ID: 1014091007

View in Genome Browser
Species Human (GRCh38)
Location 6:117403347-117403369
Sequence ATTAATTTGTAGAAGATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 384
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 347}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014091005_1014091007 1 Left 1014091005 6:117403323-117403345 CCACATTGGGACTAAAAAGCATA 0: 1
1: 0
2: 1
3: 9
4: 130
Right 1014091007 6:117403347-117403369 ATTAATTTGTAGAAGATGGATGG 0: 1
1: 0
2: 3
3: 33
4: 347
1014091003_1014091007 3 Left 1014091003 6:117403321-117403343 CCCCACATTGGGACTAAAAAGCA 0: 1
1: 0
2: 0
3: 12
4: 115
Right 1014091007 6:117403347-117403369 ATTAATTTGTAGAAGATGGATGG 0: 1
1: 0
2: 3
3: 33
4: 347
1014091004_1014091007 2 Left 1014091004 6:117403322-117403344 CCCACATTGGGACTAAAAAGCAT 0: 1
1: 0
2: 0
3: 17
4: 106
Right 1014091007 6:117403347-117403369 ATTAATTTGTAGAAGATGGATGG 0: 1
1: 0
2: 3
3: 33
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014091007 Original CRISPR ATTAATTTGTAGAAGATGGA TGG Intronic
900005479 1:45088-45110 TTTAATTTGTACATGATGCAAGG - Intergenic
906067189 1:42989925-42989947 ATTAATTTGGTGAAGTTGCAGGG + Intergenic
906229029 1:44144924-44144946 AATATTTTGTAGAAGTTTGAAGG - Intergenic
907583568 1:55593927-55593949 CCTAATTTGAAGGAGATGGAAGG - Intergenic
907935629 1:59039590-59039612 ACTAATTTGTAGAACAAGGAAGG + Intergenic
908063616 1:60378527-60378549 ATTACTTTGGAGAAGATAAAGGG + Intergenic
909193012 1:72578165-72578187 ACTCATTTGTAGAAGATGTTGGG + Intergenic
909977601 1:82063724-82063746 ATTGGTTTAAAGAAGATGGAAGG + Intergenic
910131396 1:83911176-83911198 ATTAATTTGTAGTGGTTGGAGGG + Exonic
910987673 1:93021960-93021982 GTTAAATTGTATAATATGGAAGG - Intergenic
911786463 1:101955528-101955550 TTTAAGAAGTAGAAGATGGATGG - Intronic
911860539 1:102942097-102942119 ATTTATTTGAAGAAGATAAAAGG - Intronic
912170755 1:107096583-107096605 ATTAAATTTTAAAACATGGAGGG + Intergenic
912178349 1:107188204-107188226 ATGAATTTGTAGAACTTGGTGGG + Intronic
913438624 1:118873482-118873504 ATTATTTTATAGATGAAGGAAGG + Intergenic
914335197 1:146708634-146708656 TTTAATTTGAAGAAAATGTAGGG + Intergenic
916106331 1:161435329-161435351 AGTTATTTGCAGAAGATGGCAGG + Intergenic
916697257 1:167251494-167251516 ATTATTTGGTAGAGTATGGAGGG + Intronic
917407871 1:174727911-174727933 ATTTCTTTGTAGAAGAGGAAAGG + Intronic
918739872 1:188115579-188115601 CTCTAATTGTAGAAGATGGAAGG - Intergenic
918755717 1:188337811-188337833 AGTTATCTGGAGAAGATGGAAGG + Intergenic
918774492 1:188610745-188610767 AGTCATTTGCTGAAGATGGAAGG - Intergenic
918878477 1:190082689-190082711 AATAATTTGTAGAGGTTGTAAGG - Intergenic
921563971 1:216693807-216693829 ATTAATTCATAGAGGAAGGATGG - Intronic
922959530 1:229634691-229634713 TTGCATTGGTAGAAGATGGATGG + Intronic
924762803 1:247005279-247005301 ATTAATTTGCTGTAGATGTATGG - Intronic
924798079 1:247307399-247307421 ATATACTTTTAGAAGATGGATGG - Intronic
1063030542 10:2229923-2229945 ATTAAAATGCAGAAGATGGGTGG - Intergenic
1063779197 10:9301863-9301885 ATTTATTTATATAAGATGGAGGG - Intergenic
1066283844 10:33944737-33944759 CTGAATATGTAAAAGATGGAAGG + Intergenic
1066326480 10:34364931-34364953 ATTAATTTGAAGAAAATATATGG - Intronic
1068867909 10:61914489-61914511 ATTAATTTGTCCCAAATGGAGGG + Intronic
1071750874 10:88474414-88474436 TTTAATTGCTAGAAGAAGGAGGG - Intronic
1071816262 10:89235127-89235149 AGTAATCTCTAGTAGATGGAGGG + Intronic
1071907873 10:90194861-90194883 ATTAACTTGTAGAAAATTGATGG + Intergenic
