ID: 1014081611

View in Genome Browser
Species Human (GRCh38)
Location 6:117292917-117292939
Sequence GGTCACACTAATCAAAAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 117}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014081611 Original CRISPR GGTCACACTAATCAAAAGTA AGG (reversed) Intronic
904294767 1:29512579-29512601 GAACACAGTAAGCAAAAGTATGG + Intergenic
905501180 1:38438766-38438788 GCAAACACTAATCAAAAGAAAGG - Intergenic
906124655 1:43420307-43420329 GGTCACACTGGCCAAAGGTAAGG + Exonic
910485982 1:87714212-87714234 TGTCACTCTAATAAAAACTAAGG - Intergenic
919350442 1:196446387-196446409 GATGACACTGATGAAAAGTATGG + Intronic
923061892 1:230483426-230483448 GGACACACTACTCCAAAGTACGG + Intergenic
1068493393 10:57753426-57753448 GTTCACAATAACCAAAAGTTGGG + Intergenic
1069167800 10:65185643-65185665 GATCACACTGATAAAAAGAAAGG - Intergenic
1071419015 10:85470617-85470639 GAACACACTAATAACAAGTAAGG + Intergenic
1071480810 10:86063174-86063196 GAACACACTTATCAAAAGCAAGG + Intronic
1071957990 10:90779870-90779892 GGCCACACTACCCTAAAGTATGG - Intronic
1080901324 11:36494676-36494698 GATAAAAATAATCAAAAGTAAGG - Intronic
1085311835 11:75521400-75521422 GGTCACACAGCTCAAAGGTAGGG - Intronic
1087270682 11:96108474-96108496 GGTCACACTACTAGTAAGTAGGG - Intronic
1087375829 11:97338690-97338712 GGACACATTAATGAAAAGTGGGG - Intergenic
1088149687 11:106728888-106728910 TGTCATTCTTATCAAAAGTAAGG - Intronic
1092995394 12:13945107-13945129 GTTGACACTAATCATAAATAGGG + Intronic
1093985528 12:25528188-25528210 GGTCACACTAAAAAAATGTGAGG + Intronic
1094274800 12:28660841-28660863 GCTAACACCAATCAAAAGAAAGG + Intergenic
1094314819 12:29127988-29128010 GCAAACACTAATCAAAAGAAAGG - Intergenic
1097520263 12:60659438-60659460 TGTCACAGTAATCAAAAGATTGG + Intergenic
1104253648 12:127120872-127120894 GGTTAGATTAATCAATAGTAAGG - Intergenic
1109651626 13:65335656-65335678 GGTCAAGCTCATCAAAAGCAAGG + Intergenic
1109866082 13:68265641-68265663 GTGCAAACTAAACAAAAGTATGG + Intergenic
1115777704 14:36734469-36734491 GTTCGCACCAAGCAAAAGTAGGG - Intronic
1117953564 14:61105671-61105693 GGACACACTACACGAAAGTACGG - Intergenic
1119937865 14:78609424-78609446 GGTCACACTACTTTAAAGTTTGG + Intronic
1127557168 15:60099095-60099117 GGTCACACATATAATAAGTAGGG + Intergenic
1130613997 15:85386857-85386879 GGTGACAGTAATCAACAGTGAGG - Intronic
1131964393 15:97825350-97825372 GATAACGCTAATCAAAAGAAAGG - Intergenic
1139739327 16:69021767-69021789 GGTCACACAAACAAAAAGTGTGG - Intronic
1143902098 17:10182160-10182182 CGTCACACACACCAAAAGTAAGG - Intronic
1151004966 17:70424049-70424071 GGTCTCACTGAGCAAAAGTTGGG + Intergenic
1155125191 18:22868259-22868281 ACTAACACTAATCTAAAGTAAGG - Intronic
1160189169 18:76700949-76700971 AGTAACACTAATAAAAAGCAAGG + Intergenic
1161152436 19:2716792-2716814 GGTCACAGTGATCAAATGTGAGG + Exonic
1166530284 19:43538606-43538628 GGACAGACTAATCATAAATAAGG + Intergenic
