ID: 1014073124

View in Genome Browser
Species Human (GRCh38)
Location 6:117205800-117205822
Sequence AGGGCAATGTCTCCACAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014073124_1014073132 8 Left 1014073124 6:117205800-117205822 CCAAGCTGTGGAGACATTGCCCT No data
Right 1014073132 6:117205831-117205853 TAGTTCAGGAATAGTCCATGGGG No data
1014073124_1014073125 -6 Left 1014073124 6:117205800-117205822 CCAAGCTGTGGAGACATTGCCCT No data
Right 1014073125 6:117205817-117205839 TGCCCTCCCTCATTTAGTTCAGG No data
1014073124_1014073131 7 Left 1014073124 6:117205800-117205822 CCAAGCTGTGGAGACATTGCCCT No data
Right 1014073131 6:117205830-117205852 TTAGTTCAGGAATAGTCCATGGG No data
1014073124_1014073135 21 Left 1014073124 6:117205800-117205822 CCAAGCTGTGGAGACATTGCCCT No data
Right 1014073135 6:117205844-117205866 GTCCATGGGGAGTCTTGGTTGGG No data
1014073124_1014073130 6 Left 1014073124 6:117205800-117205822 CCAAGCTGTGGAGACATTGCCCT No data
Right 1014073130 6:117205829-117205851 TTTAGTTCAGGAATAGTCCATGG No data
1014073124_1014073133 16 Left 1014073124 6:117205800-117205822 CCAAGCTGTGGAGACATTGCCCT No data
Right 1014073133 6:117205839-117205861 GAATAGTCCATGGGGAGTCTTGG No data
1014073124_1014073134 20 Left 1014073124 6:117205800-117205822 CCAAGCTGTGGAGACATTGCCCT No data
Right 1014073134 6:117205843-117205865 AGTCCATGGGGAGTCTTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014073124 Original CRISPR AGGGCAATGTCTCCACAGCT TGG (reversed) Intergenic
No off target data available for this crispr