ID: 1014066631

View in Genome Browser
Species Human (GRCh38)
Location 6:117134629-117134651
Sequence GCATCCTACTCAAATTCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014066625_1014066631 28 Left 1014066625 6:117134578-117134600 CCAATGGCTGTTAGAATGAGAAA No data
Right 1014066631 6:117134629-117134651 GCATCCTACTCAAATTCACATGG No data
1014066624_1014066631 29 Left 1014066624 6:117134577-117134599 CCCAATGGCTGTTAGAATGAGAA No data
Right 1014066631 6:117134629-117134651 GCATCCTACTCAAATTCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014066631 Original CRISPR GCATCCTACTCAAATTCACA TGG Intergenic
No off target data available for this crispr