ID: 1014073125

View in Genome Browser
Species Human (GRCh38)
Location 6:117205817-117205839
Sequence TGCCCTCCCTCATTTAGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014073124_1014073125 -6 Left 1014073124 6:117205800-117205822 CCAAGCTGTGGAGACATTGCCCT No data
Right 1014073125 6:117205817-117205839 TGCCCTCCCTCATTTAGTTCAGG No data
1014073122_1014073125 16 Left 1014073122 6:117205778-117205800 CCACGTGAAGTGTATGTGTTTTC No data
Right 1014073125 6:117205817-117205839 TGCCCTCCCTCATTTAGTTCAGG No data
1014073121_1014073125 24 Left 1014073121 6:117205770-117205792 CCAAAAGTCCACGTGAAGTGTAT No data
Right 1014073125 6:117205817-117205839 TGCCCTCCCTCATTTAGTTCAGG No data
1014073120_1014073125 25 Left 1014073120 6:117205769-117205791 CCCAAAAGTCCACGTGAAGTGTA No data
Right 1014073125 6:117205817-117205839 TGCCCTCCCTCATTTAGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014073125 Original CRISPR TGCCCTCCCTCATTTAGTTC AGG Intergenic
No off target data available for this crispr