ID: 1014084864

View in Genome Browser
Species Human (GRCh38)
Location 6:117330644-117330666
Sequence CCTCCTTGAGTTACATATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 452
Summary {0: 1, 1: 3, 2: 96, 3: 139, 4: 213}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014084860_1014084864 -2 Left 1014084860 6:117330623-117330645 CCCATTTTTGCTGCTCTCCAGCC 0: 4
1: 32
2: 126
3: 177
4: 672
Right 1014084864 6:117330644-117330666 CCTCCTTGAGTTACATATCCAGG 0: 1
1: 3
2: 96
3: 139
4: 213
1014084861_1014084864 -3 Left 1014084861 6:117330624-117330646 CCATTTTTGCTGCTCTCCAGCCT 0: 4
1: 38
2: 145
3: 264
4: 729
Right 1014084864 6:117330644-117330666 CCTCCTTGAGTTACATATCCAGG 0: 1
1: 3
2: 96
3: 139
4: 213
1014084858_1014084864 18 Left 1014084858 6:117330603-117330625 CCCAGAAGAAGGAGCAGACACCC 0: 5
1: 58
2: 129
3: 199
4: 449
Right 1014084864 6:117330644-117330666 CCTCCTTGAGTTACATATCCAGG 0: 1
1: 3
2: 96
3: 139
4: 213
1014084859_1014084864 17 Left 1014084859 6:117330604-117330626 CCAGAAGAAGGAGCAGACACCCA 0: 5
1: 59
2: 128
3: 254
4: 1018
Right 1014084864 6:117330644-117330666 CCTCCTTGAGTTACATATCCAGG 0: 1
1: 3
2: 96
3: 139
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014084864 Original CRISPR CCTCCTTGAGTTACATATCC AGG Intronic
901924872 1:12559866-12559888 CCTCCTGGAGTCACACAGCCAGG + Intergenic
905993251 1:42358442-42358464 CCTGCAGGAGTTACATATCAAGG + Intergenic
906954395 1:50359892-50359914 CCTCCTTGGGTGACACCTCCAGG + Intergenic
907266619 1:53265578-53265600 CCTCTTTCAGTTACATCTCTTGG + Intronic
908909812 1:69060206-69060228 CCTTCTCTAGTTACATAGCCTGG + Intergenic
909303174 1:74038636-74038658 CCTCCTCAAGTGACATCTCCAGG + Intronic
909924888 1:81427361-81427383 CCACCTTGGTTTCCATATCCTGG - Intronic
910518238 1:88088037-88088059 CCTGCTTGAGTGACATCTCCAGG - Intergenic
910619264 1:89235578-89235600 CCTCCTTGGGTAACATCTCCAGG - Intergenic
910769254 1:90814171-90814193 CCTCCATGTGATAAATATCCTGG + Intergenic
911508629 1:98784535-98784557 CTTCCTTGGGTGACATCTCCAGG + Intergenic
911897771 1:103459664-103459686 TCTCCTTGAGTGACATGTCTGGG - Intergenic
912607658 1:111008540-111008562 CCTCCTTGAGTGACAACTCCAGG + Intergenic
912884080 1:113450473-113450495 CCACCTTGGTTTCCATATCCTGG - Intronic
914400696 1:147317126-147317148 CCTTCTTGAGTGACATCTGCAGG + Intergenic
914404702 1:147358775-147358797 CCTCCTGGGGTGACATCTCCAGG + Intergenic
915977198 1:160399382-160399404 CCTCCTTCAGTTTCCAATCCTGG - Intergenic
916848927 1:168683536-168683558 CCTCCTTGAGTGACAGCTCCGGG - Intergenic
917060475 1:171032597-171032619 CCTCCTTGAGTGACATCTCCAGG - Intronic
917079155 1:171238165-171238187 CCTCCTTGAGTGATATCTCCAGG + Intergenic
917295600 1:173515985-173516007 CCTCCTCGAGTGACATCTCCAGG - Intronic
917356346 1:174130790-174130812 CCTCCTTGAGTGACATCTCCAGG - Intergenic
918156303 1:181849901-181849923 CCTCCCTGAGTGACATTTCCAGG + Intergenic
918168827 1:181975637-181975659 CCTCCTTGAGTGACATCTCCAGG + Intergenic
918802170 1:188986312-188986334 CCTCCTTGAATGACATCTTCAGG - Intergenic
918955318 1:191199532-191199554 CTTCCTTGAGTGACATCTCCAGG + Intergenic
919535785 1:198786173-198786195 CCTTCTTCACTTACATATCGTGG - Intergenic
919570423 1:199242218-199242240 CTTCCTTGACTTACATAACCAGG + Intergenic
919586541 1:199447468-199447490 CCTCCTTGAGTGACAACTTCAGG - Intergenic
921736326 1:218633110-218633132 CCTCCTTGAGTGACATCTCCAGG - Intergenic
924779357 1:247132099-247132121 CCTCCTTGAGTGGCATCTCCAGG + Intronic
1067156849 10:43789487-43789509 CCACCTTGGTTTCCATATCCTGG + Intergenic
1067207577 10:44233138-44233160 CCTCCTTGAATGACATCTCCAGG - Intergenic
1068126789 10:52850941-52850963 CCTCCTTGAGTGACATCTCCAGG - Intergenic
1069371027 10:67747437-67747459 CCTCCTTAGGTAACATCTCCAGG + Intergenic
1071059156 10:81548928-81548950 CCCCCTTGAGTGACATCTCCAGG + Intergenic
1071071382 10:81697719-81697741 CCTCCTTGAGTGATATCTCTTGG + Intergenic
1071763721 10:88637854-88637876 GCTCCTTCAGTGACATCTCCAGG - Intergenic
1074003436 10:109394283-109394305 CCTCCCTGAGTGACATCTCAAGG + Intergenic
1074531347 10:114300839-114300861 CCACCTCGAGTGACATATCTAGG - Intronic
1074636245 10:115321216-115321238 TCTCCTTGAGTGATATCTCCAGG - Intronic
