ID: 1014090758

View in Genome Browser
Species Human (GRCh38)
Location 6:117401258-117401280
Sequence GCATGGAGAATAGACTGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 491
Summary {0: 1, 1: 0, 2: 4, 3: 47, 4: 439}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014090758 Original CRISPR GCATGGAGAATAGACTGGGA GGG (reversed) Intronic
901840529 1:11951225-11951247 GGATGGAGAATGGCCTGGAAGGG - Intronic
903288467 1:22291911-22291933 GCATGGAGAATGGGCTGGAAAGG + Intergenic
903687954 1:25146361-25146383 GCATGGAGAAGAGGCTGAGTTGG - Intergenic
903884634 1:26533921-26533943 CCCTGGAGAACAGACTGGTAGGG - Intronic
904924795 1:34039088-34039110 GCATGCAGAATAGGCTGGTCTGG - Intronic
905416258 1:37806768-37806790 GCATTGATAGTACACTGGGATGG - Intronic
905455675 1:38086342-38086364 GGATGGGGATTAGACTGGGATGG - Intergenic
907883160 1:58570030-58570052 GTGTGGAGAATAGACTGAAAAGG - Intergenic
911608134 1:99931805-99931827 GCCTGGGGATTAGAATGGGAAGG + Intergenic
911848832 1:102788442-102788464 GCATAGAAAATAGACTGGGGAGG - Intergenic
912254710 1:108047041-108047063 GCATGGAGAACAGATTGGAGAGG - Intergenic
915053549 1:153103376-153103398 GCATGGGGTATACACTGGCATGG - Intronic
915332950 1:155124993-155125015 GCATGAGGAAGGGACTGGGAGGG + Intergenic
916934010 1:169609204-169609226 GCATGAGGAATAGCATGGGATGG - Intronic
917291686 1:173477549-173477571 GCAGGGAGAAGAAACAGGGAAGG - Intronic
919922691 1:202175810-202175832 GCCTGGAGTACAGGCTGGGAGGG + Intergenic
919999708 1:202788109-202788131 GAATGGAGAATACACTTGAAAGG - Intronic
920533701 1:206723557-206723579 ACATGAAGACAAGACTGGGAAGG - Intronic
921965499 1:221083978-221084000 GCATGGAAAGTGGACTGGCATGG + Intergenic
922102136 1:222485858-222485880 GGATGGGGAATGGGCTGGGATGG - Intergenic
922462009 1:225820633-225820655 GCATGTGGAATGGAATGGGATGG - Intronic
922616255 1:226962923-226962945 GCATGGAGTCCAGGCTGGGAGGG - Intronic
922779367 1:228239816-228239838 CCATGGAGACTAGATTAGGATGG + Intronic
924156018 1:241177394-241177416 GCCTGGAGCGTAGACAGGGATGG + Intronic
924552156 1:245089036-245089058 GCATGGAAAATAGATTTGAAAGG + Intronic
1063457931 10:6197712-6197734 TCATGTTGAGTAGACTGGGAAGG + Intronic
1063480137 10:6368234-6368256 GCATGCAGTTGAGACTGGGAGGG + Intergenic
1063545833 10:6980658-6980680 GCATGGAGAATAGACTTTCCAGG + Intergenic
1063766784 10:9151005-9151027 ACATGGAGCACAGACTGTGAGGG - Intergenic
1064685693 10:17858934-17858956 GCATAGACAATAGAATGAGAAGG - Intronic
1064753210 10:18553148-18553170 GAATGGAGAATGGAATGGAAGGG - Intronic
1064753264 10:18553455-18553477 GAATGGAGAATGAACTGGAATGG + Intronic
1064753267 10:18553472-18553494 GAATGGAGAATGGAATGGAATGG + Intronic
1064753310 10:18553756-18553778 GAATGGAGAATGGATTGGAATGG + Intronic
1064753344 10:18554058-18554080 GAATGGAGAATAGAATGCAATGG + Intronic
1064753483 10:18555031-18555053 GAATGGAGAATGGAATGGAATGG + Intronic
1064753527 10:18555351-18555373 GTATGGAGAATGGAATGGAATGG + Intronic
1064753548 10:18555502-18555524 GTATGGAGAATGGAATGGAAGGG + Intronic
1064753589 10:18555778-18555800 GAATGGAGAATGGAATGGAAAGG + Intronic
1064753601 10:18555849-18555871 GAATGGAGAATGGAATGGAATGG + Intronic
1064753603 10:18555866-18555888 GAATGGAGAATGAACTGGAATGG + Intronic
1064753605 10:18555883-18555905 GAATGGAGAATAGAATGGAATGG + Intronic
1064753608 10:18555900-18555922 GAATGGAGAATGGAATGGAATGG + Intronic
1064753642 10:18556134-18556156 GAATGGAGAATGGAATGGAATGG + Intronic
1064753645 10:18556151-18556173 GAATGGAGAATGGAATGGAATGG + Intronic
1064753730 10:18556715-18556737 GAATGGAGAATGGATTGGAATGG + Intronic
1064753833 10:18557408-18557430 GAATGGAGAATGGAATGGAATGG + Intronic
1064753846 10:18557498-18557520 GAATGGAGAATAGAATGGAAGGG + Intronic
1064753870 10:18557655-18557677 GAATGGAGAATGGAATGGAAAGG + Intronic
1064753880 10:18557711-18557733 GAATGGAGAATGGAATGGAATGG + Intronic
1064753882 10:18557728-18557750 GAATGGAGAATGAACTGGAATGG + Intronic
1064753884 10:18557745-18557767 GAATGGAGAATAGAATGGAATGG + Intronic
1064753923 10:18558030-18558052 GAATGGAGAATGGAATGGAATGG + Intronic
1064753939 10:18558160-18558182 GAATGGAGAATGGAATGGAATGG + Intronic
1064753965 10:18558311-18558333 GAATGGAGAACAGAATGGAATGG + Intronic
1064754013 10:18558629-18558651 GAATGGAGAATGGAATGGAAGGG + Intronic
1064754076 10:18559059-18559081 GTATGGAGAATGGAATGGAATGG + Intronic
