ID: 1014075683

View in Genome Browser
Species Human (GRCh38)
Location 6:117231618-117231640
Sequence GGAGTCTGGTGGGAGGCAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014075683_1014075692 21 Left 1014075683 6:117231618-117231640 CCAGTTGCCTCCCACCAGACTCC No data
Right 1014075692 6:117231662-117231684 AACTGAACATTAAATTTGGATGG No data
1014075683_1014075688 -7 Left 1014075683 6:117231618-117231640 CCAGTTGCCTCCCACCAGACTCC No data
Right 1014075688 6:117231634-117231656 AGACTCCACTTCCAACATTGTGG No data
1014075683_1014075691 17 Left 1014075683 6:117231618-117231640 CCAGTTGCCTCCCACCAGACTCC No data
Right 1014075691 6:117231658-117231680 TTACAACTGAACATTAAATTTGG No data
1014075683_1014075695 24 Left 1014075683 6:117231618-117231640 CCAGTTGCCTCCCACCAGACTCC No data
Right 1014075695 6:117231665-117231687 TGAACATTAAATTTGGATGGGGG No data
1014075683_1014075693 22 Left 1014075683 6:117231618-117231640 CCAGTTGCCTCCCACCAGACTCC No data
Right 1014075693 6:117231663-117231685 ACTGAACATTAAATTTGGATGGG No data
1014075683_1014075694 23 Left 1014075683 6:117231618-117231640 CCAGTTGCCTCCCACCAGACTCC No data
Right 1014075694 6:117231664-117231686 CTGAACATTAAATTTGGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014075683 Original CRISPR GGAGTCTGGTGGGAGGCAAC TGG (reversed) Intergenic
No off target data available for this crispr