ID: 1014089715

View in Genome Browser
Species Human (GRCh38)
Location 6:117389868-117389890
Sequence CCTTTGGACTGAATCTCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 107}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014089715 Original CRISPR CCTTTGGACTGAATCTCATG AGG (reversed) Intronic
905204259 1:36334052-36334074 CTTTTGGACTGGCTCTGATGCGG - Intergenic
905429161 1:37909193-37909215 GCTTTGGGATGAATCTCATTGGG - Intronic
907820167 1:57959684-57959706 CCTTTGGACAGCTTCTCATCAGG - Intronic
918890438 1:190259295-190259317 TCTTTGGGCTAAATCTCATCTGG - Intronic
919455368 1:197814686-197814708 CCTTTTGCCTTTATCTCATGAGG - Intergenic
919516440 1:198531462-198531484 CATTTGGACTGATTTTCAGGTGG + Intronic
920792438 1:209106092-209106114 CCTTTGCTCTGAAACTTATGTGG + Intergenic
1068528159 10:58154771-58154793 CCATTGCACTGAAGCTCATTTGG + Intergenic
1069778345 10:70939722-70939744 CCTTTGGACTAAATGTCCTTTGG - Intergenic
1071445046 10:85737834-85737856 CCTTTGAACTGAATTTCAAATGG + Intronic
1071518915 10:86316952-86316974 CAGCTGGACTGAATCTCTTGGGG - Intronic
1073951430 10:108813860-108813882 CCTTCGGACTTAATACCATGTGG - Intergenic
1080912013 11:36610867-36610889 CCTTTAGACTGGATGTGATGAGG + Intronic
1087907490 11:103715661-103715683 ACTTCAGGCTGAATCTCATGAGG - Intergenic
1090560178 11:127924078-127924100 CCTTTGGTGTGAATATCATGTGG + Intergenic
1093197179 12:16143314-16143336 CCTAGGCAATGAATCTCATGTGG - Intergenic
1107109941 13:36686072-36686094 CCACTGGACTGAATCTCATCTGG - Intronic
1107922086 13:45219275-45219297 CCTTTGGAATCAATCAGATGTGG - Intronic
1108131399 13:47305096-47305118 CCTTTGGATTGAATCCCACCAGG - Intergenic
1110924515 13:81133248-81133270 CCTATGGACTCATTCTTATGTGG + Intergenic
1112299928 13:98220605-98220627 CCTTTAAATTTAATCTCATGGGG - Intronic
1112786680 13:102958820-102958842 CCTTTGGTCAGAATCTCTGGTGG + Intergenic
1115163844 14:30426075-30426097 CCTTTTGACTGGATCCCATTAGG - Intergenic
1118055171 14:62072404-62072426 TCTTTGCAATGAATCTCTTGGGG - Intronic
1122735954 14:103841944-103841966 CCTTTGGACTTAGTCTCTTCGGG - Intronic
1123027351 14:105432954-105432976 GCTTTCGACTGAAGCTCAGGCGG - Intronic
1128825705 15:70714238-70714260 CCTTTGGACTAAATGGAATGGGG - Intronic
1131008646 15:88999283-88999305 CCTGTGGGCTGAATCTCTTCTGG + Intergenic
1131710458 15:95048626-95048648 TTTTTGGACTGAATCTGATTGGG - Intergenic
1131715630 15:95107812-95107834 CATGAGGACTGAATGTCATGTGG - Intergenic
1133059516 16:3165340-3165362 CCCTGGGACTGAGTCTCCTGGGG - Intergenic
1141166945 16:81667299-81667321 TATTTGGACTGAATCTCCAGAGG - Intronic
1146483544 17:33224966-33224988 CCCTTGGACAGAGTCTGATGGGG + Intronic
1147452154 17:40512372-40512394 CCTTGGGCCTGCATCGCATGGGG + Intergenic
1147902969 17:43802247-43802269 CCTGTGTACTGAATGTCATGCGG - Intronic