1167809947 19:51820822-51820844 GGTTATACTAATTAAAACTAAGG + Intronic
925858980 2:8156855-8156877 GGAAACACTACACAAAAGTAAGG + Intergenic
926877711 2:17501836-17501858 TGTCATACTATTTAAAAGTAGGG + Intergenic
932993245 2:76814038-76814060 GTTCAAAGTCATCAAAAGTAAGG - Intronic
933606289 2:84387868-84387890 GGTCACCCTAAACAAAATCAGGG + Intergenic
935350166 2:102145586-102145608 GGTCTCATAAATTAAAAGTAGGG + Intronic
935520739 2:104102043-104102065 GTTCACTATAATAAAAAGTAGGG - Intergenic
935793920 2:106621636-106621658 CATAACACTAATCAAAAGAAAGG - Intergenic
939259230 2:139785252-139785274 AGACACAAGAATCAAAAGTAGGG - Intergenic
940097412 2:149993331-149993353 GGACACACTATTCCAAAATATGG - Intergenic
941572733 2:167191835-167191857 GGTCTGACTGTTCAAAAGTAAGG + Intronic
941860042 2:170269679-170269701 GGAAAAACTAACCAAAAGTAGGG + Intronic
943427307 2:187752487-187752509 GGTCACACTAATGCAAAGGTGGG + Intergenic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
948441658 2:237995119-237995141 GGTCACACTATTCCTACGTAAGG - Intronic
1169410462 20:5365046-5365068 GGTCACAAGATTCAAAATTAAGG + Intergenic
1170776272 20:19377352-19377374 GAGCACAGTAATCAAAAGGAGGG + Intronic
1177232863 21:18345401-18345423 GTTCTAAGTAATCAAAAGTAAGG - Intronic
1183567740 22:38628268-38628290 GGGTACACGAAACAAAAGTAAGG + Exonic
949488090 3:4560218-4560240 GGACAAACAAATAAAAAGTAGGG + Intronic
955369024 3:58334645-58334667 GGACAAACTAATCAAGATTAAGG - Intronic
955621956 3:60874079-60874101 GGTTACACAACTCATAAGTAGGG - Intronic
956400587 3:68875279-68875301 GGTCTGAGTAATCAATAGTACGG + Intronic
957535933 3:81503592-81503614 AGTGACAGTATTCAAAAGTAAGG + Intronic
958954555 3:100453176-100453198 GGTCACTCTGAGCAAAAGTCAGG - Intronic
959564905 3:107824324-107824346 GGACACACTACCCAAAAATATGG - Intergenic
960051041 3:113239853-113239875 GGTCACAGTAACCTAGAGTAGGG + Intronic
960109470 3:113831420-113831442 TGTCACATTAAAAAAAAGTAAGG - Intronic
967672371 3:192252693-192252715 GCTGACATTAATCAAAATTAAGG - Intronic
968412082 4:398684-398706 GGTTATAATAATCAAGAGTATGG - Intergenic
969830101 4:9788732-9788754 GCTCCCACTAATCAAATCTAGGG - Intronic
970965759 4:21925912-21925934 GGTCACAGTAAGCAAAAATGGGG - Intronic
975002995 4:69248791-69248813 GTTCCCACAAATCAAAATTATGG + Intergenic
975011276 4:69356147-69356169 GTTCCCACAAATCAAAATTATGG + Intronic
976274636 4:83263795-83263817 GGTCACAATAAAGAACAGTAAGG + Intronic
978198964 4:106002649-106002671 GGTGAAACTAATGAAAAGCAAGG + Intronic
978333754 4:107644185-107644207 GGACACACTACTCCAAAATATGG + Intronic
979177941 4:117688449-117688471 TGTCACAGTAATTAAAAGCATGG + Intergenic
979630387 4:122894903-122894925 AGTACCACTAATCAAAAGTTCGG + Exonic
981641644 4:146950678-146950700 GGTCATACTAATTAACACTATGG - Intergenic
982832881 4:160086050-160086072 GGTCACACTGATGCAAAGGATGG + Intergenic
982912430 4:161161237-161161259 GGACACACAAAGCAAAAGCATGG + Intergenic
983127666 4:163974174-163974196 GCTCACCCTATTCAAAATTAGGG - Intronic
