ID: 1014083871

View in Genome Browser
Species Human (GRCh38)
Location 6:117318919-117318941
Sequence TTGGTTCAGGATAGTGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 101}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014083871 Original CRISPR TTGGTTCAGGATAGTGTGTC AGG (reversed) Intronic
903070591 1:20725188-20725210 TTGGGTCTGGATGGTGTGTGTGG - Intronic
905934319 1:41811630-41811652 ATGGTTCAGGACAGTGTCTCTGG - Intronic
907605860 1:55816846-55816868 TTTGTTGAGTATAGTTTGTCAGG + Intergenic
908702755 1:66920097-66920119 TGGGTGCAGGATAGTGGGACAGG - Intronic
914746328 1:150504279-150504301 GTGGTTCTGGATAGTGCTTCTGG + Intronic
917838514 1:178959327-178959349 TTGGCTCAGGATCATGTGTTTGG - Intergenic
920892534 1:210004126-210004148 TTGGCTCAGTAAAATGTGTCAGG - Intronic
923450259 1:234110446-234110468 TTGGTTCAGGATAATGTGTGTGG + Intronic
1065858803 10:29852893-29852915 TTGGTTCAGGAGAGGCTGACTGG + Intergenic
1067554805 10:47261389-47261411 TAGGTTCAGGTGTGTGTGTCAGG - Intergenic
1071828197 10:89346724-89346746 TTGGTTCAGGATTTTGTTGCTGG - Intronic
1073355993 10:102854597-102854619 TTGGTTAGGGACAGTGTGTGAGG + Intronic
1077795192 11:5484220-5484242 TTGTTGCAGGATCCTGTGTCTGG - Intronic
1080347554 11:31341936-31341958 TTGCTTCAGGAAAGTTTTTCTGG - Intronic
1081099844 11:38987624-38987646 TTGGTATAGGAAAGTGTATCAGG - Intergenic
1085867313 11:80309537-80309559 TTGGGTCAGGCTACTGTGCCTGG - Intergenic
1089668493 11:120035394-120035416 TTTGTTCAGGATACAGTGGCGGG + Intergenic
1089682652 11:120127879-120127901 TTGGTTCTGGTTAGGGTTTCAGG - Intronic
1090585998 11:128214093-128214115 TTGGGTAAGGATGGGGTGTCAGG + Intergenic
1093197451 12:16145554-16145576 TTTTTTAAGGATAGTTTGTCAGG - Intergenic
1098816120 12:75164676-75164698 TTGTTACAGGTTAGTGTTTCAGG - Intronic
1099354540 12:81617688-81617710 TTGCCTGAGGATAGTGTGTAAGG - Intronic
1103971376 12:124674824-124674846 ATGGTTCATGAAAATGTGTCTGG - Intergenic
1107541090 13:41389748-41389770 TTGGTTCAGGAAACACTGTCAGG - Intergenic
1108084899 13:46776722-46776744 ATGTTTAAGGATAATGTGTCAGG - Intronic
1108525454 13:51282315-51282337 TTTGTTCAGGAGAGCGTTTCAGG - Intronic
1111972583 13:94932239-94932261 TTGAGGCAGGATAGTGTTTCTGG + Intergenic
1112297474 13:98200799-98200821 TTGGATCAGGAAAGTCTTTCTGG + Intronic
1112343625 13:98572615-98572637 TTGCATCAGGATAGTGAGACTGG - Intronic
1114791446 14:25663517-25663539 GTGGTTCAGGAGAATGTGTCTGG + Intergenic
1115895820 14:38085588-38085610 TTGGGACAGGATAGTGTCTTGGG - Intergenic
1119774265 14:77238846-77238868 TTGGTGCAGGATGGTGGGACTGG + Intronic
1122020017 14:98830072-98830094 ATGGGTCAGAAAAGTGTGTCAGG - Intergenic
1122728528 14:103777427-103777449 TTGGTTCTGGATCCTCTGTCAGG - Intronic