1071937687 10:90549274-90549296 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1072700647 10:97639040-97639062 ATTAATTTTTAAAAAATAGATGG + Intronic
1072958103 10:99904632-99904654 ACTAATTTTTAGAGGAGGGATGG - Intronic
1073584803 10:104699523-104699545 ATGAATGAGTAGAAGATGAATGG + Intronic
1073721524 10:106178229-106178251 ATTATTTTGTTAAAGATAGAAGG - Intergenic
1076287617 10:129315503-129315525 ATCAATGGGTAAAAGATGGAGGG + Intergenic
1076769373 10:132654637-132654659 TTTAATTTTTACAAGATTGATGG + Intronic
1076867610 10:133175752-133175774 ATGGATTAGTAGAGGATGGACGG + Intronic
1078299084 11:10107148-10107170 GTAAATTTGTAGAAGCTGAATGG - Intronic
1078319174 11:10318460-10318482 ATTCATTTGTTGTAGATTGAGGG + Intronic
1078534991 11:12165761-12165783 ATCTATTTGGAGAAGAAGGACGG + Intronic
1079361127 11:19771416-19771438 ATCAATTGGTAGAGAATGGAAGG + Intronic
1080215907 11:29840135-29840157 ATTAATTTGTTTAAGATAAATGG + Intergenic
1081080747 11:38736505-38736527 ATTAATGGGTAGAAGAAGAATGG - Intergenic
1081609059 11:44547850-44547872 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1082884989 11:58071898-58071920 ATTAATTTTTTGAGGGTGGAGGG + Intronic
1084020239 11:66412967-66412989 AGAAATTTTTAAAAGATGGAAGG - Intergenic
1085878991 11:80443279-80443301 ATTAATCTGTTAAAGAAGGAAGG + Intergenic
1087342113 11:96919636-96919658 ATTGCTTTGTAAAAGATAGAAGG - Intergenic
1087552113 11:99664614-99664636 ATTAATTTGAAGAATAAGTATGG + Intronic
1087694687 11:101363200-101363222 CTTATTTTGTAGAGGATTGAGGG - Intergenic
1088116065 11:106316258-106316280 ATTATTTTGAAAAAAATGGAAGG - Intergenic
1089903604 11:122013580-122013602 GTTAATCTGCAGAAGATGGCAGG - Intergenic
1090321025 11:125844092-125844114 ATTAATTTTTATAAGTTGTAGGG + Intergenic
1090906537 11:131080121-131080143 ATTGATTTGTATAAAATGGCTGG + Intergenic
1091051736 11:132378728-132378750 AATTATTTGTAGAAGATGGCAGG - Intergenic
1092704641 12:11268982-11269004 ATGTATTTATAGGAGATGGAGGG - Intronic
1092716554 12:11394842-11394864 ATGTATTTATAGGAGATGGAGGG - Intronic
1092749167 12:11702387-11702409 ATTGATTTGTACAAGATAGCTGG + Intronic
1093155479 12:15679178-15679200 ATGAATTTGATGAATATGGATGG - Intronic
1093956489 12:25225907-25225929 AATAACTAGTAGAAGAAGGAAGG - Intronic
1094794202 12:33951467-33951489 ATTAATTTGTATTACATTGATGG - Intergenic
1095159162 12:38896077-38896099 ATTAATTTAAAGAAAATAGATGG + Intronic
1095670998 12:44859975-44859997 ATTAATATTTTGAAGATAGAAGG - Intronic
1095717125 12:45358614-45358636 ATTAATTTGCAGAAAATAGAGGG + Intronic
1096568849 12:52506942-52506964 ATTTTTTTGTTGAAAATGGATGG + Intergenic
1098203050 12:68077476-68077498 CTTAAGCTGAAGAAGATGGAAGG + Intergenic
1098348844 12:69535519-69535541 ATTAATTTATAAAATATGGAGGG + Intronic
1099375646 12:81893930-81893952 AGTAATCTGCAGAAGATGGCAGG - Intergenic
1099711721 12:86234901-86234923 ATTTATTTCAGGAAGATGGAAGG - Intronic
1099869020 12:88322666-88322688 ATTAAGTTGTAGCAGTTGAATGG + Intergenic
1100091801 12:90982008-90982030 GTGAATTTGTAAATGATGGAAGG + Intronic
1101175408 12:102145482-102145504 ATTAATTTCTAGAATATTAATGG + Intronic
1102538833 12:113603289-113603311 AATAATTAGGAGAAGGTGGAAGG - Intergenic
1103164247 12:118756673-118756695 AGTTAATTGGAGAAGATGGATGG - Intergenic
1105299504 13:19119262-19119284 CTTAGTTTGGAGTAGATGGAGGG + Intergenic
1107192009 13:37600152-37600174 ATTAAGTTATAGAAAATGAAGGG + Intergenic
1107469956 13:40682505-40682527 ATTTATTTATATCAGATGGAGGG - Intergenic
1107667933 13:42711932-42711954 ATTAAATTCTATAAAATGGATGG - Intergenic