1064754090 10:18559166-18559188 GAATGGAGAATAGAATGGAATGG + Intronic
1064754115 10:18559330-18559352 GAATGGAGAATTGATTGGAATGG + Intronic
1064754136 10:18559442-18559464 GAATGGAGAATGGATTGGAATGG + Intronic
1064754141 10:18559476-18559498 GAATGGAGAATGGAATGGAATGG + Intronic
1064754202 10:18559906-18559928 GAATGGAGAATGGATTGGAATGG + Intronic
1064754206 10:18559928-18559950 GAATGGAGAATGGACTGGAATGG + Intronic
1064754236 10:18560137-18560159 GAATGGATAATAGAATGGAATGG + Intronic
1064754243 10:18560171-18560193 GAATGGAGAATGAACTGGAATGG + Intronic
1064754282 10:18560472-18560494 GAATGGAGAATGGAATGGAATGG + Intronic
1064754341 10:18560871-18560893 GAATGGAGAATGGAATGGAATGG + Intronic
1064754347 10:18560900-18560922 GTATGGAGAATGGAATGGAATGG + Intronic
1064754349 10:18560917-18560939 GAATGGAGCATAGAATGGAATGG + Intronic
1064754364 10:18561017-18561039 GAATGGAGAATAGAATGGAATGG + Intronic
1064754374 10:18561080-18561102 GAATGGAGAATGGAATGGAATGG + Intronic
1064754379 10:18561138-18561160 GAATGTAGAATAGAATGGAATGG + Intronic
1064754403 10:18561299-18561321 GAATGGAGAATGGAATGGAATGG + Intronic
1064754410 10:18561357-18561379 GAATGGAGAATACAATGGAATGG + Intronic
1064754424 10:18561442-18561464 GAATGGAGAATGGAATGGAATGG + Intronic
1064754429 10:18561500-18561522 GAATGTAGAATAGAATGGAATGG + Intronic
1064754453 10:18561661-18561683 GAATGGAGAATGGAATGGAATGG + Intronic
1064754467 10:18561782-18561804 GAATGGAGAATACAATGGAATGG + Intronic
1064754476 10:18561865-18561887 GAATGGAGAATGGAATGGAATGG + Intronic
1064754511 10:18562124-18562146 GAATGGAGAATAGAATGGAATGG + Intronic
1064754599 10:18562738-18562760 GAATGGAGAATGAACTGGAATGG + Intronic
1064754644 10:18563045-18563067 GAATGGAGAATTGATTGGAATGG + Intronic
1064754686 10:18563359-18563381 GAATGGAGAATGGAATGGAACGG + Intronic
1064754717 10:18563576-18563598 GAATGGAGAATGGAATGGAAGGG - Intronic
1064754738 10:18563732-18563754 GTATGGAGAATGGAATGGAATGG - Intronic
1064754741 10:18563749-18563771 GAATGGAGAATGGAATGGTATGG - Intronic
1064754773 10:18563977-18563999 GAATGGAGAATGGAATGGAATGG - Intronic
1064754994 10:18565556-18565578 GAATGGAGAATGGATTGGAATGG - Intronic
1064755037 10:18565841-18565863 GAATGGAGAATAGAATGGAATGG - Intronic
1064755086 10:18566152-18566174 GAATGGAGAATGGAATGGAATGG - Intronic
1064755102 10:18566266-18566288 GGATGGAGAATGGAATGGAATGG - Intronic
1064755131 10:18566473-18566495 GAATGGAGAATGGAATGGAATGG - Intronic
1064755134 10:18566490-18566512 GAATGGAGAATGGAATGGAATGG - Intronic
1064755158 10:18566644-18566666 GAATGGAGAATAGAATGGAATGG - Intronic
1064755197 10:18566915-18566937 GAATGGAGAATGGAGTGGAATGG - Intronic
1064755208 10:18566998-18567020 GAATGGAGAGTAGAATGGAATGG - Intronic
1064755237 10:18567212-18567234 GAATGGAGAATAGAAGGGAATGG - Intronic
1064755255 10:18567336-18567358 GAATGGAGAATAGAATGGAATGG - Intronic
1064755271 10:18567453-18567475 GTATGGAGAATGGAATGGAATGG - Intronic
1064755277 10:18567482-18567504 GAATGGAGAATGGAATGGAATGG - Intronic
1064755348 10:18567976-18567998 GAATGGAGAATGGAATGGAATGG - Intronic
1064755355 10:18568032-18568054 GAATGGAGAATAGAATGCAATGG - Intronic
1064755387 10:18568287-18568309 GAATGGAGAATGAACTGGAATGG - Intronic
1064755420 10:18568518-18568540 GAATGGAGAATGGATTGGAATGG - Intronic
1064755481 10:18568943-18568965 GAATGGAGAATGGATTGGAATGG - Intronic
1064755517 10:18569173-18569195 GAATGGAGAATGGAATGGAATGG - Intronic
1064755581 10:18569562-18569584 GAATGGACAATAGAATGGAAGGG - Intronic
1064755617 10:18569824-18569846 GAATGGAGAATGGAATGGTATGG - Intronic
1064755669 10:18570161-18570183 GAATGGAGAATGGAGTGGAATGG - Intronic
1064755678 10:18570220-18570242 GAATGGAGAATAGAATGCAATGG - Intronic
1064755708 10:18570431-18570453 GAATGGAGAATGGAATGGAATGG - Intronic
1064755721 10:18570504-18570526 GAATGGAGAATGGAATGGAAAGG - Intronic
1064755739 10:18570606-18570628 GAATGGAGAATGGAATGGAATGG - Intronic
1064755742 10:18570623-18570645 GTATGGAGAATGGAATGGAATGG - Intronic
1064755748 10:18570657-18570679 GAATGGAGAATAGAATGGAATGG - Intronic
1064755765 10:18570776-18570798 GTATGGAGAATGGAATGGAAGGG - Intronic
1064755782 10:18570888-18570910 GAATGGAGAATGGAATGGAATGG - Intronic
1064755807 10:18571087-18571109 GAATGGAGAATGGAATGGAATGG - Intronic
1064755861 10:18571457-18571479 GAATGGAGAATGGATTGGAATGG - Intronic
1064755913 10:18571769-18571791 GTATGGAGAATGGAATGGAATGG - Intronic
