ID: 1014057252

View in Genome Browser
Species Human (GRCh38)
Location 6:117030559-117030581
Sequence GGCCCAGGCCAGCCCAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014057248_1014057252 9 Left 1014057248 6:117030527-117030549 CCTGCCATACTAAAATTGCAACT No data
Right 1014057252 6:117030559-117030581 GGCCCAGGCCAGCCCAGCCCTGG No data
1014057249_1014057252 5 Left 1014057249 6:117030531-117030553 CCATACTAAAATTGCAACTCAAA No data
Right 1014057252 6:117030559-117030581 GGCCCAGGCCAGCCCAGCCCTGG No data
1014057247_1014057252 10 Left 1014057247 6:117030526-117030548 CCCTGCCATACTAAAATTGCAAC No data
Right 1014057252 6:117030559-117030581 GGCCCAGGCCAGCCCAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014057252 Original CRISPR GGCCCAGGCCAGCCCAGCCC TGG Intergenic
No off target data available for this crispr