1075138387 10:119808203-119808225 CCTGCTTGAGTCACATTACCTGG - Intronic
1075172283 10:120127309-120127331 CCTCCTTGAGTGACATCTCCAGG - Intergenic
1076185224 10:128441189-128441211 CCTCCTCAAGTGACATCTCCAGG + Intergenic
1076297808 10:129400862-129400884 CCTCCTTGATACACATTTCCAGG + Intergenic
1079426150 11:20343495-20343517 CCTCACTGAGTGACATCTCCAGG + Intergenic
1079481917 11:20890173-20890195 CCTCCTTAAGTGACATCTCCAGG + Intronic
1079935168 11:26608261-26608283 CCTCCTTGTGTGACATCTACAGG - Intronic
1080130809 11:28792623-28792645 CCTCCTTGAGTGACATCTCCAGG - Intergenic
1083521924 11:63321412-63321434 CCTCCTCAAGTGACATCTCCCGG + Intronic
1085065914 11:73495511-73495533 CCTCCTTGAGTGACATCTCCAGG + Intronic
1085066393 11:73499177-73499199 CCTCCTTCAGTGACATCTCCAGG + Intronic
1085213285 11:74802801-74802823 CCTACTTGAGTTCCAGATACAGG - Intronic
1086513918 11:87589767-87589789 CCTCCTTGAGTGACATCTCAAGG + Intergenic
1087851905 11:103041251-103041273 CCTCCTTGAGGAACATAATCTGG + Intergenic
1088004931 11:104927885-104927907 CCTCCTTGAGTGACATCATCAGG + Intergenic
1088167526 11:106956605-106956627 ACTCCTTGAATGACATCTCCAGG - Intronic
1088383299 11:109221020-109221042 CCTTCTTGAGTGACATCTCCAGG - Intergenic
1090117022 11:123984457-123984479 CCTCCTCAAGTGACATCTCCAGG - Intergenic
1090497233 11:127225304-127225326 CCTCCTGGAGTTACAAAAGCTGG - Intergenic
1092628507 12:10354281-10354303 CCTCCTTGAGTGACATCTTCAGG - Intergenic
1092639875 12:10494058-10494080 CCACCTTGAGTGACATCTCCAGG + Intergenic
1093413573 12:18895552-18895574 CCTCCTTGACTGACATCTCCAGG - Intergenic
1093808548 12:23465051-23465073 CCTCCCTGAGTGACATCTCCAGG + Intergenic
1094054720 12:26256969-26256991 CCTCCTTGAGTAACATCTCCAGG + Intronic
1094275420 12:28669239-28669261 CCTCCTTGAGTAACATCTCCAGG + Intergenic
1094329057 12:29272964-29272986 CCTCTTTGAGTGACATCTCCAGG - Intronic
1094776297 12:33731942-33731964 CCTCCTTGAGTGACATCTTCAGG - Intergenic
1095474146 12:42568043-42568065 CTTTCTTTAGTTTCATATCCAGG - Intronic
1096272476 12:50177144-50177166 CCTCCCAGAGTTCCACATCCTGG + Exonic
1096448050 12:51712705-51712727 CCACCTTGGTTTCCATATCCTGG + Intronic
1097455798 12:59796703-59796725 CCTCCTTGGGTGACATCTCTAGG + Intergenic
1097749041 12:63331414-63331436 CCTCCTTGAGTGACATCTCCAGG + Intergenic
1098694735 12:73538056-73538078 CCTCCTTAAGTGACATCTCCAGG + Intergenic
1099502594 12:83432325-83432347 CCTCCATGAGTGACATCTCCAGG - Intergenic
1099793174 12:87362993-87363015 CCTCCTTGAATGACATCTCCAGG - Intergenic
1100028209 12:90153986-90154008 CCTTCTTGAATGACATCTCCAGG + Intergenic
1101066623 12:101027995-101028017 CCTGCTTGAGTGACATCTCCAGG + Intronic
1102028003 12:109724391-109724413 CCTCCTGGAGTTGCATTTCTTGG - Intronic
1105668373 13:22586170-22586192 TCTCCTTGAGTGGCATCTCCAGG - Intergenic
1106126473 13:26903794-26903816 CCTCCTGGAGTCACAAAGCCTGG - Intergenic
1106890040 13:34235551-34235573 CTGCCTTGAGTGACATCTCCAGG - Intergenic
1108113571 13:47103336-47103358 CCTCCTTGAGTGACATCTCCGGG + Intergenic
1108144755 13:47464406-47464428 CCTCCTTGAGTGACATCTCTAGG + Intergenic
1108160494 13:47633132-47633154 GCTCCTTGAGTGACATCTCAAGG + Intergenic
1108815552 13:54286632-54286654 CCTCTTTGAGTGACATCTCCAGG - Intergenic
1110567047 13:76967604-76967626 CCTCCTTGAGTGACATCTTCAGG - Intergenic
1110790404 13:79581509-79581531 CATCCTTGAGTGACATTTCCAGG - Intergenic
1111045265 13:82805884-82805906 CCTCCTCAAGTGACATCTCCAGG + Intergenic
1111200427 13:84928306-84928328 CCTCCTTCAGTGACATCTCCAGG + Intergenic
1111363889 13:87214740-87214762 ATTCCTTCAGTTAAATATCCAGG - Intergenic
1112660056 13:101497508-101497530 CCTCCATGGTTTACATGTCCTGG - Intronic
1114706060 14:24727330-24727352 CCTCCTTGAGTGACATCTCCAGG + Intergenic
1115928740 14:38467314-38467336 CCTTCTTGAGTGACATCTCCAGG - Intergenic
1116560830 14:46376923-46376945 CCTCCTTGAGTGACATCTCCAGG - Intergenic
1116977502 14:51131978-51132000 CCTCCTTGAATGACATCTCCAGG + Intergenic
1118111957 14:62731888-62731910 CCTTCTTGAGTTACACATTCAGG + Intronic
1118478991 14:66144485-66144507 CCTCCTTGAGTGACATCTCCAGG + Intergenic
1118523622 14:66616537-66616559 CCTCCTTGAGTGACATCTCCAGG - Intronic