1108904275 13:55449944-55449966 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1110458281 13:75714797-75714819 AGTAATGTTTAGAAGATGGAGGG + Intronic
1110521899 13:76489356-76489378 AATCATTTGTAGAAGATGAAAGG - Intergenic
1110894775 13:80735865-80735887 GTTAAATTTTACAAGATGGAAGG - Intergenic
1111019046 13:82422038-82422060 ATTAATATTTAGAATATGGGAGG + Intergenic
1111057805 13:82973055-82973077 GTTAATCTGAAGAAGATGGCAGG + Intergenic
1111608972 13:90578732-90578754 AATAATGGGTAGAAGCTGGAAGG - Intergenic
1113625421 13:111792772-111792794 CTTTGTTTGTGGAAGATGGAAGG - Intergenic
1113857761 13:113458065-113458087 ATGATTTTGTAGAATATGCACGG - Exonic
1113895619 13:113762489-113762511 TTTATTTTGTAGCAGATGGGGGG + Intronic
1114642869 14:24236091-24236113 TTGAATTTGTAAAAGATGTACGG + Exonic
1115340210 14:32285746-32285768 ATAGATTGCTAGAAGATGGAAGG + Intergenic
1115505316 14:34088170-34088192 ATTAGTAAGGAGAAGATGGAAGG + Intronic
1116109798 14:40563408-40563430 ATTAATTACTAGAATATAGAAGG - Intergenic
1116415069 14:44669285-44669307 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1117042915 14:51783908-51783930 ACTCATTTGGAGAAGATGGACGG + Intergenic
1117534038 14:56687189-56687211 TTTCATTTGTAGATTATGGATGG + Intronic
1117731076 14:58722448-58722470 AATAAATTGTAGAAGATTGGGGG - Intergenic
1119359901 14:74040378-74040400 ATCAATCTGTAGAAGATTGAGGG + Intronic
1120074896 14:80145126-80145148 ATTAATTTACTGAAGATGGATGG - Intergenic
1120253331 14:82087738-82087760 ACTAATTTGAAGAAGAAGGGGGG + Intergenic
1120791136 14:88583438-88583460 AATAATTTTTAAAATATGGAAGG - Intronic
1122384883 14:101337593-101337615 ATTAATTTGTTAAATATAGATGG - Intergenic
1123219532 14:106843145-106843167 CAAAATTTGCAGAAGATGGAAGG - Intergenic
1125030999 15:35076026-35076048 ATTGAGATGGAGAAGATGGATGG - Intergenic
1126812537 15:52422434-52422456 ATTGAGATGTAGAAGATGGCAGG - Intronic
1127042221 15:54989930-54989952 ATCAATTTGTAGCAGCTGGTGGG - Intergenic
1127387069 15:58475259-58475281 ATTATGGTGTGGAAGATGGAGGG - Intronic
1127466991 15:59253797-59253819 ATTAATTTACAGAAAATGTAGGG + Intronic
1127738631 15:61873426-61873448 ATTAATTTCTAGAATATACAAGG + Intronic
1128186937 15:65650683-65650705 AGAAAGGTGTAGAAGATGGAGGG + Exonic
1129643309 15:77405482-77405504 ATTAATTTTTAAAAGATGTGTGG + Intronic
1129924145 15:79347428-79347450 CTTAATGGGCAGAAGATGGAAGG + Intronic
1130809766 15:87364531-87364553 ATTATATTGCAGAAAATGGATGG - Intergenic
1133576678 16:7098119-7098141 ATTAGTTAATGGAAGATGGAGGG + Intronic
1135434081 16:22413529-22413551 TTTAATTTCTAGGAGATGCATGG - Intronic
1135557646 16:23450507-23450529 AATAATTAGTAAAAGATGCAAGG + Intronic
1139006744 16:62581661-62581683 ATCAATTGGTAGAAGTTGCATGG - Intergenic
1139103276 16:63795637-63795659 ATTAATTTATTGAAGAGGGAGGG + Intergenic
1139998427 16:71002606-71002628 TTTAATTTGAAGAAAATGTAGGG - Intronic
1140417504 16:74786619-74786641 AGGAATTTGAAAAAGATGGAGGG - Intergenic
1142760150 17:2037229-2037251 ATATAATTGGAGAAGATGGATGG + Intronic
1143229235 17:5337932-5337954 AATAATTTTTAGCAAATGGAAGG + Intronic
1143961772 17:10727177-10727199 ATTAATTTTTTGGAGATGGGGGG + Intronic
1144346766 17:14356478-14356500 GGTAATGTGTTGAAGATGGAGGG + Intergenic
1145404210 17:22571278-22571300 AATAATTTGGGGTAGATGGAGGG + Intergenic
1147590744 17:41681902-41681924 ATTAATTTGGGGAAGATGGGTGG + Intergenic
1149556135 17:57574714-57574736 AGTAGTTGGTAGAAGATAGATGG - Intronic
1150439014 17:65176794-65176816 GTAAATTTGTGGTAGATGGATGG - Intronic