1064755926 10:18571864-18571886 GAATGGAGAATAGAATGGAATGG - Intronic
1064755936 10:18571922-18571944 GAATGGAGAATGGAATGGAAAGG - Intronic
1064756000 10:18572321-18572343 GAATGGAGAATGGAATGGAATGG - Intronic
1064756043 10:18572545-18572567 GAATGGAGAATGGAATGGAATGG - Intronic
1064756054 10:18572626-18572648 GAATGGAGAATAGAATAGAATGG - Intronic
1064756107 10:18572945-18572967 GAATGGAGAATGGAATGGAATGG - Intronic
1064756155 10:18573285-18573307 GAATGGAGAATGGAATGGGATGG - Intronic
1064756159 10:18573302-18573324 GAATGGAGAATGGAATGGAATGG - Intronic
1064756182 10:18573425-18573447 GAATGGAGAATGGAATGGAAAGG - Intronic
1065846889 10:29751913-29751935 GCATGGAGAATAGTGGGGCATGG + Intergenic
1067359255 10:45562143-45562165 ACATAAAGAATAGACTGAGATGG + Intronic
1068066650 10:52140467-52140489 GCATGGGGAGTGGAGTGGGATGG - Intronic
1069222401 10:65901070-65901092 GCATGGAGAATACACACAGATGG + Intergenic
1069824278 10:71245753-71245775 GCCTACAGAATAGACAGGGAGGG - Intronic
1070669465 10:78367950-78367972 CCAAGGAGAATAGGCTGGGCTGG - Intergenic
1071099987 10:82024834-82024856 GCTTTGAGAAGATACTGGGAGGG - Intronic
1071319953 10:84444619-84444641 GCAGGGAGAAGAGAGTGTGAAGG + Intronic
1071412189 10:85407741-85407763 GCATGCAGAAAGGACAGGGAAGG - Intergenic
1072466898 10:95672082-95672104 GGACAGAGAATAGACTGGAAAGG - Intronic
1073018402 10:100420449-100420471 GCATGGTAAATAGACTGTGGGGG + Intergenic
1074020774 10:109580316-109580338 GCATGGAGAAAAGATTGGGGGGG - Intergenic
1075675636 10:124293925-124293947 GCATGGAGGGAAGACTGGGCAGG + Intergenic
1076085494 10:127626525-127626547 GGATGAAGAATATGCTGGGATGG - Intergenic
1076154469 10:128193043-128193065 GCAGGGAGAATAGGATGGGAAGG - Intergenic
1077345221 11:2045216-2045238 GCATGGAGAATAGTGTAGGAAGG - Intergenic
1077609319 11:3634780-3634802 GGCTGGAGAATAGGCTGGGCAGG + Intergenic
1077729040 11:4708735-4708757 GCATTGAGAATAGATTGGCTGGG - Intronic
1077819719 11:5725193-5725215 GCATGGAGAATATCCAGGAAAGG + Intronic
1078197879 11:9151684-9151706 GCAGGGAGACTAGCCTGGAAAGG + Intronic
1078484378 11:11707985-11708007 GGATGGAAAACAGCCTGGGAGGG + Intergenic
1079694359 11:23460578-23460600 GAATGGAGAGTAGAATGGAATGG + Intergenic
1079904603 11:26230048-26230070 GAAATGAGAATAGACTGGCATGG + Intergenic
1080299259 11:30766506-30766528 GCATGGAGAGAAGACTGGAAAGG - Intergenic
1081540373 11:44030402-44030424 GCTTGGAGAATAGGCGGGGAGGG - Intergenic
1081709583 11:45208238-45208260 GCTTGGAGAACTGACCGGGACGG + Intronic
1081729252 11:45357432-45357454 GTGTGGTGAATGGACTGGGATGG - Intergenic
1081759149 11:45564904-45564926 GCATTGAGAATAGACTGCAGAGG + Intergenic
1081814196 11:45929492-45929514 GCATGGACAAGAGACAGGGTTGG + Intronic
1082071254 11:47941554-47941576 GCCTGGAGGATAAAATGGGACGG - Intergenic
1082286408 11:50322530-50322552 GTACTGAGAGTAGACTGGGAGGG - Intergenic
1082724866 11:56722271-56722293 GGATGGAGAATGGATTTGGAGGG + Intergenic
1084407521 11:68984281-68984303 GTATGGAGAATAGACTGATAAGG + Intergenic
1084426376 11:69086617-69086639 CCATGGAGAACAGCCTGGGTGGG - Intronic
1084933250 11:72573567-72573589 GCAGGGAGAAAAGAGTGGGGTGG - Intergenic
1086280343 11:85178858-85178880 GCATGAAGAATAGATTGAGAGGG + Intronic
1087411702 11:97798757-97798779 TCATGGTGAATAGGCTGAGAAGG - Intergenic
1088810708 11:113389895-113389917 GTATGGAGAATGCATTGGGAGGG + Intronic
1089091749 11:115883861-115883883 GCATGAAGAATGGACTGGACTGG - Intergenic
1089750778 11:120649626-120649648 GCCTGGAGAAGAGGGTGGGATGG - Intronic
1090651546 11:128810832-128810854 GCATGGAGGATGGATGGGGAGGG - Exonic
1091535300 12:1401954-1401976 ACATGGAAAACAGACTGAGAAGG + Intronic
1092080612 12:5713059-5713081 GTGTGGAGAATGGACTGGAAGGG + Intronic
1092970982 12:13694627-13694649 TCTTGCACAATAGACTGGGAAGG - Intronic
1093051482 12:14509775-14509797 CAAGGGAGAATAGACTGGGTGGG - Intronic
1093759729 12:22894999-22895021 GAATGGAGAATAGAGTAGGGTGG + Intergenic
1093793241 12:23279767-23279789 ACATGGATAATACGCTGGGAAGG - Intergenic
1093821227 12:23620348-23620370 ATATGGAGAATAGATTGGGAGGG + Intronic
1096740032 12:53686360-53686382 CCATGAAGAACAGAATGGGAAGG + Intergenic
1097894204 12:64808128-64808150 GCTTGGAGCACAGAGTGGGAAGG - Intronic
1099163314 12:79272760-79272782 GCCTTGAGAATAGAAAGGGAAGG + Intronic
1100032707 12:90212615-90212637 CCATGGAGATTAGAGTAGGAAGG - Intergenic
1100918154 12:99451496-99451518 GCATGAAGAAATGGCTGGGAAGG + Intronic