1119124339 14:72111741-72111763 CTTCCTTGAGGTACGTACCCTGG - Intronic
1124046444 15:26155325-26155347 CCTCCTTGAGTGTCATCTCCAGG - Intergenic
1126284506 15:46996135-46996157 CCTCCTTGAATGACACCTCCAGG - Intergenic
1126552906 15:49953032-49953054 CCTCCTTGAGTGACATCTCCAGG - Intronic
1127042444 15:54991400-54991422 CCTCCTTGAGTGACATCTCCAGG + Intergenic
1127687610 15:61364437-61364459 CCTCCTGAAGTGACATCTCCAGG - Intergenic
1129950867 15:79589988-79590010 TCTCTTTGAGTTACAAAACCTGG - Intergenic
1130848363 15:87768382-87768404 CCTCCTTAACTGACATCTCCAGG + Intergenic
1131818286 15:96245512-96245534 CCTCCCTGAGTTAGATACTCTGG - Intergenic
1131942668 15:97584780-97584802 CCTCCTTAAGTGACATCTCCAGG - Intergenic
1133944907 16:10340015-10340037 CCTCCTGGAGTCACAAAGCCTGG - Intronic
1135715167 16:24758480-24758502 CCTTCTTCAGTAACATACCCTGG + Intronic
1137510027 16:49091033-49091055 CATGCTGGAGTTACATATCATGG + Intergenic
1139169609 16:64615162-64615184 CCTCCTTGAGTGATATTTCCAGG - Intergenic
1140797233 16:78450251-78450273 CATCCTTGAGTTGCATATGATGG + Intronic
1142911668 17:3098343-3098365 CCTCCTTGAGTGATACCTCCAGG + Intergenic
1143218061 17:5239908-5239930 CCTCCTGGAGTCACAAAGCCTGG + Intergenic
1144624647 17:16838590-16838612 CCTCCTTGAGTCCCATAGCTGGG + Intergenic
1144881783 17:18434131-18434153 CCTCCTTGAGTCCCATAGCTGGG - Intergenic
1145150450 17:20510255-20510277 CCTCCTTGAGTCCCATAGCTGGG + Intergenic
1145238725 17:21227060-21227082 CCTCCTGGACTTACATAGCCTGG + Intergenic
1146162380 17:30566909-30566931 CCTCCTTGAGTCCCATAGCTGGG + Intergenic
1147954066 17:44122774-44122796 CTTCCATGAGATACAGATCCAGG + Intronic
1149174537 17:53853554-53853576 CCTCCTTGAGTGACATCTCCAGG + Intergenic
1149229614 17:54518480-54518502 GCTCCTTGAGTGACATCTCCAGG - Intergenic
1149242079 17:54662825-54662847 TTTCCTTGAGTGACATCTCCAGG - Intergenic
1149377853 17:56064066-56064088 CCTCCTTCAATGACATCTCCAGG - Intergenic
1153289865 18:3490270-3490292 CCTCCTTCAGTTCTATATTCTGG + Intergenic
1155847892 18:30731747-30731769 CCTCCTTGAGTGACATCTCTAGG + Intergenic
1155864443 18:30947463-30947485 CCTCCAAGAGTCACATATTCTGG + Intergenic
1156058767 18:33046729-33046751 CCTCCTTGAGTGACATCTCTAGG + Intronic
1156664667 18:39390595-39390617 CCTCCTTGAGTGACATCTCCAGG + Intergenic
1156778556 18:40822458-40822480 CCTCCTTGAGTGACATCTCCAGG + Intergenic
1157898799 18:51493645-51493667 ACACCCTGAGTTACATAACCAGG - Intergenic
1158105558 18:53882134-53882156 CCTCCTTGAGTGACATCTCCAGG - Intergenic
1158729076 18:60003319-60003341 CCTCCTTGACTGACATCTCCAGG - Intergenic
1162630426 19:11923433-11923455 CCTCCCTGAGTTTCCTGTCCTGG + Intergenic
1163872254 19:19831508-19831530 CCTCCTTGAGTGACATCTCCAGG + Intergenic
1163886045 19:19965907-19965929 ACTTCTTGAGTGACATCTCCAGG - Intergenic
1163888423 19:19989570-19989592 CCTCCTTGAGTGACATCTCCAGG + Intergenic
1163897352 19:20071169-20071191 CCTCCTTGAGTGACCTCTCCAGG + Intergenic
1163908077 19:20164936-20164958 CTTCCTTGAGTGACATCTCCAGG + Intergenic
1163935467 19:20438702-20438724 CCTCCTTGAGTAACATCTCTAGG - Intergenic
1163949576 19:20571485-20571507 CCTCCTTGAGTGACATCTCCAGG - Intronic
1163958279 19:20664167-20664189 CCTCCTTGATTGACATCTCCAGG - Intronic
1163968500 19:20770413-20770435 CCTCCTTGAGTGACATCTCCAGG + Intronic
1164050321 19:21580837-21580859 CATCCTTAGGTTACATACCCAGG + Intergenic
1164134980 19:22406295-22406317 CCTCCTTGAGTATTATCTCCAGG + Intronic
1165618759 19:37226382-37226404 ACTCCTGGTGTTACACATCCAGG + Intronic
1166887682 19:45971920-45971942 CCTCCTTGGGTCACACACCCAGG + Intronic
925447404 2:3940208-3940230 CCTCCTTGAGTGACATCTCAAGG - Intergenic
926873256 2:17446344-17446366 CCTCCTTGAGTGACATCTCCAGG + Intergenic
928744316 2:34393887-34393909 CCTCCTTGAGGTATAGATGCTGG + Intergenic
928757486 2:34544990-34545012 CCTCCATGAGTGACATCTCCAGG - Intergenic
928803796 2:35126003-35126025 CCTTCTTGAGTGACATCTCCAGG + Intergenic
929405618 2:41637686-41637708 CCTCCTCAAGTGACATCTCCAGG + Intergenic
930552381 2:52852192-52852214 CCTCCTTGAGTGACATCTCCAGG - Intergenic
931634036 2:64326216-64326238 CCTCTATGAGTTACATATTGTGG + Intergenic