1153155890 18:2148384-2148406 ATTAATGGGTGGAAGTTGGAAGG - Intergenic
1155333558 18:24742223-24742245 ATTAATTTGAATACAATGGAGGG + Intergenic
1155895551 18:31321440-31321462 AATATTTTGTAGAAAATGGAAGG + Intronic
1155914981 18:31548176-31548198 ATTAACTTGTAGAAAAGGGAAGG - Exonic
1156510334 18:37631139-37631161 ATTCATTTGTTGATGGTGGAAGG + Intergenic
1157122366 18:44923528-44923550 ATTAATTTAAAGAACATGGCTGG - Intronic
1157632775 18:49115847-49115869 ATTAATTTTAAAAAGATAGAAGG + Intronic
1157998507 18:52588155-52588177 AGTTATCTGCAGAAGATGGAAGG + Intronic
1158314412 18:56194738-56194760 TTTATTTTGTAGATGATGTAAGG + Intergenic
1158683778 18:59594221-59594243 ATTCATTTGTAGAAGGAGGACGG - Intronic
1159457249 18:68675784-68675806 ATTAGTTTATAGAAGATGAGAGG + Exonic
1159780604 18:72656406-72656428 ATGAAGTTGTAGAAACTGGAAGG - Intergenic
1160637234 19:86699-86721 TTTAATTTGTACATGATGCAAGG - Intergenic
1161820467 19:6527784-6527806 ATAAATTTGCAGAAGAAGGCCGG - Intergenic
1162132454 19:8535337-8535359 TTTGATTTGGAGAAGACGGACGG - Intronic
1163177015 19:15571508-15571530 ATAGATATGTAGATGATGGATGG - Intergenic
1163919927 19:20278868-20278890 CTTAAATTGTAAAAGATAGAGGG - Intergenic
1165546776 19:36544441-36544463 TTTAATTTGTTTAAGCTGGAAGG + Exonic
1168414352 19:56159243-56159265 ATGAATGTCTAGATGATGGATGG - Intronic
926235482 2:11039985-11040007 ATGAATTTGAAGAACATGGAGGG - Intergenic
928185743 2:29109085-29109107 ATTATTTTATAGAAAATGTAAGG - Intronic
928377002 2:30783486-30783508 ATTAATTGTTAGAGGAAGGAAGG + Intronic
931093738 2:58916215-58916237 ATTGATTTGTATAAAAGGGAGGG + Intergenic
933286379 2:80388794-80388816 CTTAATTTGTAGAGCCTGGAGGG + Intronic
933538753 2:83611470-83611492 AGTAATATTTAGAAGATGAAGGG - Intergenic
935314448 2:101817599-101817621 GGCACTTTGTAGAAGATGGAGGG + Intronic
935425113 2:102911356-102911378 AGTTATTTGCAGAAGATGGCAGG + Intergenic
938179796 2:129170139-129170161 AATAATATTTAGATGATGGATGG - Intergenic
938714625 2:134008140-134008162 ATCAATCTATACAAGATGGATGG + Intergenic
938954415 2:136284746-136284768 ATTAGTTAGCAGAAAATGGAGGG - Intergenic
940231865 2:151463184-151463206 ATTACTTTGGAGAAGTTTGATGG + Exonic
940682419 2:156803656-156803678 ATTAAATTGTAGGACCTGGATGG - Intergenic
941388382 2:164881188-164881210 ATAAATTTCAAGAAGAAGGAAGG - Intergenic
941838842 2:170056551-170056573 GTTTATTTGTAGAAGTTGGTAGG + Intronic
942062382 2:172239731-172239753 CTCAAATTGGAGAAGATGGAAGG - Intergenic
942549147 2:177096307-177096329 ATTTATTTGTATACTATGGAAGG - Intergenic
942962146 2:181843670-181843692 ATGGATATGTAGAAGAGGGAGGG + Intergenic
943016537 2:182517326-182517348 ATAAACATGGAGAAGATGGAAGG - Intronic
943201705 2:184835380-184835402 AGTAATTTCTAGAAAAAGGATGG + Intronic
943604428 2:189960384-189960406 ATTAATTTGGAGAAGAGGGGAGG - Intronic
944833092 2:203552122-203552144 GTTAATTTGTAGAAGAGGGTAGG - Intergenic
947046552 2:225993528-225993550 TTCAATTGTTAGAAGATGGAAGG + Intergenic
947177101 2:227378846-227378868 ATTAATTAGTAGAAGTTGGCTGG - Intronic
947846561 2:233249139-233249161 ATTAATTTGGAGAAGTCAGAAGG + Intronic
1169641878 20:7761272-7761294 ATTTATTTGTAGAGCATGGTAGG - Intergenic
1170051126 20:12146626-12146648 ATTAATTTTTAGAAGGTGTAAGG + Intergenic
1170871945 20:20214106-20214128 ATTAATTAGTGACAGATGGAAGG + Intronic
1171002847 20:21432180-21432202 ATTCATTTGCAAAAGAAGGAAGG - Intergenic
1172473075 20:35215216-35215238 TTTAATTGGCAGAAAATGGAGGG - Intergenic
1174503476 20:51002210-51002232 ATTAATTTAAAAAAGAAGGAAGG - Intergenic