1101196340 12:102386654-102386676 GCATATAGATTAGACTGGGGTGG + Intergenic
1102765825 12:115432064-115432086 GCATGGACAAAGGACAGGGAAGG - Intergenic
1102842570 12:116141742-116141764 ACATGGAGAAGACACTGGGTTGG - Intronic
1103742261 12:123098809-123098831 GGATGGAGATTGGGCTGGGAAGG - Intronic
1104091603 12:125522231-125522253 GCATGGATCACAGACTGTGATGG - Intronic
1106789676 13:33141975-33141997 ACATGGAGAATACACATGGATGG + Intronic
1108294961 13:49006665-49006687 GAAGGGAGAAGAGAATGGGAGGG - Intronic
1108444525 13:50493952-50493974 GGGTGGAGAACAGATTGGGAAGG + Intronic
1111956222 13:94761434-94761456 ACAGGGAGAAGAGAATGGGATGG - Intergenic
1112578642 13:100659632-100659654 GCAAGGAGGAGAGCCTGGGAGGG - Intronic
1114231205 14:20784690-20784712 ACAAGTGGAATAGACTGGGATGG + Intergenic
1114728436 14:24964482-24964504 CCATGAAGAAGAGACAGGGAGGG - Intronic
1114831078 14:26142364-26142386 GACTGGAGAAGATACTGGGAAGG - Intergenic
1115017440 14:28633977-28633999 GCCTTGAGAATAGACAGAGATGG - Intergenic
1115524658 14:34267692-34267714 GGATGGAGAATGGACTTGGAAGG - Intronic
1115676268 14:35678550-35678572 TTATGGAGAATGGATTGGGAGGG - Intronic
1121154960 14:91674649-91674671 GCATGGAGTGTCGAGTGGGAAGG - Intronic
1121413038 14:93760938-93760960 GAGTGGAGAATAGATTGGGGTGG - Intronic
1121476486 14:94211691-94211713 GTATGGAGAATAGATTGGAGTGG + Intronic
1121554921 14:94829199-94829221 TCCTGGAGAACAGACTGGAAGGG - Intergenic
1121563587 14:94892601-94892623 GGATGGAGAGTAGGCTGGGCTGG + Intergenic
1121805832 14:96821625-96821647 GCATCAAGAATAGACTGTAAGGG - Intronic
1122245182 14:100397611-100397633 GCATAAAGAACAGCCTGGGAGGG + Intronic
1123800135 15:23810691-23810713 GCATAGAGATAAGTCTGGGAGGG + Intergenic
1125255531 15:37758784-37758806 GCATGATGGATAGACTGGAAAGG + Intergenic
1125794031 15:42391435-42391457 TCATGCTGAATAGACTGGGAGGG - Intronic
1127509452 15:59625628-59625650 GCATTGAGAACAGACTGGCTTGG + Intronic
1130016729 15:80193215-80193237 GGATGGAGAATAGATCTGGAGGG - Intergenic
1131258215 15:90875359-90875381 GCATGGAGAAAGGATTGGGGGGG + Intronic
1131465553 15:92652542-92652564 GCAGGGAGAATTGGCAGGGAGGG + Intronic
1131669541 15:94605446-94605468 GCATGTAGAAGAGACAGAGAGGG - Intergenic
1131807500 15:96137763-96137785 GCCTGGAGAATGGCATGGGAGGG + Intergenic
1131818902 15:96251574-96251596 GTATGGAGAATAGAATGGTAAGG + Intergenic
1132817548 16:1839699-1839721 GCAAGGAAATGAGACTGGGATGG - Exonic
1132985971 16:2767831-2767853 GGAGGGAGAAGAGACTGTGAAGG - Exonic
1135533619 16:23275678-23275700 ATATGGAGAATAGACTGGAGGGG + Intergenic
1135927864 16:26711145-26711167 GTGTGGAGAATACACTGGGCAGG + Intergenic
1136078991 16:27839147-27839169 TCATGGAGACTAGAAAGGGAGGG + Intronic
1136711433 16:32240335-32240357 GCATGGAGAAGAGACAGAGGTGG - Intergenic
1136756477 16:32689070-32689092 GCATGGAGAAGAGACAGAGGTGG + Intergenic
1136811634 16:33181303-33181325 GCATGGAGAAGAGACAGAGGTGG - Intergenic
1136818110 16:33291383-33291405 GCATGGAGAAGAGACAGAGGTGG - Intronic
1136824674 16:33347912-33347934 GCATGGAGAAGAGACAGAGGTGG - Intergenic
1136829740 16:33446683-33446705 GCATGGAGAAGAGACAGAGGTGG - Intergenic
1137500213 16:49005212-49005234 ACATGGAGAAAACTCTGGGAAGG - Intergenic
1138545202 16:57714821-57714843 GCAAGTAGTATATACTGGGAAGG - Intronic
1139340225 16:66263573-66263595 GCATGGAGAATGATCTGGAAGGG + Intergenic
1139707445 16:68751095-68751117 GGATGGAGAAAAGACTGGCTTGG - Intronic
1139836109 16:69839964-69839986 GCATGGAAAAAAGAGTGGGAAGG - Intronic
1140490501 16:75331533-75331555 GGGTGGGGAATTGACTGGGAAGG - Intronic
1141474192 16:84261137-84261159 GCTTGGAAAATAGAATTGGAAGG - Intergenic
1141482904 16:84318599-84318621 GGATGGAGAATTGAAGGGGAGGG + Intronic
1141713379 16:85713230-85713252 GCAGGGAGAATACAATGTGAAGG - Intronic
1141795609 16:86271584-86271606 GTATGGAGAGTTGACTGAGATGG - Intergenic
1202990212 16_KI270728v1_random:4272-4294 GCATGGAGAAGAGACAGAGGTGG - Intergenic
1203058621 16_KI270728v1_random:949424-949446 GCATGGAGAAGAGACAGAGGTGG + Intergenic
1144214202 17:13040363-13040385 AAATGCAGAATAGACTTGGATGG + Intergenic
1144323929 17:14159088-14159110 GCTTGGACAATAGATTGGTATGG - Intronic
1145796590 17:27659027-27659049 GCATGGAGAAAGGACTGCCAGGG + Intergenic
1145811025 17:27764304-27764326 GCATGGAGAAAGGACTGCCAGGG + Intronic
1146513294 17:33469233-33469255 CCATGGAGCACAGACTGGGGTGG + Intronic