933129586 2:78655635-78655657 CTTCCTTGAGTGACATCTCCAGG + Intergenic
933602441 2:84347369-84347391 CCTCCTTGAGTGACATCTCCAGG - Intergenic
934615292 2:95766977-95766999 CCTCCTGGAGTCACAAAGCCTGG - Intergenic
934645614 2:96057582-96057604 CCTCCTGGAGTCACAAAGCCTGG + Intergenic
934839018 2:97613671-97613693 CCTCCTGGAGTCACAAAGCCTGG + Intergenic
935989887 2:108709760-108709782 CCTCCTTGCTTTATATATCTGGG - Intergenic
936076969 2:109407816-109407838 CCTCCATGACTTACCAATCCTGG + Intronic
937893865 2:126962932-126962954 CCTCCTTGAGGAACATCTCCAGG - Intergenic
937931600 2:127209174-127209196 CCTCCTTGAGTGACATCTCCAGG + Intronic
938136728 2:128765425-128765447 CCTCCTTGAGTGACATCTCCAGG - Intergenic
939109806 2:137992857-137992879 CCTCTTTGAGTGACATCTCCAGG + Intronic
939391220 2:141571229-141571251 CCCGCTTGAGTGACATCTCCAGG + Intronic
939809061 2:146808687-146808709 CCTCCTTGAGTGACATCTCCAGG + Intergenic
939860545 2:147415243-147415265 CCTCCTCAAGTGACATCTCCAGG - Intergenic
940167765 2:150793529-150793551 CCTCCTTCAGTGACATCTCCAGG + Intergenic
940273290 2:151914801-151914823 CCTCCTTGAGTGACATCTCCAGG - Intronic
940410830 2:153361046-153361068 CCTCTTCGAGTGACATATCCAGG + Intergenic
941088448 2:161146644-161146666 CCTCCTTGAGTGATGTCTCCAGG - Intronic
941522822 2:166569830-166569852 CCTCCTGGATTTTCATCTCCAGG + Intergenic
942482498 2:176404307-176404329 CCTTCTTGAGTTTGGTATCCTGG + Intergenic
942560934 2:177217764-177217786 CCACCTTGGTTTCCATATCCTGG - Exonic
942924178 2:181411896-181411918 CCTCCTTGAGTGACATCTGCAGG + Intergenic
943514135 2:188863085-188863107 CCCCCTTGAGTGACATCTCCAGG + Intergenic
944224896 2:197339839-197339861 CCTGTTTGAGTCACATGTCCAGG + Intergenic
944385202 2:199155626-199155648 CCTCCTTGAGTGACATCTCCAGG + Intergenic
945381095 2:209141603-209141625 CCTCCTTCACTTACACATCTAGG - Intergenic
945439651 2:209864171-209864193 CCTCCTTGAGTGACATCTCCAGG - Intronic
948103170 2:235391423-235391445 ACTCCTTGAGTTGCATCTCTTGG - Intergenic
1169695677 20:8384850-8384872 CCTCCTTGAGTGACATCTCCTGG - Intronic
1169979145 20:11364143-11364165 TCTCCTTGAGTGACATCTCCAGG - Intergenic
1169980687 20:11380337-11380359 CCTCCTTGAGTGACATCTCTAGG + Intergenic
1170730073 20:18966245-18966267 CCTTCTTGAGTGACATCTCTAGG + Intergenic
1170758754 20:19230560-19230582 CCTAGTTGAGTTGCATTTCCGGG + Intronic
1172110402 20:32541434-32541456 GCTCCCTGAGTTTCATTTCCTGG + Intronic
1173411860 20:42818192-42818214 CCTCCTTGAGTGACATCTCCAGG + Intronic
1175257913 20:57657984-57658006 CGTGGTTGAGTTACACATCCTGG + Intronic
1175485052 20:59339739-59339761 CCTCCTTTAGTTGCACATGCAGG + Intergenic
1177099259 21:16879630-16879652 CATGCTTGGGTGACATATCCAGG + Intergenic
1177511281 21:22091353-22091375 CCTCCTTGAGTGACATCTCCAGG - Intergenic
1177878841 21:26668905-26668927 CCTCCTTAAGTGACATCTCCAGG - Intergenic
1177956494 21:27605716-27605738 CCTCCTCGAGTGACATATCCAGG - Intergenic
1179052762 21:37902839-37902861 GCTTCTTGAGTTAGATGTCCAGG - Intronic
1179087993 21:38237414-38237436 TCTCCTTTTGTTCCATATCCAGG - Intronic
1182938848 22:34254768-34254790 CCTCCTTGAGTGACATCTCCAGG - Intergenic
1183196132 22:36354755-36354777 CCACCTTGAGATACATTCCCAGG + Intronic
1184809626 22:46822566-46822588 CCTCCATGAGTGACATCTCTAGG - Intronic
949119836 3:372926-372948 CCTCCTTGAGTGACATCTCCAGG - Intronic
949465998 3:4344351-4344373 CCTCCTTGAGTGACATCTCCAGG + Intronic
949592800 3:5511049-5511071 CCTCCTTGAGTGACATCTCCAGG + Intergenic
950463853 3:13141698-13141720 CCTCCTCGACCTACATATCAGGG + Intergenic
952503695 3:33988783-33988805 CCTCCTTGAGTGACATTTCCAGG - Intergenic
952634111 3:35505938-35505960 CTTCCTTGAGTGACATCTCCTGG + Intergenic
952800526 3:37286593-37286615 CTTCCTTGAGTTACAGATCTCGG + Intronic
953115553 3:39989353-39989375 GCTCCTTGTGTGACATCTCCAGG - Intronic
954726466 3:52615414-52615436 TCTCCTTGAGTAACTTCTCCAGG + Exonic
954960964 3:54564538-54564560 ACTCTTTGAGTCACATGTCCAGG - Intronic
955832029 3:63015205-63015227 CCTCCTTGAGTGACAACTCCAGG - Intergenic
957028734 3:75215375-75215397 CCACCTTGGTTTCCATATCCTGG - Intergenic
957224993 3:77431945-77431967 CATCCTTGAATTCCAAATCCTGG + Intronic