1174654970 20:52163717-52163739 ATAAATGTGTATAAGATGCAGGG - Intronic
1175436120 20:58950348-58950370 CTTAATTTGTAAAAGAAGGGAGG + Intergenic
1177083458 21:16671900-16671922 ATTATTTTTTAAAAGATTGAGGG - Intergenic
1177127625 21:17215998-17216020 TTTATTTTGGAGAAGATGAATGG - Intergenic
1177505564 21:22014211-22014233 AGTTATCTGCAGAAGATGGAAGG + Intergenic
1177571742 21:22895764-22895786 ATTAATTTTTATAAGATGTAAGG + Intergenic
1178035626 21:28579107-28579129 ATCGAGTTGTAGAAAATGGATGG + Intergenic
1178368630 21:32008817-32008839 ATGAATGAGTAGATGATGGATGG + Intronic
1180591647 22:16943264-16943286 TTTAATTTGTATAACATGTAAGG - Intergenic
1182107469 22:27699580-27699602 ATTAATGTGGAGAAGGTGCATGG - Intergenic
1183766665 22:39883152-39883174 ATTCATTTGTTGATTATGGAAGG - Intronic
1184574043 22:45347845-45347867 GGTCATTTCTAGAAGATGGATGG + Intronic
1184826777 22:46957891-46957913 ATCCATTTGCAGATGATGGAGGG + Intronic
1185256242 22:49834153-49834175 TTTAATTTGTTGAAGATAGATGG + Intergenic
949287043 3:2419050-2419072 ATTAATTGGTAGAAGTTAAATGG + Intronic
950928532 3:16766811-16766833 ATGAATTTGAGGAAGATTGAAGG + Intergenic
950928628 3:16767535-16767557 TTTAATTTGTACAAGATTTAAGG + Intergenic
951285782 3:20811589-20811611 TTTTTTTTGTAGAAGATGAATGG - Intergenic
952594413 3:34998773-34998795 ATTTACATGCAGAAGATGGAAGG - Intergenic
952605448 3:35142045-35142067 ATTTATCTGCAGAAGATGGCAGG + Intergenic
952660650 3:35842535-35842557 ATTAATTTGTAGCAAATGGATGG + Intergenic
953282363 3:41571722-41571744 TTAAATTTGGAGAAGTTGGAGGG - Intronic
954054115 3:48007647-48007669 AGTTATCTGTAGAAGATGGCAGG - Intronic
955091672 3:55758239-55758261 ATTAATTTCCAAAGGATGGAGGG + Intronic
955142521 3:56283561-56283583 ATTTATTTGTAAAGGGTGGAGGG - Intronic
955653142 3:61215969-61215991 ATTAATTTGTATAAGATGTAAGG - Intronic
956360449 3:68441408-68441430 AGTAATCTGCAGAAGATGGCAGG - Intronic
956888500 3:73585648-73585670 ATTATTTCCTGGAAGATGGATGG + Intronic
957311431 3:78524350-78524372 ATTTATTGGCAGAAGATGGAAGG + Intergenic
957755607 3:84482346-84482368 ATTAATGTCTAGAATATGCAAGG + Intergenic
958937811 3:100276201-100276223 ATAAATTTTTAGAACATGGTTGG + Intronic
959952502 3:112195022-112195044 ATTAATTTGTATAAGACAAATGG + Intronic
959997856 3:112698292-112698314 AGTTATCTGCAGAAGATGGAAGG - Intergenic
960175570 3:114513801-114513823 ATGAAGTGCTAGAAGATGGAAGG - Intronic
960709727 3:120515800-120515822 ATTCATTTGAACATGATGGAGGG - Intergenic
961614034 3:128164642-128164664 ATTACATTTTAGAAGATGGGAGG + Intronic
962228257 3:133634716-133634738 AACAATTTGTAGAAGAAGCAAGG + Intronic
963101424 3:141609502-141609524 CTTAAGCTGCAGAAGATGGAAGG + Exonic
965861787 3:173158172-173158194 GTTATTTTGTAGAAGATGTTGGG + Intergenic
966293136 3:178384331-178384353 ATTAACTTTTAGAAAATGCACGG + Intergenic
966573161 3:181470063-181470085 ACAAATTTATGGAAGATGGAAGG - Intergenic
968598395 4:1497092-1497114 ATGGATGTGTAGATGATGGATGG + Intergenic
968598421 4:1497265-1497287 ATGGATGTGTAGATGATGGATGG + Intergenic
968598451 4:1497471-1497493 ATGGATGTGTAGATGATGGATGG + Intergenic
969275497 4:6132902-6132924 ATGAATGTGTAGAAGTTGGCTGG - Intronic
969383864 4:6829486-6829508 ACTGATTTTTAAAAGATGGAAGG - Intronic
969997750 4:11331854-11331876 TTTAATTTGTGGAAGACAGAAGG - Intergenic
971672947 4:29587336-29587358 GTAAATTTGCATAAGATGGAAGG + Intergenic
972129066 4:35807595-35807617 ATTAATTTATAGAAAATGCTGGG + Intergenic
972201301 4:36717183-36717205 AGTTATCTGTAGAAGATGGCAGG + Intergenic
