
1172620070 20:36312946-36312968 ATGGAGGCCCAGAGAGGTGCAGG - Intronic
1175872574 20:62215471-62215493 TTGGGGGCAGAGAGAGTTGGTGG + Exonic
1176146812 20:63569136-63569158 CTGGTGGCCAAGTGAGCTGGGGG - Exonic
1180057189 21:45365068-45365090 CTGGGACCCCAGAGAGTAGGAGG - Intergenic
1181535075 22:23537620-23537642 CTGGGGACCCAGAGAGAAGGAGG + Intergenic
1181772305 22:25134648-25134670 CCTCCAGCCCAGAGAGTTGGAGG + Intronic
1181829138 22:25545428-25545450 CTGGAGGGCCAGAGAGATCGTGG - Intergenic
1182417013 22:30227887-30227909 ATGGAGGCCCAGAGAAGTGGTGG - Intergenic
1183167758 22:36160473-36160495 TTGGGGGCCCAGAGAGAGGGAGG + Intronic
1183190564 22:36319747-36319769 CTGTGGCCCCAGGGAGTTGGGGG - Intronic
1183367906 22:37416946-37416968 CTGGCTGCGCACAGTGTTGGTGG - Intronic
1183504222 22:38200186-38200208 CTGGAGGCTCAGAGAGGTGAAGG - Intronic
1184103823 22:42355758-42355780 CTGGAGGCCTAGAGACCTGGAGG + Intergenic
1184411794 22:44330429-44330451 CAGGAGGCCCAGAGAGGTAGGGG + Intergenic
1185157525 22:49203194-49203216 CTGAGGGCGCAGAGAGATGGAGG - Intergenic
952653869 3:35760290-35760312 CTGGTGGCCCTCAGGGTTGGTGG + Intronic
957792666 3:84959789-84959811 CTGCCGCACCAGAGAGTAGGGGG - Intronic
961654328 3:128433043-128433065 CCCGCGGCCCGGAGATTTGGGGG - Intergenic
966886594 3:184380565-184380587 CGGGCGGCCCGGAGGGTGGGCGG + Intronic
968323366 3:197791249-197791271 CTGGCGGGCCCGAGTGTTGTCGG + Intronic
968483104 4:845566-845588 TTGGAGGCCCACAGAGTTGGGGG + Intergenic
968578765 4:1380068-1380090 CTGGAAGCCCAGCGAGGTGGAGG + Exonic
969967566 4:11012975-11012997 CTGGAGTTCCACAGAGTTGGTGG + Intergenic
971244106 4:24912995-24913017 CTGGCGGCCGCGAGAGGCGGCGG - Intronic
971352241 4:25864095-25864117 CTGCGGGCCCAGATAGTTGTCGG - Intronic
979633225 4:122926952-122926974 CTGGCAGCACAGAGTGCTGGAGG + Intronic
983906372 4:173186855-173186877 CAGGAGACCCAGGGAGTTGGAGG - Intronic
989523259 5:42424738-42424760 CTGGCGGCGCAGAGGGTGCGGGG + Intronic
992170618 5:74098164-74098186 CTGGAGGACCACTGAGTTGGTGG - Intergenic
992226206 5:74621584-74621606 CTGGCATCCCACACAGTTGGAGG + Intergenic
995412266 5:111872169-111872191 CTGGAGACCCAGAGAGTTGATGG + Intronic
1001236410 5:170033212-170033234 CTGGCAGCCCACAGACTAGGTGG - Intronic
1006436670 6:34029325-34029347 ATGGGGGCCCATAGAGCTGGGGG - Intronic
1007473419 6:42104885-42104907 CTGGCGGCCCAGATACTGGAGGG + Exonic
1014048729 6:116926552-116926574 CTGGCGGCCCAGAGAGTTGGTGG + Intronic
1014961704 6:127694836-127694858 TTGGAGGGCCAGAGAGTTGGAGG - Intergenic