1146790256 17:35746993-35747015 GTATGGGGAAGAGACAGGGATGG - Intronic
1147644200 17:42024092-42024114 GGATGGGGAGTAGGCTGGGAGGG - Exonic
1148595266 17:48849408-48849430 GCATGGAGATCAGAATTGGATGG + Intronic
1148875074 17:50682307-50682329 ACAAGCAGAATAGACTGGCAGGG - Intronic
1150372906 17:64656822-64656844 GTATGGAGGATGGACTGGAATGG - Intronic
1153268469 18:3295561-3295583 GCAGGGAGCAAAGTCTGGGAGGG - Intergenic
1153749236 18:8211830-8211852 GAAGGGTGAATGGACTGGGAAGG + Intronic
1154960691 18:21305613-21305635 GCATGAAGAATAGACTGCAGGGG - Intronic
1155015532 18:21835292-21835314 GTATAGAGAATAGAGTGGAAAGG + Intronic
1155088669 18:22484146-22484168 GTGTTGAGAATAGACTGGGGTGG - Intergenic
1156800144 18:41100950-41100972 GAATGCAGAATAGATTGGAAAGG + Intergenic
1157225869 18:45864065-45864087 GCATAGAGGATAGGCTGAGAAGG - Intronic
1157241826 18:46017527-46017549 ACATGGAGAATAGGATGAGAAGG - Intronic
1157281178 18:46347317-46347339 GGATGGAGACTGGAATGGGAGGG - Intronic
1157872256 18:51241374-51241396 GCATGGAGTAAAGACTGTGAGGG + Intergenic
1158377569 18:56888513-56888535 GCATGGAGAAGAAAATCGGAAGG - Intronic
1158775227 18:60570531-60570553 GCATGGAAAATAGCCTGGACTGG + Intergenic
1159139777 18:64379619-64379641 TCATGTTGAATAGACTGAGAAGG + Intergenic
1159294741 18:66470370-66470392 GCATGGAGAATAAAAGGAGATGG - Intergenic
1160081086 18:75727724-75727746 GCATGTAGCATAGACAGGGAGGG - Intergenic
1160299876 18:77669775-77669797 GCATGGAGCAGAGACTGGTGTGG + Intergenic
1160299895 18:77669860-77669882 GCATGGAGCAGAGACTGGTGTGG + Intergenic
1160299901 18:77669894-77669916 GCATGGAGCAGAGACTGGTGTGG + Intergenic
1160299907 18:77669928-77669950 GCATGGAGCAGAGACTGGCATGG + Intergenic
1160299911 18:77669945-77669967 GCATGGGGCAGAGACTGGCATGG + Intergenic
1160299959 18:77670166-77670188 GCATGGAGCAGAGACTGGCGTGG + Intergenic
1160299987 18:77670285-77670307 GCATGGGGCAGAGACTGGCATGG + Intergenic
1160300009 18:77670387-77670409 GCATGGAGCAGAGACTGGCGTGG + Intergenic
1160300037 18:77670506-77670528 GCATGGGGCAGAGACTGGCATGG + Intergenic
1160300061 18:77670608-77670630 GCATGGGGCAGAGACTGGCATGG + Intergenic
1160300075 18:77670676-77670698 GCATGGAGCAGAGACTGGTGTGG + Intergenic
1160300081 18:77670710-77670732 GCATGGAGCAGAGACTGGCGTGG + Intergenic
1160300085 18:77670727-77670749 GCGTGGGGCATAGACTGGCATGG + Intergenic
1160300087 18:77670744-77670766 GCATGGAGCAGAGACTGGCGTGG + Intergenic
1160300107 18:77670829-77670851 GCATGGGGCAGAGACTGGCATGG + Intergenic
1160300111 18:77670846-77670868 GCATGGGGCAGAGACTGGCATGG + Intergenic
1160300119 18:77670880-77670902 GCGTGGGGCATAGACTGGCATGG + Intergenic
1160300127 18:77670931-77670953 GCATGGAGCAGAGACTGGTGTGG + Intergenic
1160300133 18:77670965-77670987 GCATGGAGCAGAGACTGGTGTGG + Intergenic
1160300139 18:77670999-77671021 GCATGGAGCAGAGACTGGTGTGG + Intergenic
1160300149 18:77671050-77671072 GCATGGAGCAGAGACTGGCGTGG + Intergenic
1160300169 18:77671135-77671157 GCATGGGGCAGAGACTGGCATGG + Intergenic
1160300171 18:77671152-77671174 GCATGGAGCAGAGACTGGCATGG + Intergenic
1160300175 18:77671169-77671191 GCATGGGGCATAGACTGGCGTGG + Intergenic
1160300181 18:77671203-77671225 GCATGGAGCAGAGACTGGTGTGG + Intergenic
1160433580 18:78829349-78829371 GCATGGAGCCTAGCCTGTGACGG - Intergenic
1160880455 19:1317334-1317356 GCCTGGGGGATAGAGTGGGAGGG + Intergenic
1161426802 19:4208131-4208153 GCATTTAGAGTAGTCTGGGAGGG + Intronic
1161664167 19:5564966-5564988 GCGGGGAGAACAGACTGTGATGG - Intergenic
1163581905 19:18144300-18144322 GCATAGAGAATAATTTGGGAAGG + Intronic
1163727859 19:18932695-18932717 GCAGCGAGAAGAGACAGGGATGG + Intronic
1166752813 19:45172774-45172796 GGATGGAGATTGGCCTGGGAAGG - Intronic
1166934152 19:46321001-46321023 TCTTGAAGGATAGACTGGGAGGG - Intronic
1167220636 19:48196244-48196266 GCATGGAGAATGGAGATGGAGGG + Intronic
1167746002 19:51352195-51352217 GCTTTGAGAATGGACTGGAATGG - Intronic
1168374854 19:55868225-55868247 GCATGTAGAATAGACTTGGTGGG + Intronic
926103625 2:10136797-10136819 GCATGGAGACTAGACTCCCAGGG - Intergenic
928813103 2:35253631-35253653 GGAAGGAGAATGGAGTGGGAAGG - Intergenic
929005896 2:37392388-37392410 GCATGAAGAATAGACTGAAGGGG - Intergenic
929508795 2:42550625-42550647 GCTGGGACAAGAGACTGGGAAGG + Intronic
931089653 2:58871777-58871799 GCATGGAGAATAGTATTGGCTGG - Intergenic