974030841 4:56775035-56775057 TTTTATTTGTAGAAGATACAGGG - Intergenic
974337151 4:60563968-60563990 AGTCATTTGTACAACATGGATGG - Intergenic
975320779 4:73008308-73008330 ATCTATTTGTTGAAGATGGTGGG - Intergenic
976034208 4:80795851-80795873 AGTTATTTGCAGAAGATGGCAGG + Intronic
976656656 4:87496012-87496034 ATTAATTTCTATTAGAGGGATGG + Intronic
976829919 4:89304070-89304092 GTTAGTTTATAAAAGATGGATGG - Intronic
977744197 4:100525697-100525719 ATTTATTTCGAGAAGTTGGATGG - Intronic
978908124 4:114033706-114033728 ATTTATTTTTAGAAGAAGGGTGG - Intergenic
979205831 4:118036840-118036862 AGTAATTTGTAGAAGATTTGGGG - Intronic
979767017 4:124474565-124474587 AGTTATCTGTAGAAGATGGCAGG - Intergenic
982082742 4:151806460-151806482 ATTAATTTCTAGTAGATCTATGG - Intergenic
982621968 4:157719460-157719482 GTTAAATTTTAGAACATGGAAGG + Intergenic
982806836 4:159776436-159776458 AATAATTTGTAAAAGATGTTTGG + Intergenic
983025730 4:162735463-162735485 AATAACTTGTAACAGATGGATGG - Intergenic
983291170 4:165808035-165808057 ATAAATTTGTAAAAAATGTAAGG - Intergenic
983382948 4:167020880-167020902 ATAAAGTTGAAGAAGATGGGTGG + Intronic
983691096 4:170469861-170469883 GTTAATTTGGAGAATCTGGATGG - Intergenic
983806157 4:171995325-171995347 TTTAATTTCTAGGAGATGGATGG - Intronic
984273929 4:177584571-177584593 ATTAATCAGAACAAGATGGAAGG - Intergenic
984310818 4:178055705-178055727 AGTCTTTTGTAGAGGATGGATGG - Intergenic
985210279 4:187585677-187585699 AATAATTTTCAGAATATGGAAGG + Intergenic
985329974 4:188821234-188821256 ATTTATTTGTATAAGACAGAGGG + Intergenic
985712940 5:1440230-1440252 ATGAATAGATAGAAGATGGATGG + Intronic
986312539 5:6564000-6564022 TTTCATTTTTAGAAGATTGAAGG + Intergenic
988187404 5:27885059-27885081 ATTAATTTTTATAAGGTGTAAGG + Intergenic
988228766 5:28448097-28448119 ATTTATCTGCAGAAGATGGTAGG - Intergenic
988467876 5:31508349-31508371 ATTAAATTGCAGTAGATGGAAGG - Intronic
988944446 5:36181901-36181923 ATTAATCTGTAGATGAGGAAGGG - Exonic
989217037 5:38916319-38916341 ATTCATCTTTAGAAAATGGATGG - Intronic
989337323 5:40333254-40333276 ATTAAATTTTAGAATATGAATGG + Intergenic
989556609 5:42803904-42803926 CTTAATTTATTGAAGATGCAAGG - Intronic
992486206 5:77198850-77198872 TTTAAGTTGTAGAAGAAGAATGG - Intergenic
992486305 5:77200228-77200250 TTTAAGTTGTAGAAGAAGAATGG + Intergenic
993155898 5:84221858-84221880 ATAAATTTGTAGCAAATGTAAGG + Intronic
993408518 5:87544574-87544596 GCTAATTTGTATGAGATGGAAGG - Intergenic
993566245 5:89479193-89479215 ATTTCTTAGTAGAAGTTGGAAGG - Intergenic
993791788 5:92218882-92218904 ATTTATCTGCAGAAGATGGCAGG - Intergenic
994377612 5:99032916-99032938 ATTGATTAGGAGAAAATGGAGGG - Intergenic
994797971 5:104331042-104331064 TAAAATTTCTAGAAGATGGATGG - Intergenic
994968182 5:106700537-106700559 ATTTATTTGTATCAGATAGAAGG + Intergenic
995249188 5:109970444-109970466 TTTAATTTCTAGATCATGGATGG - Intergenic
995291940 5:110467082-110467104 AAAAATTTAAAGAAGATGGACGG + Intronic
995360855 5:111295304-111295326 AGAAATTTGTAGGATATGGAGGG - Intronic
995427736 5:112043755-112043777 AGTTATTTGCAGAAGATGGCAGG + Intergenic
996478082 5:123943539-123943561 ATTAGATTTTAGAAGAAGGAAGG + Intergenic
997664873 5:135622303-135622325 ATAAATTTAGAGAAGATGAATGG - Intergenic
1000791800 5:165617134-165617156 ATAAATTTGGACAAGATGCATGG - Intergenic
1002829162 6:803318-803340 GATAATATATAGAAGATGGATGG - Intergenic
1002837213 6:875020-875042 TGTTATTTTTAGAAGATGGAGGG + Intergenic
1005763792 6:28990954-28990976 ATTAATTTTTAGGACATGCAGGG + Intergenic