957268796 3:78002864-78002886 CCTCCTTGAGTGACATCTCCAGG - Intergenic
957394826 3:79622990-79623012 CCTCCTTGAGTGACATCTCCAGG + Intronic
957510362 3:81180066-81180088 TGTCCTTCAGTTATATATCCTGG - Intergenic
958503664 3:94946222-94946244 CCGCCTTGAGTGACATCTCCAGG - Intergenic
959031002 3:101299724-101299746 CCTCCTCGAGTGACATCTCCAGG - Intronic
959258797 3:104048742-104048764 CCTACTTGAGTGACATCTCCAGG + Intergenic
959418277 3:106103877-106103899 CCTCCTTGAGTGACATATCCAGG - Intergenic
959452802 3:106523683-106523705 CCTCCTTGAGTGACATCTCCAGG + Intergenic
960192585 3:114724609-114724631 GCTCTTTGAGATACATATTCTGG - Intronic
960233544 3:115255458-115255480 CCTCCTTGACTGACATCTCCAGG + Intergenic
960413822 3:117359526-117359548 CCTCCTTGAATGACATCTCCAGG + Intergenic
960477170 3:118144462-118144484 GCTCGTTGAGTGACATCTCCAGG - Intergenic
960565426 3:119126693-119126715 ACTCCTTGAATGACATCTCCAGG + Intronic
963400375 3:144790624-144790646 CATCCTTGAGTGACATCTCCAGG - Intergenic
964985378 3:162732082-162732104 CCTCCTGGAGTCACAAAGCCTGG + Intergenic
965263419 3:166511270-166511292 CCTCCTTGAGTGACACCTTCAGG + Intergenic
966250415 3:177859770-177859792 CCTCCTTGAATGACATCTCCAGG - Intergenic
966539543 3:181074681-181074703 CCTCCTTGAGTGGCATCTCCAGG - Intergenic
968692204 4:1997954-1997976 CCTCCTTTAGTGACACCTCCAGG + Intronic
970155194 4:13134141-13134163 TCTCCTTGAGTGACATCTCCAGG + Intergenic
970288025 4:14539739-14539761 CCTCCTTGAGTGACATCTTCAGG + Intergenic
970494388 4:16610024-16610046 CCTCCTTGAGTGACATCTCCAGG + Intronic
970608910 4:17707760-17707782 CCTCCTTAAGCTGCACATCCAGG + Exonic
970952653 4:21775285-21775307 CCTCCTTGAGTGACCTCTCCAGG - Intronic
971516727 4:27496620-27496642 CCTCCTTGAGTGACATCTCCAGG + Intergenic
971906526 4:32732872-32732894 TCTCCTCGAGTGACATCTCCAGG + Intergenic
973018615 4:45172293-45172315 CCTCCTCGAGTGTCATCTCCAGG - Intergenic
974181130 4:58386209-58386231 CCTCCTCAAGTGACATCTCCAGG - Intergenic
974271566 4:59656736-59656758 CCTCCTTGGGTGACATCTCCAGG + Intergenic
974499798 4:62684654-62684676 CCTCCTTGGGTGACATCTCCAGG + Intergenic
974741525 4:66013838-66013860 CCTCCTTGAATGACATCTCCAGG - Intergenic
974768750 4:66383349-66383371 CCTCCTTGAGTGACACCTCCAGG + Intergenic
974885308 4:67810184-67810206 CCCCCTTGAGTGACATCTCCAGG + Intergenic
975747817 4:77492088-77492110 CATCCTTGAGATCCATTTCCAGG - Intergenic
976538118 4:86242175-86242197 CCTCCTTGAATGACATCTCCAGG - Intronic
976807331 4:89063099-89063121 CCTCCTTGAGTGACATCTCCAGG - Intronic
977462072 4:97337685-97337707 CCTCCTTGAGTGACATCTCCAGG + Intronic
978206250 4:106083759-106083781 CCTCCTTGAGTGACATCTCCAGG + Intronic
978656922 4:111075362-111075384 CTTCCTTGAGTGACAGCTCCAGG + Intergenic
979197750 4:117941122-117941144 CTTCCTTGAGTCACATCTCCAGG - Intergenic
979583791 4:122391185-122391207 CCTCCCTGAGTGACATCTCCAGG - Intronic
979628318 4:122871669-122871691 CCTCCTTGAGTAACATCTCCAGG + Intronic
980392835 4:132169220-132169242 CCTCCCTGAATGACATCTCCAGG - Intergenic
980626398 4:135380181-135380203 CCTCCTTGAGTGACATCTCCAGG - Intergenic
980787321 4:137572411-137572433 CCTCCTTGAGTGACATCTCCAGG - Intergenic
981919846 4:150075820-150075842 CCACCTTGAGTTAAAAATACTGG + Intergenic
982528313 4:156506408-156506430 CCTCCTTGAATGACATCTCCAGG + Intergenic
983403053 4:167289626-167289648 CCTTCTTGAGTGACATCTACAGG - Intergenic
983972223 4:173889662-173889684 CCTCCTCGAGTGACATCTCCAGG - Intergenic
984071047 4:175112892-175112914 CTTCCTTGAGTTGCATATTTAGG - Intergenic
984092199 4:175387883-175387905 CCTCCTTGAGTGACACCTGCAGG + Intergenic
984215839 4:176911471-176911493 CCTTCTTGAGTGACATCTCCAGG + Intergenic
984626018 4:182009058-182009080 CCTCCTTGAGTGACATCTCCAGG - Intergenic
984723427 4:182998160-182998182 CCTCTTTGGGTGACATCTCCAGG + Intergenic
986492515 5:8307132-8307154 CCTCCTTGAGTGACATCTCCAGG + Intergenic
987207465 5:15642321-15642343 CCTTGGAGAGTTACATATCCTGG - Intronic
987399746 5:17463337-17463359 CCTCCTTGAGTGACATCTCCAGG - Intergenic
987453958 5:18120022-18120044 CCTCCTTGAGTGACATCTCCAGG + Intergenic
987834616 5:23145761-23145783 CCTCTTTGAGTGACACCTCCAGG - Intergenic
989092142 5:37744091-37744113 CCTCCTTGAGTGACATCTCCAGG + Intronic