931287749 2:60846940-60846962 GGATTGAGAATAAACTGTGAAGG - Intergenic
934158138 2:89222340-89222362 GGAAGGAGAATAGGGTGGGAGGG - Intergenic
934209125 2:89960084-89960106 GGAAGGAGAATAGGGTGGGAGGG + Intergenic
934539825 2:95164693-95164715 GGATGGTTAACAGACTGGGAAGG + Intronic
935084974 2:99836073-99836095 GTATGGAGAACAGAATAGGAAGG + Intronic
937640777 2:124208644-124208666 GAATGGACAATAAACTGGCATGG - Intronic
937889070 2:126922056-126922078 GCTTGGGGTATTGACTGGGAAGG - Intergenic
938736013 2:134187277-134187299 GCATGGAGAATTGTCTGTAAGGG + Intronic
938990051 2:136618558-136618580 GCATGGAGAAAATACTGGAGAGG - Intergenic
940062876 2:149592095-149592117 GCACAGAGAATAGATTGGAAGGG + Intergenic
941635196 2:167928394-167928416 GCAAGAAGAATTGAGTGGGATGG + Intergenic
941897207 2:170641176-170641198 AAATGGTGAATAAACTGGGAGGG + Intronic
942378824 2:175365522-175365544 GCATGTAGGATAGGCTGGTATGG + Intergenic
942402934 2:175622539-175622561 GCATGCAGGACAAACTGGGAGGG - Intergenic
942543491 2:177038682-177038704 GGATAGATAATAGACTGGCAAGG + Intergenic
943728480 2:191276652-191276674 CCAGGGAGGATGGACTGGGAAGG + Intronic
944654611 2:201865129-201865151 GCATTGAGAATACACAGGCATGG - Intronic
945466548 2:210176011-210176033 GTGGGGAGAATTGACTGGGATGG + Intergenic
945665603 2:212737553-212737575 GCGTAGAGAATAGGCTAGGAGGG - Intergenic
947671663 2:231940813-231940835 GCAGGAAGAATAGAGTGGGTGGG + Intergenic
947948964 2:234131267-234131289 GTGTGGAGAATAGATTGTGAGGG + Intergenic
948342554 2:237266451-237266473 GCATGTAGAGTAGGCTGGGGAGG - Intergenic
948627946 2:239280710-239280732 GCATGGGGACAAGACTTGGATGG - Intronic
1169160073 20:3370135-3370157 GCATGTAGAATATAAGGGGATGG - Intronic
1172391497 20:34568266-34568288 GGGAGGAGAATAGGCTGGGAAGG + Intronic
1172688110 20:36772584-36772606 GTCTGAAGAATAGACTGGGCCGG - Intronic
1173317071 20:41954695-41954717 GCAGGGAGATAAGGCTGGGATGG - Intergenic
1174210712 20:48875883-48875905 GTGTGGAGAAGAGACTGGGAAGG + Intergenic
1174402400 20:50283054-50283076 GTGTGGAGAACAGACTGTGAGGG - Intergenic
1174553657 20:51378957-51378979 GCGTGGAGAATGGGCTGGGGAGG + Intergenic
1174718604 20:52786627-52786649 GCATGGAGAACGAATTGGGAAGG + Intergenic
1174729573 20:52902702-52902724 GCATGGAGAATGATCAGGGAAGG - Intergenic
1175113269 20:56663972-56663994 GGAGGAAGAGTAGACTGGGATGG + Intergenic
1178440899 21:32597531-32597553 GCCTGGAGGATGGGCTGGGAGGG - Intronic
1178702559 21:34845698-34845720 GGGTGGGGAAGAGACTGGGAAGG - Intronic
1179095785 21:38313544-38313566 GTGTGGAGAATAGATTGGGAAGG - Intergenic
1182581936 22:31319110-31319132 GCATAGAAAAAAGACTGGAAGGG - Intergenic
1183747632 22:39700717-39700739 GCATGGAGCATTGTGTGGGAGGG + Intergenic
1183931274 22:41237493-41237515 GCAGGGAGAAGAGGCTGGGCAGG + Exonic
1184257875 22:43297289-43297311 CCATGGAGAAGGGATTGGGAGGG - Intronic
1184440909 22:44514178-44514200 ACATGGAGCATAGACCGAGAAGG - Intergenic
1185196477 22:49473570-49473592 CCAGGGAGAAAAGCCTGGGAGGG + Intronic
1185225717 22:49650922-49650944 GCATGAAGAATCCAGTGGGAAGG + Intronic
949120249 3:375376-375398 GCATTGAGAATCCAGTGGGAGGG + Intronic
950290487 3:11780067-11780089 CTATGGAGAATAGACTAGAAAGG - Intergenic
951380558 3:21979150-21979172 GCCTGTAGAATAGTCTGGGCTGG + Intronic
951976223 3:28512584-28512606 TCATGGAGAATAGAATGATAAGG - Intronic
952559703 3:34577064-34577086 GCATGAAGAATAGATTTTGAAGG + Intergenic
954446465 3:50549547-50549569 GCAGTGAGAAAAGCCTGGGAGGG + Intergenic
954709743 3:52499561-52499583 GCATGGAGAATACAGTCGCAGGG - Intronic
955048053 3:55378345-55378367 ACATGGAAAATAGAGTGAGAAGG + Intergenic
956688155 3:71851313-71851335 GCATAGAGAAGAGAATGGAAAGG + Intergenic
959121673 3:102240381-102240403 GTATGGAGAATGGACTGGAGTGG - Intronic
959213228 3:103415697-103415719 GCCTGGAAAAAAGACAGGGAAGG + Intergenic
959367911 3:105487211-105487233 GATGGGAGAATAGAATGGGACGG - Intronic
961580277 3:127875209-127875231 CCAAGGAGAAAAGCCTGGGATGG - Intergenic
963850671 3:150207488-150207510 GAATGGGGAAGAGGCTGGGAAGG - Intergenic
964517634 3:157530167-157530189 ACATGGAGAATGGATTGGAAGGG + Intronic
965862901 3:173168718-173168740 GCAGGGGGAATAGACTGTGATGG + Intergenic
965936868 3:174125024-174125046 GCATGGAGAATGGCATGAGATGG + Intronic
965960650 3:174424985-174425007 TCATGGAGAAAATTCTGGGAGGG - Intergenic
968223456 3:196956602-196956624 ACATGGAAGATAGACTGAGAAGG - Intronic
968842400 4:3017056-3017078 CCGTGGAGAACAGACTGTGAGGG - Intronic
