ID: 1014089282

View in Genome Browser
Species Human (GRCh38)
Location 6:117385139-117385161
Sequence CCTGCCAAGAACCAACGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 62}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014089279_1014089282 9 Left 1014089279 6:117385107-117385129 CCTTGAATCATGCTTTTGGAGCA 0: 1
1: 0
2: 0
3: 12
4: 147
Right 1014089282 6:117385139-117385161 CCTGCCAAGAACCAACGCTCAGG 0: 1
1: 0
2: 0
3: 5
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014089282 Original CRISPR CCTGCCAAGAACCAACGCTC AGG Intronic
900594158 1:3472818-3472840 CCTGCCACGATCCCACGCACTGG - Intronic
915262700 1:154689560-154689582 CCTGGCCAGAAGCAATGCTCAGG + Intergenic
921149043 1:212385497-212385519 CCTACCAACAACCTACGTTCTGG + Intronic
1075836915 10:125462037-125462059 CCTAACAAGAACCAAGGCTCAGG + Intergenic
1080970329 11:37266781-37266803 TCTGGTAAGAACCAACTCTCTGG + Intergenic
1081003984 11:37710793-37710815 CCTGACAAGTACCAACACACTGG + Intergenic
1087002807 11:93437756-93437778 CCCGCCAAGAAAAAAAGCTCTGG + Exonic
1091696300 12:2630452-2630474 CCTGCCCAGAAACAAGGCCCAGG - Intronic
1095914819 12:47467171-47467193 TCTGCCAAGAGGCAGCGCTCAGG + Intergenic
1101652513 12:106690546-106690568 CCAACCAAGAACAAACGCACTGG - Intronic
1101717382 12:107322201-107322223 CCTGCCCAAAACCAACTCTGTGG - Intronic
1103283917 12:119784511-119784533 CCTGCCCAGAGGCAACGCTCTGG - Intronic
1105683221 13:22751674-22751696 CCTGCCAAGTACCGTCTCTCAGG - Intergenic
1109383724 13:61599910-61599932 CCTGCCAAGCACCATTTCTCCGG + Intergenic
1115241797 14:31257258-31257280 CCTGCCAAGATCCAAGACTTCGG - Intergenic
1122984528 14:105206118-105206140 CCTGCAAAGCACCTGCGCTCAGG + Intergenic
1130916617 15:88310161-88310183 CCTGCTTAGAATCAACACTCTGG - Intergenic
1132766052 16:1534668-1534690 CCTGCCCAGAGGCCACGCTCAGG - Intronic
1136024994 16:27463400-27463422 CCTGCCAAGAACCAAGGTGCCGG + Intronic
1138627678 16:58265576-58265598 CTTGACAAGAACCACAGCTCTGG + Intronic
1148397902 17:47324494-47324516 TCTTCCAAGAACCCACGCTGAGG - Exonic
1166487441 19:43225481-43225503 CCTGCCAGGAATCAGGGCTCAGG - Intronic
1166494289 19:43287370-43287392 CCTGCCAGGAATCAGGGCTCAGG - Intergenic
1202640453 1_KI270706v1_random:79960-79982 CATGCCAAGAACATACGCTGGGG + Intergenic
930147797 2:48025184-48025206 CCTGGCAAGAACCAGCTCTGGGG + Intergenic
933715161 2:85354640-85354662 CCAGCGAAGAGCCAACTCTCAGG + Intronic
934555182 2:95283268-95283290 CCTGCCAAGGACCAGAGCCCAGG - Intronic
934619360 2:95794544-95794566 CCTGCCCAGGGCCAAAGCTCAGG - Intergenic
934641532 2:96030013-96030035 CCTGCCCAGGGCCAAAGCTCAGG + Intronic
946519731 2:220451605-220451627 TCTTCCTAGAACAAACGCTCAGG - Intergenic