1006143599 6:31945401-31945423 ATTCAGAGGTAGAAGATGGAGGG - Exonic
1006685486 6:35829625-35829647 ATTAAGTTGATGAAGATGAATGG + Intronic
1007338084 6:41169460-41169482 ATCAATTTATAGAAAATGCAGGG - Intergenic
1007962916 6:45977432-45977454 TTTAATTTACAAAAGATGGAGGG - Intronic
1008228194 6:48949605-48949627 AAAAATTTGTAAAAGATGCAAGG + Intergenic
1008714285 6:54269508-54269530 TTTAATTTGGTGAAAATGGAAGG + Intergenic
1008942172 6:57058964-57058986 ATTATTTTGAAAAAGATGAATGG + Intergenic
1009472577 6:64046475-64046497 GTTAAGATGTAGAAGATGGTAGG - Intronic
1009604731 6:65852340-65852362 ATTAAGTCAGAGAAGATGGAAGG - Intergenic
1011069098 6:83361637-83361659 ATTTATCTGCAGAAGATGGCAGG - Intronic
1011861374 6:91761212-91761234 TTTTATTTGAAGAAGATGCATGG + Intergenic
1012582532 6:100886127-100886149 ATTAATTTGGAGAAGATTTGGGG - Intergenic
1012716406 6:102678285-102678307 ATGAATAGGGAGAAGATGGAGGG - Intergenic
1012730458 6:102874291-102874313 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1012856689 6:104510113-104510135 ATTTACTTTTAGAAGATGAAAGG + Intergenic
1012915480 6:105165813-105165835 ATTAATGAGTAGAATATTGATGG - Intronic
1013200254 6:107887759-107887781 ATTTTTTTGTATAAGATGTAAGG + Intronic
1013406668 6:109849774-109849796 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1013853592 6:114544169-114544191 CTTAACGTGTAGAAGATGCATGG + Intergenic
1014091007 6:117403347-117403369 ATTAATTTGTAGAAGATGGATGG + Intronic
1014303053 6:119707529-119707551 ATAAATTTGGACAACATGGAAGG + Intergenic
1015406925 6:132848119-132848141 AATCATTTGTAGAAAATAGAAGG + Intergenic
1015443289 6:133272593-133272615 AGTTATCTGTAGAAGATGGTTGG + Intronic
1015768098 6:136740037-136740059 AATAATTTGAAGAACATGCAGGG - Intronic
1015856601 6:137631720-137631742 ATTTATTTGTAAAAGATAGATGG - Intergenic
1017670629 6:156766351-156766373 TTAAAACTGTAGAAGATGGATGG - Intergenic
1017699017 6:157049579-157049601 CTTAATTTGTGGAAGAGTGAAGG - Intronic
1017991600 6:159493899-159493921 ATTAATTTGTAAAATATGCACGG + Intergenic
1020146531 7:5648417-5648439 TTTAATTTATAGAAAATTGAAGG + Intronic
1020778596 7:12489812-12489834 AGTGATGTGTAGAAGATGGGTGG + Intergenic
1021124355 7:16833664-16833686 ATTAATTTTTACAAGATGTCTGG + Intergenic
1021804723 7:24343564-24343586 CTTAATTAGTAGAAGAGGGGAGG - Intergenic
1021805345 7:24349431-24349453 CTTAATTAGTAGAAGAGGGGAGG + Intergenic
1022064006 7:26832013-26832035 TTTAATTAGTAGAGAATGGAAGG - Intronic
1024811841 7:53220870-53220892 AATAGCTTGTAGAAGAGGGAGGG - Intergenic
1024899300 7:54299451-54299473 AACAATTTGTAAAACATGGAGGG - Intergenic
1026033021 7:66811447-66811469 ATCAATTTTTGGAAGAGGGACGG - Exonic
1026661354 7:72305401-72305423 ATTAATAAGTTGAATATGGAAGG + Intronic
1027588278 7:80085566-80085588 TTTAACTTATAGAACATGGAAGG - Intergenic
1027781059 7:82521146-82521168 ACTAAATTGCAGAAAATGGAAGG + Intergenic
1028513140 7:91647074-91647096 TTGAATTTGTAGAAGGTTGAGGG + Intergenic
1028700499 7:93773260-93773282 GTTAATTTGTATAAGGTGTAAGG - Intronic
1030142989 7:106324345-106324367 ATTGATTTGTATAAGGTGTAAGG - Intergenic
1030840258 7:114343208-114343230 AATAAGATGTAGAAGATGTAGGG - Intronic
1032307419 7:130749189-130749211 ATAATTTTGTAGAAGATGGAAGG - Intergenic
1032370627 7:131347130-131347152 ATTATTATGTAGAAGGTGCAGGG - Intronic
1034827295 7:154277461-154277483 AATAAATTTTAAAAGATGGAAGG + Intronic
1036513931 8:9426192-9426214 ATTAATATTTAAAAGTTGGATGG + Intergenic
1036924185 8:12888226-12888248 ATGTATTTGTGGAAGATTGAAGG + Intergenic