969148054 4:5141590-5141612 ATGTGGAGAATAGCCTGGGAGGG + Intronic
969466586 4:7360874-7360896 GCATGAAGAAGGGACTGGGCGGG - Intronic
970189490 4:13499572-13499594 ACATGGAGAATAACCTGGGAAGG + Intergenic
972419099 4:38869425-38869447 GAATGGAGAAAAGACTGGTGAGG + Intronic
972652076 4:41027876-41027898 GCATGATGAATAGACGTGGAGGG - Intronic
974000740 4:56508285-56508307 GAATGGAGAAGAGGCAGGGATGG + Intronic
974097071 4:57375145-57375167 GGTTGGAGAATAGACTAGAAAGG + Intergenic
975207916 4:71665441-71665463 GCGTGGAGAACAGATTGGAATGG - Intergenic
976112745 4:81693548-81693570 GGATGGAGGTTAAACTGGGATGG - Intronic
977096865 4:92757223-92757245 GCATGGAGAATACATTGTGGAGG + Intronic
979257655 4:118621717-118621739 GGATGGGGAATGGGCTGGGATGG + Intergenic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
979330692 4:119418845-119418867 GGATGGGGAATGGGCTGGGATGG - Intergenic
979542627 4:121903381-121903403 ACATGCAGAATTGACTGGGTGGG - Intronic
980155826 4:129103776-129103798 GCAGGGGGAATAGAATGAGAAGG - Intronic
981611803 4:146600935-146600957 GCAGGGAGAACACACAGGGAAGG + Intergenic
982165631 4:152611489-152611511 GGATGGAGGAGAGTCTGGGATGG - Intergenic
982271261 4:153591549-153591571 GGATGGACAGTAGACAGGGAGGG - Intronic
983475625 4:168208541-168208563 ACATGGAGAATTGTCAGGGAGGG - Intergenic
984237891 4:177183056-177183078 GAATGGAGAAAAGATTGGAATGG - Intergenic
984530858 4:180914545-180914567 GCAGGTAGAATAGCCAGGGAAGG - Intergenic
986965698 5:13267992-13268014 GTATGGAGAATAAACTGATATGG - Intergenic
987059015 5:14224535-14224557 GCATGGAGACTAGCTTGGGAAGG + Intronic
988167220 5:27609338-27609360 GAATTGAGAATAGAATGAGATGG + Intergenic
989548087 5:42697820-42697842 GCATGGAGAATAGACTGGAGGGG + Intronic
990018105 5:51091182-51091204 GCCTGGAGACTAGACTATGAAGG + Intergenic
991586313 5:68205759-68205781 GCAGGAAGGATAGGCTGGGAGGG - Intergenic
991978992 5:72212138-72212160 ACATGGAGAATAAGCTAGGAGGG - Intergenic
993977407 5:94499276-94499298 GCATGGAGAGTTTACTTGGAAGG - Intronic
996995137 5:129686657-129686679 TCAAGGAGCATAGAGTGGGAAGG + Intronic
998378563 5:141708009-141708031 GTGTGGAGAATAGACTGGGGTGG + Intergenic
998394706 5:141811382-141811404 GCATGGAGAAGAGGCTGGGATGG - Intergenic
998948851 5:147371235-147371257 GCATGGGGAATAGAATGGAGTGG - Intronic
999121407 5:149212394-149212416 GCATTGTGGAGAGACTGGGAAGG + Intronic
999498153 5:152120316-152120338 GGATGGAGAATGGGTTGGGAGGG + Intergenic
999791603 5:154945111-154945133 GTGTTGAGAATAGACTGGGGTGG + Intronic
1000026561 5:157363783-157363805 GCTTGGAGAATAGACGGGAGGGG + Intronic
1000290075 5:159861760-159861782 CTTTGGAGAATAGACTGAGACGG - Intergenic
1000393036 5:160745184-160745206 GCATAGAAAATAGAATGGGCTGG - Intronic
1001366105 5:171141583-171141605 GGATGGAGTGTAGACTGAGATGG + Intronic
1002338307 5:178495574-178495596 GCATGGAAAACAGACTGGGAAGG + Intronic
1003141182 6:3472526-3472548 GCATGGAGAATGTACTGGCTGGG - Intergenic
1004350745 6:14888263-14888285 CCATGGAGAATATATTGGGTGGG - Intergenic
1006264932 6:32913026-32913048 GCAAGGAGAAGAAATTGGGATGG + Intergenic
1007896505 6:45366895-45366917 GTATGGAGAATGAACTGAGATGG - Intronic
1008921556 6:56848662-56848684 ACATGGAGGATAGACTTGGGGGG - Intronic
1009689577 6:67010922-67010944 GTATGGAAAATAGACTGGAGAGG - Intergenic
1012453690 6:99381231-99381253 TCATGGAGAACAGATTGGAAAGG - Intronic
1012605327 6:101151445-101151467 AAAGGGAGAAGAGACTGGGAGGG + Intergenic
1013353266 6:109325050-109325072 GTGTGGAGAATAGGCTGTGAAGG + Intergenic
1013803624 6:113972666-113972688 GCATGGAGAACAGTCTTGGCGGG - Intronic
1014090758 6:117401258-117401280 GCATGGAGAATAGACTGGGAGGG - Intronic
1014114198 6:117654188-117654210 GCACAGATAAGAGACTGGGAGGG - Intergenic
1014366468 6:120549160-120549182 GCAGGGAGAATGGTCTGGAAAGG - Intergenic
1014734555 6:125077251-125077273 GCATGGAGCGTAGCCTAGGAAGG + Intronic
1016071104 6:139740179-139740201 GGATGAAGAATAGGCTGGGGAGG + Intergenic
1017624904 6:156338420-156338442 GCAAGCAGACTAGACTGGGAAGG + Intergenic
1019838412 7:3414001-3414023 GAGTGGAGAATGGATTGGGAGGG + Intronic
1020559826 7:9716925-9716947 GCATGGAGAATAAAGCAGGAGGG + Intergenic
1022055902 7:26734235-26734257 TGATGGAGAATGGATTGGGATGG - Intronic
1023167667 7:37358828-37358850 ACATGAAGAACAGACTGGCATGG + Intronic
1023325856 7:39055042-39055064 GCAGAGAGAATAGATTGGAAAGG + Intronic