990016114 5:51064210-51064232 CCTCCTCGAGTGACATCTCCAGG + Intergenic
990138997 5:52682008-52682030 CCTCCTTGAGTGACATCTCCAGG - Intergenic
990620012 5:57549749-57549771 TCTCCTTGAGTGACATCTCCAGG - Intergenic
991140155 5:63231448-63231470 CCTCCTAAAATTACATATCAGGG - Intergenic
993117174 5:83733305-83733327 CCTCCCTGAGTAACATCTCCAGG - Intergenic
993963205 5:94327296-94327318 CCACCTTTATTTACATTTCCAGG + Intronic
994344614 5:98669414-98669436 CCTCCTTGAGTGGCATCTCCAGG + Intergenic
994696532 5:103079360-103079382 CCTCCTTGAGTGACATCTCCAGG - Intergenic
995003097 5:107158572-107158594 CCTCCTTGAGTGACATCTCCAGG + Intergenic
995080760 5:108048117-108048139 TCTCCTTGAGTGACATCTCCAGG + Intronic
995264072 5:110138399-110138421 CCCCCTTGGGTGACATCTCCAGG - Intergenic
995401043 5:111741990-111742012 ACTCCTTGAGTTTCATTGCCTGG + Intronic
995666266 5:114545309-114545331 CTTCCTTGAGTGACATCTCCAGG + Intergenic
995685261 5:114765924-114765946 CCTCCATGAGTGACATCTCCAGG - Intergenic
995960064 5:117829260-117829282 CCTCCTTGAGTGACATCTCCAGG - Intergenic
996040661 5:118806725-118806747 CATCAGTGAGTCACATATCCTGG + Intergenic
996287641 5:121813358-121813380 CCTCCTTGAGTGACATCTCCAGG - Intergenic
996729449 5:126703273-126703295 CCTCCTGGAGTCACAAAGCCTGG - Intergenic
996925996 5:128827385-128827407 CCTATTTGAGTTTCCTATCCAGG + Intronic
997325680 5:133018807-133018829 CCTCATAGAGTCACATAGCCAGG + Intronic
997889602 5:137663704-137663726 TATCCGTGAGTTCCATATCCAGG - Intronic
998788923 5:145744524-145744546 CCTTCTTGAGTGACATCGCCAGG + Intronic
998867724 5:146522108-146522130 CCTTCCTGAGTGACATGTCCAGG + Intergenic
999596987 5:153215372-153215394 CCTCCTCGAGTGACATCTCCAGG + Intergenic
1001355813 5:171022120-171022142 CCTTGTTGAGTGACATCTCCAGG - Intronic
1001839611 5:174864298-174864320 CCTCCTTGAGTGACATCTCCAGG - Intergenic
1003687001 6:8314662-8314684 TCTCCTTGAGTAATATCTCCAGG - Intergenic
1004101856 6:12620770-12620792 CCTCTTAGAGTTACCTATTCTGG - Intergenic
1004760204 6:18657199-18657221 CCTCCTTGAGTGACATCTCCAGG + Intergenic
1005120945 6:22389298-22389320 CCTCCTTGAGTGATATCTCCAGG - Intergenic
1005170707 6:22981117-22981139 CCTCCTTGAGTGACATCTCCAGG + Intergenic
1005296914 6:24435875-24435897 TTTCCTTAAGTTACATTTCCTGG - Intronic
1008166794 6:48149112-48149134 CCACCTTGGTTTGCATATCCTGG + Intergenic
1008468164 6:51854252-51854274 TCTCCTTGAGTGACATCTCCAGG - Intronic
1008741648 6:54615588-54615610 CCTCCTTTAGTGACATCTCCAGG + Intergenic
1008773556 6:55008714-55008736 CCTCCTTGAGTGACATCTCCAGG - Intergenic
1008819207 6:55609851-55609873 CCTCCTTAAGTGACATCTCTAGG + Intergenic
1009316621 6:62228825-62228847 CTTCCTCGAGTGACATCTCCAGG - Intronic
1009916694 6:70005479-70005501 ACTCCTTGAGTGACATCTCCAGG - Intronic
1010282894 6:74041142-74041164 CCTCCTTGAGTGACATCTCCAGG - Intergenic
1010331389 6:74627129-74627151 CCTCTCTGAGTGACATCTCCAGG + Intergenic
1010411798 6:75569124-75569146 CCTCCTTGAGTGACATCTCCAGG + Intergenic
1010718885 6:79261208-79261230 CCTCCTTGAGTGACATCTCCAGG - Intergenic
1010945708 6:81970722-81970744 CCTCCTTGAGTGACATCTCCAGG + Intergenic
1011944264 6:92881067-92881089 CCTCTTTGAGTGACATCTCCAGG + Intergenic
1012063167 6:94512380-94512402 CCTCCTTGAGTGACATCTGCAGG + Intergenic
1012434745 6:99203713-99203735 CCTCCTTGAGTTGCATCTCCAGG - Intergenic
1013461613 6:110379394-110379416 CCTCCTTGAGTGACGTCTCCAGG + Intergenic
1014084864 6:117330644-117330666 CCTCCTTGAGTTACATATCCAGG + Intronic
1014369188 6:120583941-120583963 CCTCCTTAAGTGACATCTCCAGG - Intergenic
1015136918 6:129882795-129882817 CCTCCTTGAGTGACATATCCAGG - Intergenic
1015358281 6:132305675-132305697 CCTCCTGGAGTGTCATCTCCAGG + Intronic
1015416134 6:132950731-132950753 ACCCCTTGAGTTAAAAATCCTGG - Intergenic
1015660081 6:135565890-135565912 CCTCCTCAAGTGACATCTCCAGG - Intergenic
1017590610 6:155974726-155974748 CCTCCTTTAGTAACATATTTTGG + Intergenic
1018574306 6:165243253-165243275 CCTGCTTGAGGTACATCTCCTGG + Intergenic
1019113440 6:169737633-169737655 CTTCCTTGAGTGACATCTCCAGG - Intergenic
1019718266 7:2552448-2552470 CCTCTTTGAGCTAAATATCTAGG - Intronic