984888395 4:184471838-184471860 TGTCAGCATAATCAAAAGTAAGG - Intronic
988162296 5:27534635-27534657 GGACACAAAAATAAAAAGTAAGG - Intergenic
988643326 5:33066174-33066196 GGTCAGACTTATGAAAAGTTTGG - Intergenic
990245227 5:53857684-53857706 GGACACACTACCCCAAAGTATGG - Intergenic
992264145 5:75001473-75001495 GTTAACAATAATCAAAAGAAAGG - Intergenic
995551660 5:113287785-113287807 GGGCACACTTATCTAGAGTAGGG - Intronic
996448853 5:123594201-123594223 GACAACACTAATAAAAAGTAGGG - Intronic
996520250 5:124418220-124418242 GGACACACTACCCCAAAGTATGG - Intergenic
996576825 5:124984779-124984801 GGGCACACTAACCCAAAATATGG + Intergenic
997662046 5:135596753-135596775 GGTCAATCTAATGAAAAGTGGGG - Intergenic
998249296 5:140540193-140540215 GATGACACTAAACAAATGTAGGG + Intronic
1001395127 5:171413392-171413414 GGTTACAGTAGTAAAAAGTAAGG + Intergenic
1003484354 6:6562986-6563008 GGTCACACTGATGAAAGGGATGG + Intergenic
1007640403 6:43334601-43334623 GATCCCACTAACCAAAAGGAAGG + Intronic
1011864272 6:91803111-91803133 GATAACTCTAATCAAAAGAAAGG - Intergenic
1011898627 6:92263566-92263588 GGTCACACTGAGCTAAATTATGG - Intergenic
1013720518 6:113021216-113021238 GTTAACACTAATCAAAAGAAAGG + Intergenic
1014081611 6:117292917-117292939 GGTCACACTAATCAAAAGTAAGG - Intronic
1014668920 6:124274770-124274792 GGACACACTATTCAAAAAAAAGG + Intronic
1022154987 7:27651652-27651674 GGTCAAACAATTCATAAGTATGG + Intronic
1024190701 7:47005263-47005285 GCTAACACTAATCAAATGAAAGG + Intergenic
1024713842 7:52051158-52051180 GCTGACACTAACCAAAAGAAAGG - Intergenic
1025473800 7:60894116-60894138 GGTCACAGTAATGCACAGTAAGG + Intergenic
1025513204 7:61595750-61595772 GGTCACAGTAATGCACAGTAAGG - Intergenic
1027471696 7:78582110-78582132 GGACACACTACTCAAAAACATGG - Intronic
1027805713 7:82819407-82819429 AGTCACAATAATTAAAAATAAGG + Intronic
1030662153 7:112231431-112231453 GGTCACCCTTATCAAAATTTTGG + Intronic
1038519570 8:28218675-28218697 GGTCACACAAACCACAAGCAGGG - Intergenic
1042121727 8:65495717-65495739 GGTCAGACTATTCAATGGTAAGG + Intergenic
1044822342 8:96162738-96162760 GGTCACACTACTCCAGAGTCTGG + Intergenic
1045266882 8:100626320-100626342 AGTCATATAAATCAAAAGTAGGG + Intronic
1046095176 8:109549876-109549898 GCTAGCACTAATCAAAAGAAAGG - Intronic
1046405760 8:113770079-113770101 GGTCACACTGATCAAGAGGTGGG - Intergenic
1047086079 8:121517160-121517182 ACTAACACTAATCAAAAGTAAGG + Intergenic
1048190667 8:132285709-132285731 GGTAATACTCATCAAAACTATGG + Intronic
1055378395 9:75677055-75677077 GCTAACACTAATAAAAAGAAAGG + Intergenic
1186644633 X:11493540-11493562 AGTCACACCAATGAATAGTAAGG - Intronic
1192982937 X:76366674-76366696 GGTCACAATAATCCAAAAGATGG + Intergenic
1197066158 X:122236821-122236843 GTTCACAGTAAGCCAAAGTAAGG - Intergenic
1198345481 X:135754372-135754394 GATCTCACAAATCAAAGGTAAGG + Intergenic
1199215515 X:145256491-145256513 GGTCCTACTAATCATAGGTATGG - Intergenic