1151849527 17:76682183-76682205 CCTGTGAACTGAAGCTCCTGGGG + Intronic
1155025365 18:21935786-21935808 ACTTGGGACTGAATCTCCAGGGG + Intergenic
1164908514 19:31986735-31986757 CATGGGGACTGTATCTCATGGGG + Intergenic
1166440826 19:42813615-42813637 TCTTTCCAGTGAATCTCATGGGG + Intronic
1166460327 19:42982497-42982519 TCTTTCCAGTGAATCTCATGGGG + Intronic
1166477601 19:43142204-43142226 TCTTTCCAATGAATCTCATGGGG + Intronic
1166489030 19:43241686-43241708 TCTTTCCAATGAATCTCATGGGG + Intronic
928327707 2:30333335-30333357 CCTATCCACTGAATCCCATGTGG + Intergenic
931976023 2:67645273-67645295 ACTATGGACTGAATCACAGGAGG + Intergenic
936946417 2:117935074-117935096 CCTAAGGAATGAATCTCTTGTGG + Intronic
939743507 2:145939416-145939438 CATTTGGATTGAGTGTCATGGGG + Intergenic
940719368 2:157265024-157265046 CCTTTTGAATTCATCTCATGAGG - Intronic
941435709 2:165468557-165468579 CCTTTGGCCTTATTCCCATGAGG + Intergenic
942366316 2:175231886-175231908 ACTTTGACCTGAATCTCAGGTGG - Intergenic
944089555 2:195890715-195890737 CATAAGGACTGACTCTCATGGGG - Intronic
1170273181 20:14550918-14550940 CATTTGGAATGAAATTCATGAGG - Intronic
1171100507 20:22379411-22379433 CCTTTGGATTTAATGTCATGGGG - Intergenic
1178696280 21:34795435-34795457 CCTTTGGGGTGAATGTGATGAGG + Intronic
1182898222 22:33875973-33875995 TCTTTGGACTGAATCCTATCTGG - Intronic
1183520816 22:38295176-38295198 CCTTGGGACAGAAGCTCAAGGGG + Intronic
949473609 3:4421407-4421429 CCTTGTGACTGAGTGTCATGGGG - Intronic
949699348 3:6738174-6738196 CCTCTGCACTTAAGCTCATGTGG + Intergenic
950515610 3:13463115-13463137 CCCTTGGTCTGAATCTCAAATGG - Intergenic
950728941 3:14939395-14939417 CCTGTGCACAGAATCTCCTGAGG - Intergenic
955883421 3:63572076-63572098 GCTTTGGACTGAAAGTCAAGTGG - Intronic
959969537 3:112393881-112393903 ACGTTGAACTGCATCTCATGAGG - Intergenic
960231194 3:115229509-115229531 CATTTTGATTGAATCTCATTGGG - Intergenic
965468804 3:169064884-169064906 AATTTGGACTGAATATCAGGAGG + Intergenic
968297283 3:197586431-197586453 CCTGTGGACTGTATCTTCTGAGG - Intergenic
969887943 4:10233071-10233093 CCTTCATACTGAATATCATGTGG + Intergenic
971480445 4:27109829-27109851 CCTGGAGACTGAATCTCATCAGG - Intergenic
971768466 4:30865471-30865493 GCTGTTCACTGAATCTCATGTGG + Intronic
972439333 4:39070520-39070542 CCTTTGGACAAAATCCCAAGGGG + Intronic
976246894 4:83013151-83013173 CCATCGGACTGAAGCTGATGGGG + Intergenic
976526065 4:86090349-86090371 ACATTGGAATGAATCTCATGAGG - Intronic
982108905 4:152035163-152035185 CTTTTGGACTGAGTCACATGGGG + Intergenic
982868341 4:160545603-160545625 CCTGTGCACTGAATCTCTTCTGG + Intergenic
985191177 4:187374877-187374899 TCCTTGGACTGTATCACATGTGG - Intergenic
987011681 5:13772495-13772517 CCTCTTGACTGAATCTCAGCAGG - Intronic