1020525357 7:9251640-9251662 CCTCCTCGAGTGACATCTCCAGG + Intergenic
1020620879 7:10517347-10517369 CCTCCTTGAGTGACATCTCCAGG + Intergenic
1020621882 7:10528418-10528440 CCTCCTTGAGTGACATCTCCAGG + Intergenic
1020633696 7:10671724-10671746 CCTCCTTGAGTGACATCTCTGGG - Intergenic
1022416791 7:30185287-30185309 CCTCTTTGAGTTTCAATTCCTGG + Intergenic
1022523674 7:31023685-31023707 CCTCCTTGAGGCACATATAGGGG + Intergenic
1022634733 7:32120552-32120574 CCTCCTTGAGTGATATCTCCAGG + Intronic
1023207273 7:37764083-37764105 TCTCCTCGAGTGACATCTCCAGG + Intronic
1023363605 7:39441016-39441038 ACTTCTTGAATGACATATCCAGG - Intronic
1023557479 7:41438210-41438232 TCTTTTTGAGTTACATTTCCAGG - Intergenic
1024089602 7:45924310-45924332 CCTCCCGGAATTACATATACTGG + Intergenic
1027944131 7:84723409-84723431 CCTCCTTGAATGACATCCCCAGG + Intergenic
1028049001 7:86158946-86158968 GCTCCTTGAGTGACATCTTCAGG + Intergenic
1028442602 7:90880754-90880776 CCTCCTTGAGTGACATCTCCAGG + Intronic
1028779425 7:94719394-94719416 CCTCCTCGAGTGACATCTCTAGG - Intergenic
1029039582 7:97558344-97558366 CTTCCTTAAGAGACATATCCAGG + Intergenic
1029041551 7:97580903-97580925 CCTCCCTGAGTGACATTTCTAGG + Intergenic
1029057193 7:97759315-97759337 CCTCTTTAAATTTCATATCCTGG - Intergenic
1030701474 7:112646425-112646447 TCTCCTTGAGTGACATCTTCAGG - Intergenic
1030759453 7:113332272-113332294 TCTCCTTGAGTGACATCTCCAGG + Intergenic
1031804678 7:126293171-126293193 CCCCCTTGAGTGGCATCTCCAGG + Intergenic
1032776907 7:135122708-135122730 CCTCCTTGAGTGACATCTCCAGG + Intronic
1032926729 7:136614616-136614638 CCTCCTTGAATGACATTTCCAGG - Intergenic
1033879185 7:145860649-145860671 CCTCCCTGAGTGACATCTCCAGG + Intergenic
1033879499 7:145863050-145863072 CCTCCCTGAGTGACATCTCCAGG + Intergenic
1035599400 8:888701-888723 CCTCCCTGAGTGACATCTCCAGG - Intergenic
1036426955 8:8653875-8653897 CCTCCTCCAGTTGCAAATCCAGG + Intergenic
1037174001 8:15925966-15925988 CCTCCTGGAGTCACAAAGCCTGG + Intergenic
1038073785 8:24046891-24046913 CCTCCTTGAGTGACATCTCCAGG + Intergenic
1039265248 8:35816518-35816540 TCTCCTGGAGTGACATCTCCAGG + Intergenic
1039293756 8:36127276-36127298 CCTCCTTGAGTCACATCTCCAGG - Intergenic
1039719840 8:40151441-40151463 CCTCCTTGAAAGACATTTCCAGG - Intergenic
1040370308 8:46764306-46764328 CCTCTTTAAATTTCATATCCTGG + Intergenic
1040937616 8:52797371-52797393 CTTCCTTGAGTTACATAAGCAGG - Intergenic
1041021303 8:53642041-53642063 CCTTCTTGAGTGACATCTCCAGG - Intergenic
1041743171 8:61177656-61177678 CCTCCTCAAGTGACATCTCCAGG + Intronic
1042630044 8:70806081-70806103 CCTCCTTGAGTGACATCTCCAGG + Intergenic
1042759757 8:72257652-72257674 CCTCCTCGGGTGACATCTCCAGG + Intergenic
1043223755 8:77699031-77699053 CCTCCTTGAGGGACATCTGCAGG - Intergenic
1044356055 8:91224508-91224530 CCTCCTTGAGTGACATCTCCAGG - Intronic
1045705353 8:104916335-104916357 CCTCCCTGAGTGACATCTCCAGG - Intronic
1046317002 8:112517102-112517124 TCTCCTTGAAGTTCATATCCTGG + Exonic
1046338811 8:112825655-112825677 CCTCCTCAAGTGACATCTCCAGG - Intronic
1046570254 8:115954979-115955001 ACTCATTGACTTACATATTCTGG - Intergenic
1046708929 8:117487478-117487500 CCTCACTGAGTGACATTTCCAGG + Intergenic
1046860276 8:119083668-119083690 CCTGCTTTAGTTTCCTATCCGGG - Intronic
1047174612 8:122528688-122528710 CCTCCTTGAGTTTGAGATTCTGG + Intergenic
1048587614 8:135790166-135790188 CCTCCTTGAGTGATATCTCCAGG - Intergenic
1048587863 8:135791569-135791591 CCCCCTTGAGTGATATCTCCAGG + Intergenic
1048801150 8:138194716-138194738 CCCCCTTGTGTTAGATATCTGGG - Intronic
1050630194 9:7550063-7550085 CCTCCTGAAGTGACATCTCCAGG + Intergenic
1050660833 9:7880692-7880714 CCTCCTCAAGTGACATCTCCAGG + Intronic
1050773057 9:9227661-9227683 CCTTCTTGAATTACTTATCTGGG + Intronic
1050982418 9:12036617-12036639 CCTCCTTGAGTGACATCTCCAGG + Intergenic
1051003542 9:12314855-12314877 ACTCCTTGAGTGACATCTCCGGG - Intergenic
1051036073 9:12747069-12747091 CCGCCTTGAGTGACATCTCTGGG - Intergenic
1052199837 9:25764385-25764407 CCTCCTCGAGTGACATCTCCAGG + Intergenic
1052225193 9:26077464-26077486 ACTCCTTGAGTAACATTTCCAGG - Intergenic
1052369332 9:27645992-27646014 CCTCCCTGAGTGACACCTCCAGG + Intergenic