1023399639 7:39782976-39782998 GGATGGGGAATGGGCTGGGATGG + Intergenic
1023935511 7:44737220-44737242 GCAGGGTGCATTGACTGGGAAGG + Intergenic
1024072575 7:45798780-45798802 GGATGGGGAATGGGCTGGGATGG + Intergenic
1025911040 7:65828858-65828880 GGATGGGGAATGGGCTGGGATGG + Intergenic
1025978665 7:66389987-66390009 GGATGGGGAATGGGCTGGGATGG - Intronic
1026044085 7:66893628-66893650 GGATGGGGAATGGGCTGGGATGG + Intergenic
1026208058 7:68276449-68276471 GGATGGAGAATGGATGGGGAAGG - Intergenic
1026253965 7:68694768-68694790 GTGTGGAGAATAGCCTGGGGGGG - Intergenic
1027429511 7:78095667-78095689 TCATGGAGAATGGGGTGGGATGG + Intronic
1027843102 7:83339154-83339176 CCATGGTGAATAGTCTTGGAAGG + Intergenic
1028188422 7:87817309-87817331 ACATGGAGAATGGACTGTGAGGG - Intronic
1028947256 7:96594343-96594365 GGATGGGGAATAGAGTGGGAAGG - Intronic
1029501287 7:100932125-100932147 ACATGAAGAATAGAAAGGGAAGG + Intergenic
1031119564 7:117705530-117705552 GAATGGAGAGGAGATTGGGAAGG - Intronic
1032049962 7:128642458-128642480 GGATGGGGAATGGGCTGGGATGG + Intergenic
1032540327 7:132697548-132697570 GCATGAGGAACAGCCTGGGATGG + Intronic
1034831861 7:154315644-154315666 GCATGTAGAAGAGGCTGGAATGG + Intronic
1035901355 8:3461338-3461360 GCTTGGAGAGTATGCTGGGAAGG + Intronic
1036036982 8:5030280-5030302 GAAGGTAGAATAGACTTGGAAGG + Intergenic
1039321240 8:36434480-36434502 TTATAGAGAATAGACTGGGCTGG - Intergenic
1039450546 8:37671225-37671247 GGAGGGAGGATTGACTGGGAAGG + Intergenic
1041243538 8:55870081-55870103 GCATAGAGCATGGCCTGGGAAGG - Intergenic
1041879546 8:62733730-62733752 GCATGGAGAATAGAATGAGAAGG - Intronic
1042801433 8:72722239-72722261 GGGTGGAGAACAGACTGGAAGGG - Intronic
1044576308 8:93773426-93773448 GCATGGAGAATAGAATTTGTTGG + Intronic
1044839468 8:96325651-96325673 GCATGGAGAATGGATTTGGAGGG - Intronic
1046274925 8:111946209-111946231 GCATTGAGAATATAGTGAGACGG + Intergenic
1049024987 8:139982224-139982246 GCATGGAAAATGGACGAGGAGGG + Intronic
1049757972 8:144319196-144319218 GCATGGAGACCAGACAGGGCTGG - Intronic
1050153122 9:2637519-2637541 ATTTGGAGCATAGACTGGGAGGG - Intronic
1051989377 9:23133062-23133084 GCAGGGAGGAGAGACAGGGAGGG + Intergenic
1052854296 9:33397545-33397567 GAATAGAGCAAAGACTGGGATGG + Intronic
1053472365 9:38355961-38355983 GCATGGAGGATGGATTGGGGAGG - Intergenic
1056053007 9:82789472-82789494 GCATGCTGAATACCCTGGGAGGG + Intergenic
1056254371 9:84783660-84783682 GCATGGAGAAGAGAGAGGGATGG + Intronic
1056734984 9:89201749-89201771 GGATGGAGAATAGACTGGACAGG + Intergenic
1057077137 9:92143812-92143834 GCATGGAGAAGAGCCAGGGTGGG + Intergenic
1057124275 9:92603812-92603834 GCATGGAGAGTGGACTGGGGAGG - Intronic
1057240024 9:93399939-93399961 GAAGGAAGAATAGACTGGGCTGG - Intergenic
1057848250 9:98542308-98542330 GCATAGAAAAAGGACTGGGAAGG - Intronic
1058422189 9:104842746-104842768 GGGTTGAGAAGAGACTGGGATGG - Intronic
1061641218 9:131957967-131957989 GCCTGGAGTGCAGACTGGGAGGG + Intronic
1061919813 9:133776574-133776596 GCATGGTGAATAGGGTGCGAGGG - Intronic
1061942673 9:133891738-133891760 GCATGGAGGAGAGGCAGGGAGGG + Intronic
1062594626 9:137293613-137293635 GCAGGAGGAATTGACTGGGATGG + Intergenic
1062691045 9:137842088-137842110 GCATGGAGGATACAGGGGGACGG - Intronic
1187221110 X:17327025-17327047 GACTGGAGAATAGACTGGGCTGG - Intergenic
1189088416 X:38051366-38051388 CCATGGAGAGTAGATTGGAAGGG + Intronic
1190455115 X:50619434-50619456 GCAAGGAGGATACACAGGGAGGG + Intronic
1193882180 X:86936695-86936717 GCTTGGAGAATAGGCAGGAATGG - Intergenic
1194848317 X:98839253-98839275 GCTTGGAGAAGTGACAGGGACGG - Intergenic
1195365152 X:104117443-104117465 TCATGGCCAGTAGACTGGGAGGG + Intronic
1195416235 X:104622435-104622457 GCTTAGAGAAGAGACAGGGAAGG - Intronic
1195681138 X:107547476-107547498 GCATTCAGAATAGACTGGAGTGG - Intronic
1197067281 X:122248482-122248504 GCATGGAGGATACAATTGGATGG - Intergenic
1197644583 X:129004026-129004048 GCATGGAGCATGGAGAGGGAGGG - Intergenic
1198390630 X:136170300-136170322 GCATGGAGCAAATGCTGGGATGG + Intronic
1198595278 X:138229290-138229312 GCATGGAGAATTGAGGGGTAGGG + Intergenic
1198661701 X:138975884-138975906 GCAATGTGAATATACTGGGAAGG + Intronic
1198973201 X:142304377-142304399 GCCTGAAGAATATACTGTGATGG + Intergenic
1199754036 X:150847943-150847965 GGATGGAGCATAGACCTGGAAGG - Intronic
1200052644 X:153443114-153443136 GCATGGAGAATGGGCTGGAGAGG - Intergenic