1128688116 15:69702260-69702282 TTCGCTCAGGATAGAGGGTCTGG - Intergenic
1133402746 16:5500638-5500660 CTGGCTGAGGATGGTGTGTCTGG - Intergenic
1137945452 16:52729756-52729778 TTGGTTAAGGATGATGTGACAGG + Intergenic
1142029684 16:87832293-87832315 CTGGCTCAGGATGGTGTCTCGGG + Exonic
1146482318 17:33214519-33214541 TTGGTGCTGGTTATTGTGTCTGG + Intronic
1148806350 17:50265938-50265960 TTGGGTGAGCATTGTGTGTCTGG - Intergenic
1153192557 18:2557958-2557980 TTGGTTTAGAATAGTGTTTAAGG - Intronic
1156183157 18:34629766-34629788 GTGGTTCAGGACATTGTGTCTGG - Intronic
1157737440 18:50062694-50062716 TGGGTTCAGGATGCGGTGTCTGG - Intronic
1162863739 19:13527848-13527870 TAGGTTTTGGATAGTGTGTGTGG - Intronic
1167809743 19:51818740-51818762 TGGGTCCAGCACAGTGTGTCAGG + Intronic
930010714 2:46936430-46936452 TTGGTTCAGGACAATCTCTCCGG + Intronic
931917646 2:66975679-66975701 TTGGTTGGTGATAGTGTGTTAGG + Intergenic
933797311 2:85929918-85929940 TTGATTAACCATAGTGTGTCTGG - Intergenic
935403043 2:102680605-102680627 TTGGTTCAGGATACAGTTTAGGG + Intronic
937429446 2:121826038-121826060 TTGGTTCAGGATTCTGTCCCAGG + Intergenic
943188221 2:184641322-184641344 TTGGTTCAGCATAATGTTTTGGG - Intronic
946162499 2:217844314-217844336 GAGGTTCAGGATGATGTGTCTGG - Intronic
946556556 2:220864988-220865010 CTGGTTTAGGATCGTGTTTCAGG + Intergenic
1170221955 20:13950820-13950842 TTGGTTCAGGATAGGGTGGTAGG - Intronic
1170408183 20:16061521-16061543 TTGGTTCTGCATAGTGAGTCAGG + Intergenic
1171277493 20:23870358-23870380 TAGGTTGAGGATAAGGTGTCAGG + Intergenic
1171392522 20:24810913-24810935 TGTGTTCAGGCAAGTGTGTCTGG - Intergenic
1177115309 21:17078393-17078415 TGGGTGCTGGGTAGTGTGTCAGG + Intergenic
950316660 3:12006793-12006815 TTGGTTGAGACTAGTGTTTCAGG + Intronic
952095784 3:29951612-29951634 TGGATTCAGGAAAGTGTGTTAGG + Intronic
955640420 3:61077093-61077115 TTGGTTCAAGATTGTGTTTCAGG - Intronic
957527364 3:81394375-81394397 CTGGTACAGGACAGTGTGTTTGG - Intergenic
959642300 3:108655645-108655667 TGGGTTCAGGACAGTGGGTGCGG + Intronic
959996702 3:112688244-112688266 TTTGTTCAGGAAAGTGCTTCAGG - Intergenic
962256438 3:133873043-133873065 TGGGTGCAGGATAGTGAGACGGG - Intronic
966600514 3:181770575-181770597 TTGCTTCAGGATAATCTATCTGG + Intergenic
970655642 4:18227552-18227574 TTGGTTCAGGAAAGGGTCACTGG + Intergenic
970790378 4:19851191-19851213 ATGGTCCAGGATAGTCAGTCTGG + Intergenic
972820282 4:42693968-42693990 ATAGTTCAGGAAAGTGTGTGTGG - Intergenic
981616549 4:146649259-146649281 TTCGTTCAGGACAGTGTTTGTGG + Intergenic
981802498 4:148674538-148674560 TTAGTTAATGATAGTGTATCAGG - Intergenic
982267880 4:153556561-153556583 TTGGTTTATGACAGTCTGTCTGG + Intronic
988894310 5:35655545-35655567 TTGCTTCAGGAGACAGTGTCTGG + Intronic