1052420883 9:28241798-28241820 CCTCCCTGAATAACATCTCCAGG + Intronic
1052546741 9:29889416-29889438 CCTCCTTGAGTGACATATCCAGG + Intergenic
1052781144 9:32783138-32783160 CCTTCTCCAGTTACAAATCCGGG - Intergenic
1052885307 9:33641139-33641161 CCTCCTTGGGCTTCATATCCTGG - Intergenic
1055153228 9:73028608-73028630 CCTCTTTGAGTTACATTTGGAGG - Intronic
1058374394 9:104305711-104305733 CCTCCTTGAATGACATCTCCAGG + Intergenic
1058485089 9:105435646-105435668 CCTCCTGGAGTCACAAAGCCTGG - Intronic
1058591115 9:106565951-106565973 CCTCCTTGAGTGACATCTCCAGG + Intergenic
1059237067 9:112770075-112770097 CCACCTTCAGTCATATATCCAGG + Intronic
1059596385 9:115724654-115724676 CCTCCGTGAGTGACATCTCCAGG + Intergenic
1059746121 9:117203678-117203700 ACTCCTTGAGTGACATCTCCAGG - Intronic
1059895225 9:118856417-118856439 CCTCCTTGAGTGACATCTCCAGG + Intergenic
1185846182 X:3440542-3440564 CCTCCTTGAGTGACATCTCCAGG - Intergenic
1185952574 X:4452452-4452474 CCTCCTTGAGTGACATCTCCAGG + Intergenic
1186510833 X:10128661-10128683 CCTCCTTGCGCTCCATCTCCAGG - Exonic
1188092261 X:25977577-25977599 CCTCCTTCAGTGACATCTCCAGG + Intergenic
1188593401 X:31866457-31866479 CCTCCATAAATTACATATCAGGG + Intronic
1188881425 X:35496770-35496792 CCTCCTGGAGTCACAAAGCCTGG + Intergenic
1188884432 X:35531881-35531903 CCTCCTTGAGTAACATCTCCAGG + Intergenic
1189571979 X:42307285-42307307 CCTCCTTGAGTGACATCTCCAGG + Intergenic
1190529708 X:51362107-51362129 CCTCCTTGAGTGACATCTCCAGG + Intergenic
1192026436 X:67457261-67457283 CCTCCTTGAGTGACATCTCCAGG + Intergenic
1192952022 X:76026933-76026955 CCTCCTTGAGTGACATCTCCAGG + Intergenic
1193039381 X:76988156-76988178 CCTCCTTGAGTGACATCTCCAGG + Intergenic
1193091192 X:77494982-77495004 CCTCCTTGAGAGACATCTCCAGG + Intergenic
1193158833 X:78204814-78204836 CCTTCTTAAGTGACATCTCCAGG + Intergenic
1193227318 X:78998825-78998847 CATCCTGGAGTGACATTTCCAGG + Intergenic
1193719416 X:84970982-84971004 CCTCCTTGAATAACATCTCCAGG - Intergenic
1193768456 X:85560748-85560770 ACTCCTTGAGTGACATCTCCAGG - Intergenic
1193780704 X:85698522-85698544 TCTCCTTGAGGGACATCTCCAGG - Intergenic
1194021962 X:88702196-88702218 CCTCCTTGAGTGACATCTCCAGG - Intergenic
1194058112 X:89163322-89163344 GCTCCTTAAGTGACATCTCCAGG - Intergenic
1194133059 X:90106056-90106078 GCTCCTTGAGTGACATCTCCAGG - Intergenic
1194193606 X:90865793-90865815 CCTCCTTGGGTGACATCTCTAGG + Intergenic
1194286879 X:92020868-92020890 CCTCCTCGAGTGACATCTCCAGG + Intronic
1194445971 X:93987213-93987235 CCCCCTTGAATGACATCTCCTGG + Intergenic
1194489764 X:94531206-94531228 CCTCCTTTAGTGACATCTCCAGG + Intergenic
1194523224 X:94943409-94943431 CCCCCTTGAGTAACATCTCCAGG + Intergenic
1194596804 X:95868434-95868456 CCACCTTGAGTGACATCTCCAGG + Intergenic
1194797474 X:98229551-98229573 CCTCATTGAGGTACAGATGCAGG - Intergenic
1195686278 X:107589416-107589438 CCTCCTTGAGTGACATCTCCAGG - Intronic
1195983203 X:110601559-110601581 CCTCCTCAAGTGACATCTCCAGG + Intergenic
1196054558 X:111340696-111340718 CCTCCTTGAGTGACATCTCTAGG + Intronic
1196517182 X:116628094-116628116 CACCCTTGAGTAACATCTCCAGG - Intergenic
1196607259 X:117671317-117671339 CCTCCTTGAGTGACGTCTCCAGG - Intergenic
1197030018 X:121802505-121802527 CCACCTTGAGTGACATCTCCAGG - Intergenic
1197046389 X:122003664-122003686 CCTCCTTGAGTGACGTCTCCAGG - Intergenic
1197049471 X:122042036-122042058 CCTCCTCAAGTGACATCTCCAGG - Intergenic
1197302843 X:124802430-124802452 CCTCCTCGAGTGACATCTCCAGG - Intronic
1197403838 X:126027054-126027076 GCTTCCTGAGTGACATATCCAGG - Intergenic
1197602051 X:128542952-128542974 CCTCCTTGACTGACATCTCCAGG - Intergenic
1198761100 X:140033223-140033245 CCACCTTGGTTTCCATATCCTGG - Intergenic
1199567325 X:149229746-149229768 CCTCCTCAAGTAACATCTCCAGG - Intergenic
1199927032 X:152478577-152478599 CCTCCTGGAGTTTCAAATTCTGG - Intergenic
1200478847 Y:3676131-3676153 GCTCCTTGAGTGACATCTCCAGG - Intergenic
1200540218 Y:4448175-4448197 CCTCCTTGGGTGACATCTCTAGG + Intergenic
1200604421 Y:5245428-5245450 CCTCCTCGAGTGACATCTCCAGG + Intronic
1200818321 Y:7555860-7555882 CCTCCTTGAGTGACATCTCCAGG + Intergenic
1201739136 Y:17304504-17304526 CCTCTTTGAGTGACATTTCCAGG + Intergenic