ID: 1014073120

View in Genome Browser
Species Human (GRCh38)
Location 6:117205769-117205791
Sequence TACACTTCACGTGGACTTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014073120_1014073123 -4 Left 1014073120 6:117205769-117205791 CCCAAAAGTCCACGTGAAGTGTA No data
Right 1014073123 6:117205788-117205810 TGTATGTGTTTTCCAAGCTGTGG No data
1014073120_1014073125 25 Left 1014073120 6:117205769-117205791 CCCAAAAGTCCACGTGAAGTGTA No data
Right 1014073125 6:117205817-117205839 TGCCCTCCCTCATTTAGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014073120 Original CRISPR TACACTTCACGTGGACTTTT GGG (reversed) Intergenic
No off target data available for this crispr