947546157 2:231011746-231011768 CCTGCCAAGGCCCCAGGCTCAGG + Intronic
947868639 2:233419533-233419555 CAAGCCAAGAAGCAACCCTCTGG - Intronic
947991440 2:234490967-234490989 CGTTCCAAGAACCCAAGCTCTGG + Intergenic
948902282 2:240962823-240962845 CCTCCCCAGCACCTACGCTCTGG - Intronic
1169548650 20:6678523-6678545 CTTCCCAGGAACCAAAGCTCTGG - Intergenic
1170585135 20:17728617-17728639 CATGCCAAAAGCCAAAGCTCTGG - Intronic
1173076340 20:39823379-39823401 CCTGCAAAGGATCAAAGCTCTGG + Intergenic
1173183228 20:40820228-40820250 TCTGCCCAGAAGCAAGGCTCTGG - Intergenic
1174735291 20:52960304-52960326 CCTGCAAAGAAACAATGATCTGG - Intergenic
1175929452 20:62486818-62486840 CCTCCCAAGCACCAAAGCTATGG - Intergenic
1177907691 21:26991999-26992021 CCAGCCACGAACCAACACTGGGG - Intergenic
1180361491 22:11901920-11901942 CATGCCAAGAACATACGCTGGGG - Intergenic
1182722214 22:32412236-32412258 CCTTCCAAGAACCAAAGCGCAGG + Exonic
952034554 3:29183863-29183885 ACTGCTAAGAACCCACGCACAGG + Intergenic
962585299 3:136836682-136836704 CCTGCCAAGAACCACAGCAAGGG + Intronic
963347335 3:144110812-144110834 CCAGCCAAGAACCAACCTTCAGG - Intergenic
967692077 3:192487053-192487075 CCTGCCTAGAACCAACTGGCTGG + Intronic
967984153 3:195082887-195082909 CCTGCCAAGAGCCAACAGTGAGG + Intronic
1202738102 3_GL000221v1_random:27441-27463 CATGCCAAGAACGTACGCTGGGG - Intergenic
969670394 4:8586988-8587010 CCTGCCACGCACTCACGCTCCGG - Intronic
973383968 4:49490471-49490493 CATGCCAAGAACATACGCTGGGG + Intergenic
1202767818 4_GL000008v2_random:165804-165826 CATGCCAAGAACATACGCTGGGG + Intergenic
988436073 5:31177108-31177130 CATGCCAAAAACCAACAGTCAGG + Intergenic
996937721 5:128967137-128967159 TCTGCCAAGAGCCCACGTTCTGG - Intronic
1000292010 5:159879302-159879324 CCTCCCATGAACCACAGCTCTGG + Intergenic
1002586589 5:180252643-180252665 CCTGCCAAGCGCCTCCGCTCCGG + Intronic
1013366380 6:109441012-109441034 CCTGCGAAGAAGGAACGGTCTGG + Exonic
1014089282 6:117385139-117385161 CCTGCCAAGAACCAACGCTCAGG + Intronic
1023904536 7:44512950-44512972 CAGGCCAAGAGCCAACGCTGTGG - Exonic
1031217046 7:118908060-118908082 TCTGCCAAGAACAAAAGCTTAGG - Intergenic
1035260277 7:157656646-157656668 CCTGCTAAGATCCAAGGTTCAGG + Intronic
1044320709 8:90797894-90797916 CCTGGAAAGAACCAACACCCAGG - Intronic
1203692229 Un_GL000214v1:54725-54747 CATGCCAAGAACATACGCTGGGG + Intergenic
1203706831 Un_KI270742v1:57885-57907 CATGCCAAGAACGTACGCTGGGG - Intergenic
1203556417 Un_KI270744v1:1617-1639 CATGCCAAGAACATACGCTGGGG + Intergenic
1203644066 Un_KI270751v1:49466-49488 CATGCCAAGAACATACGCTGGGG - Intergenic
1193572371 X:83160418-83160440 CCTGCCAAGAACAAAAGGACAGG - Intergenic
1195660259 X:107371069-107371091 CCTGCCAAGAAACTATGGTCAGG + Intergenic