990989751 5:61673471-61673493 TTGGAGCAGGAGAGTCTGTCTGG - Intronic
994661810 5:102662884-102662906 GTGTTTCAGGATAGTTAGTCAGG - Intergenic
994807841 5:104475046-104475068 TGGCTTAAGAATAGTGTGTCTGG + Intergenic
996280999 5:121728909-121728931 TTGGTTCAGGATACAGGGGCAGG - Intergenic
996472285 5:123874907-123874929 TTGTTTCAAGATATTGAGTCCGG + Intergenic
997707979 5:135976645-135976667 TTGGTACAGGAAGGTGTTTCAGG - Intergenic
1000109585 5:158094924-158094946 ATGGGTCAGGATAGTAAGTCTGG + Intergenic
1002777491 6:341476-341498 TTGGTGCAGGACTGTGTGTGGGG - Intronic
1002787626 6:416238-416260 TTTTTTCAGGAAAGTGTCTCAGG - Intergenic
1013478655 6:110532840-110532862 TTGGTACAGCAAAGTCTGTCTGG - Intergenic
1013636271 6:112032671-112032693 TTGTTTCAGGTGAGTGTGTTGGG + Intergenic
1014083871 6:117318919-117318941 TTGGTTCAGGATAGTGTGTCAGG - Intronic
1018544234 6:164918447-164918469 TGGGTTCAGGAGAGTGAGTCTGG + Intergenic
1019258383 7:65970-65992 TTGGTTCAGGCCAGAGTGTGGGG - Intergenic
1022471630 7:30685070-30685092 TAGGTTCAGGGAAGTGTGACAGG + Intronic
1022778578 7:33554463-33554485 TTGGTGCTGGATTGTGTGTAAGG + Intronic
1026394935 7:69941942-69941964 TTTGCTCAGGACAGTGTGTAAGG + Intronic
1027267810 7:76503802-76503824 TTGGTTCAGGAAAGAGTGGAGGG - Intronic
1027319621 7:77003664-77003686 TTGGTTCAGGAAAGAGTGGAGGG - Intergenic
1029992630 7:104975964-104975986 TTGTTTCAGGAAAGTCTATCAGG + Intergenic
1041552188 8:59115769-59115791 TTGGTTAAGGCAAGTGTGTGAGG - Intronic
1043453210 8:80389462-80389484 TTGGTGCAGGATATTCTGTTTGG + Intergenic
1043747743 8:83897894-83897916 TGGGTACAGGATAGTGGGTGCGG + Intergenic
1044206514 8:89497255-89497277 CTTGTTCAAGATAGTGTGGCTGG + Intergenic
1047296472 8:123574942-123574964 TTTGTTCAAGAGAGAGTGTCTGG + Intergenic
1047324114 8:123819763-123819785 TTGCTGCAGGATGGTGAGTCTGG + Intergenic
1049036783 8:140082764-140082786 TTAGTTCAAGATTGTGTGGCTGG + Intronic
1055071828 9:72174526-72174548 TTGGTTCTGGATTTTGTGTATGG + Intronic
1058603885 9:106700276-106700298 TTTGTACAGGACAGTTTGTCAGG + Intergenic
1059362832 9:113759166-113759188 CTGGTGCAGCTTAGTGTGTCCGG - Intergenic
1061878201 9:133555448-133555470 TTGGTTCAGCTTGGTGTTTCTGG + Intronic
1187261216 X:17686782-17686804 CTGGATCTGGATAGTGTGTCTGG + Intronic
1188767891 X:34119136-34119158 TTTATTCAGGATAGTATGTGCGG + Intergenic
1190784379 X:53630107-53630129 ATGCTTCAGGGTACTGTGTCCGG - Intronic
1193685008 X:84567442-84567464 TTGGTGGAGGAGGGTGTGTCAGG - Intergenic
1195080793 X:101368028-101368050 TTGGTTCAGGACATGGAGTCTGG + Intronic
1195285598 X:103379633-103379655 TTAGTTAAGGATAGTGAGTTAGG - Intergenic
1201728879 Y:17184832-17184854 GTTCTTAAGGATAGTGTGTCTGG + Intergenic