ID: 1014066985

View in Genome Browser
Species Human (GRCh38)
Location 6:117138566-117138588
Sequence GGATGGAAAGAATATCAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014066982_1014066985 1 Left 1014066982 6:117138542-117138564 CCACAAGGCACACATTGCTACTC No data
Right 1014066985 6:117138566-117138588 GGATGGAAAGAATATCAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014066985 Original CRISPR GGATGGAAAGAATATCAGCT AGG Intergenic
No off target data available for this crispr