ID: 1014073122

View in Genome Browser
Species Human (GRCh38)
Location 6:117205778-117205800
Sequence GAAAACACATACACTTCACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014073122_1014073132 30 Left 1014073122 6:117205778-117205800 CCACGTGAAGTGTATGTGTTTTC No data
Right 1014073132 6:117205831-117205853 TAGTTCAGGAATAGTCCATGGGG No data
1014073122_1014073130 28 Left 1014073122 6:117205778-117205800 CCACGTGAAGTGTATGTGTTTTC No data
Right 1014073130 6:117205829-117205851 TTTAGTTCAGGAATAGTCCATGG No data
1014073122_1014073131 29 Left 1014073122 6:117205778-117205800 CCACGTGAAGTGTATGTGTTTTC No data
Right 1014073131 6:117205830-117205852 TTAGTTCAGGAATAGTCCATGGG No data
1014073122_1014073125 16 Left 1014073122 6:117205778-117205800 CCACGTGAAGTGTATGTGTTTTC No data
Right 1014073125 6:117205817-117205839 TGCCCTCCCTCATTTAGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014073122 Original CRISPR GAAAACACATACACTTCACG TGG (reversed) Intergenic
No off target data available for this crispr