1019384617 7:747634-747656 GTGGTGGCCCACAGTGTTGGTGG + Intronic
1019643421 7:2116550-2116572 GTGGCAGGCCAGAGGGTTGGGGG + Intronic
1021790008 7:24195395-24195417 CTGGATGCCCAGAGACTTTGGGG + Intergenic
1023915033 7:44582268-44582290 CTAGCGACCCTGAGAGTTAGGGG + Intronic
1024284348 7:47744409-47744431 CTGGACGCCCAGAGGGGTGGAGG + Intronic
1026297049 7:69062196-69062218 CAGGCTGCCCAGATATTTGGTGG - Intergenic
1026383043 7:69818300-69818322 CTGCCAGCCAAGAGAGTTGTAGG + Intronic
1026535719 7:71237070-71237092 TTGGGGGTCCAGAGAGTGGGAGG + Intronic
1027052753 7:75030095-75030117 CTGGTGGCCGAGAGAGCTTGTGG + Intronic
1029551114 7:101237606-101237628 CTGGTGCCCCAGAGAGGGGGAGG + Exonic
1030314326 7:108098404-108098426 CTGGCAGCCCAGGGGGTCGGTGG + Exonic
1034413874 7:150955090-150955112 ATGGGTGCCCAGAGAGATGGTGG - Intronic
1034820946 7:154215794-154215816 CTGGCGACCCAGAGAGGGGAAGG - Intronic
1036223646 8:6940868-6940890 CTGGCATCCCAGAGAGCTGCTGG - Intergenic
1036625796 8:10470384-10470406 CTGGAGGCCAGGAGAGTTGGTGG + Intergenic
1038015114 8:23508232-23508254 ATGGCGGCCCAGAGAGGTGGAGG + Intergenic
1038553576 8:28490431-28490453 GTGGCGGCCAAGAGCGTGGGAGG + Intergenic
1039545730 8:38409859-38409881 CGGGAGGCTCAAAGAGTTGGTGG - Intergenic
1043566320 8:81552499-81552521 CTGGATGGCAAGAGAGTTGGAGG + Intergenic
1046962554 8:120125958-120125980 CTCCCGGCGCAGAGAGGTGGAGG - Intronic
1049277763 8:141728448-141728470 CTGGAGGGGCAGAGAGTTGGGGG - Intergenic
1053003719 9:34591280-34591302 CCGGCGGCCCAGAGAGCCCGGGG - Intergenic
1058633810 9:107017278-107017300 CTGGTGCCCCAGAAAGTTGAAGG + Intergenic
1060545077 9:124454703-124454725 CTGTAGCCCCTGAGAGTTGGCGG + Intronic
1061944689 9:133902054-133902076 CTTTTGGCCCAGAGAGGTGGGGG - Intronic
1203792135 EBV:157452-157474 CTGGCGGCGCAGGGAGTCGTAGG + Intergenic
1187098249 X:16168544-16168566 GTCGCGTCCCAAAGAGTTGGAGG + Intronic
1189268921 X:39736686-39736708 TTGGAGGCTCAGAGAGTGGGTGG - Intergenic
1189361076 X:40351929-40351951 CTGCAGGCCCAGAGGGTTTGGGG + Intergenic
1192087044 X:68110530-68110552 CCTGTGGCCCAGAGAGTGGGAGG + Intronic
1192944484 X:75950266-75950288 CTGGCAGCCAAGGGAGGTGGTGG - Intergenic
1196859210 X:120011740-120011762 TGGGGGGCCCAGAGAGTTTGTGG + Intergenic
1197785298 X:130191989-130192011 CTGCCTGACCAGAGTGTTGGGGG - Intergenic
1199966374 X:152824148-152824170 CGGGTGGACCAGAGAGATGGAGG - Intergenic
1200783327 Y:7236651-7236673 CTGGGGACCCAGAAAGTTAGAGG + Intergenic