989485739 5:41989795-41989817 TCTTTGGTCTGAATCTAAGGTGG - Intergenic
991659052 5:68932100-68932122 CCTTTGAACTGAAGCACCTGGGG + Intergenic
992623253 5:78614181-78614203 TCTTTGCCCTGAATCTGATGTGG + Intronic
993850135 5:92998325-92998347 TCTTTGGACTAACTCCCATGCGG + Intergenic
995711011 5:115035614-115035636 TCTTTGGACTGTGTCTCTTGGGG + Intergenic
1005852592 6:29832914-29832936 CCTTTGCTCTGAATGACATGGGG + Intergenic
1005876187 6:30011437-30011459 CCTTTGCTCTGAATGACATGGGG + Intergenic
1009278072 6:61710656-61710678 CCATTGAGCTGAATCTCAGGAGG - Intronic
1010728247 6:79360040-79360062 CCTTTGGCCTTGAACTCATGGGG + Intergenic
1013722490 6:113047264-113047286 CCTTGGGACTGTAGCTGATGTGG + Intergenic
1014089715 6:117389868-117389890 CCTTTGGACTGAATCTCATGAGG - Intronic
1018503528 6:164439641-164439663 CCTTTGGTCCGTATCACATGTGG + Intergenic
1019370244 7:659406-659428 CCTGTGGGCTGAATCATATGTGG - Intronic
1020169393 7:5833331-5833353 CATAGGGACTCAATCTCATGAGG - Intergenic
1020173062 7:5860013-5860035 CCTGGGTTCTGAATCTCATGGGG + Intergenic
1021230446 7:18081315-18081337 CATTTGGATTGAATCTGATTGGG + Intergenic
1021461876 7:20897635-20897657 ATTTTGGACTGAATGACATGCGG - Intergenic
1022265170 7:28746560-28746582 TCTTTGGACAGAATCTCTTAAGG - Intronic
1022597867 7:31729932-31729954 ACTTTGGAATGAGACTCATGGGG + Intergenic
1024631055 7:51247366-51247388 CTTTTGGACAGGATCTCCTGAGG + Intronic
1027848219 7:83412954-83412976 CCTTTGGGCTGAAATTCTTGGGG - Intronic
1028037362 7:86001946-86001968 CTTTTGAACTGAATCTCTTTAGG + Intergenic
1029085683 7:98009998-98010020 CCTGGGTTCTGAATCTCATGGGG - Intergenic
1032613803 7:133444177-133444199 CCTTTGGACTGAAATTCCTCTGG - Intronic
1040986941 8:53305919-53305941 CTTTTGTAATGAAACTCATGTGG + Intergenic
1044382006 8:91545049-91545071 CCTTTGGACTCAACCACCTGGGG + Intergenic
1045378870 8:101602938-101602960 CCTTTGGCCTGGTCCTCATGGGG + Intronic
1045846725 8:106645666-106645688 CCTTTGGGCTGATTCACCTGGGG + Intronic
1047135297 8:122071176-122071198 CCTTGGGACTGAGTCTGAGGAGG - Intergenic
1048692318 8:136981197-136981219 CCCATGGACTGAATCTGAAGGGG - Intergenic
1055366690 9:75551581-75551603 ACTTTAGACTCAATCTCCTGTGG - Intergenic
1056910354 9:90695130-90695152 CTTTTGGTCTGACTCTCTTGTGG - Intergenic
1059608774 9:115869120-115869142 CTTAAGGACTGATTCTCATGTGG + Intergenic
1186187672 X:7037799-7037821 TCTTTCCAATGAATCTCATGGGG + Intergenic
1187038827 X:15571544-15571566 CCTTTGGCCCCAGTCTCATGAGG - Intronic
1189149363 X:38688393-38688415 TCTTTTGACTTAATCTCATTTGG + Exonic
1190335886 X:49261417-49261439 CCTTTGGTCTGGGCCTCATGGGG + Intronic
1191004560 X:55697271-55697293 CCTTTGGTGTGGAACTCATGAGG + Intergenic
1196940897 X:120774813-120774835 CCTCTGCTCAGAATCTCATGGGG + Intergenic
1198815337 X:140583932-140583954 CCTTTGGACTCAAACAGATGTGG + Intergenic