1037011093 8:13843465-13843487 ATTAATATATAAAACATGGAAGG + Intergenic
1038087916 8:24220567-24220589 ATTAATATGTGGAGTATGGAAGG - Intergenic
1039750688 8:40475580-40475602 ATTAATTTTTAAAAGAAGGGTGG + Intergenic
1041050546 8:53930510-53930532 ATTAATTTCCAGAAGTAGGAAGG - Intronic
1043307063 8:78807587-78807609 ATTATTTTTTATAAGATAGATGG + Intergenic
1043368849 8:79567396-79567418 ATTAATTTGTGCAAAATAGAGGG - Intergenic
1045433036 8:102131839-102131861 ATTAATTTCTAATAGATGTACGG + Intergenic
1045783133 8:105891345-105891367 ATTAATATGCAGAATATGTAAGG + Intergenic
1046362216 8:113175811-113175833 ATTATTTTTTAGAGGGTGGAAGG - Intronic
1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1046804662 8:118466673-118466695 AGTAATTTGTAAAGGATGGTCGG - Intronic
1046932126 8:119852245-119852267 ATTATTTTGGAGAATATTGATGG - Intronic
1047718890 8:127620386-127620408 ACTAATGGGGAGAAGATGGAGGG + Intergenic
1048756604 8:137746525-137746547 ATTAATCTGTAGAAGTTCTAGGG - Intergenic
1050837132 9:10096904-10096926 ATTAATTTTTTTAAGATGTAAGG + Intronic
1051176420 9:14365453-14365475 GTTGATTTGTAGAAGAAAGATGG + Intronic
1051227209 9:14912361-14912383 ATTCATTTGTGGCAGATAGAAGG - Intergenic
1051727219 9:20100543-20100565 ATTAAGTTCATGAAGATGGAAGG + Intergenic
1052212033 9:25916163-25916185 ATTAACTAGTAAAAGATTGATGG + Intergenic
1052457514 9:28719286-28719308 GTTAATTTAGAGAAGATGTAGGG - Intergenic
1055012518 9:71582542-71582564 AGAAATTTTTAGAAGATGTATGG - Intergenic
1055445611 9:76379300-76379322 TTGAAATTTTAGAAGATGGAAGG - Intergenic
1056035459 9:82600439-82600461 ATTAATTGTTAATAGATGGATGG - Intergenic
1056125861 9:83536439-83536461 ATGAATGTGTAGATGATGGAGGG - Intronic
1056297718 9:85209188-85209210 ATTAAATTGAAGAAAAGGGAAGG + Intergenic
1058883112 9:109302501-109302523 ATGAATTTGGGGAAAATGGAGGG + Intronic
1059367846 9:113800570-113800592 AATAAATTGTCCAAGATGGAGGG - Intergenic
1059970655 9:119664638-119664660 ATTAGTTTGTAGAGAATGAATGG + Intergenic
1060632224 9:125169223-125169245 ATTATTTTGTAGACAATGAAAGG - Intronic
1061398835 9:130357502-130357524 ATGGATTGGTAGATGATGGATGG + Intronic
1061770019 9:132912119-132912141 ATTAATTAGAAGAAAATGGAGGG + Intronic
1188341735 X:29010692-29010714 AGTAATGTGTAGATGGTGGAGGG + Intronic
1189154887 X:38746752-38746774 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1192367869 X:70489810-70489832 ATGAATTTGTAGAAGATTAGAGG - Intronic
1193200328 X:78682324-78682346 ATTGATTGGTGGATGATGGATGG - Intergenic
1193339057 X:80324403-80324425 ATTAATTTGTATAAGGTGTAAGG - Intergenic
1193598388 X:83477218-83477240 AGCCATTTGCAGAAGATGGAAGG + Intergenic
1194046898 X:89018553-89018575 ATTTATTTATAGAATATTGATGG - Intergenic
1194064024 X:89240232-89240254 ATAAATGTGTAGCAGATGGTGGG - Intergenic
1194258815 X:91668890-91668912 ATTAAATTTTAGAATATGTAAGG + Intergenic
1194443546 X:93961071-93961093 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1194598613 X:95891326-95891348 ATTAATTTATGGAAGCTGGTTGG - Intergenic
1194660134 X:96621805-96621827 ATTAATCTGTAGATGAGGAAGGG - Intergenic
1195269756 X:103217659-103217681 TTTAATTTTTAGAATATTGAGGG + Intergenic
1195591515 X:106633635-106633657 ATTAATTGGTAGAAGATTGGTGG + Intronic
1195709442 X:107762252-107762274 GTTAAAATGTAGAAGATGGGGGG + Intronic
1197190296 X:123639792-123639814 ATTAATTTTTTTAAGATGCAAGG - Intronic
1197480265 X:126975011-126975033 AATAATTTGTCAAATATGGAGGG - Intergenic
1200083619 X:153592020-153592042 ATTAATAGGTAGATCATGGAGGG - Intronic
1200577518 Y:4908088-4908110 ATTAAATTTTAGAATATGTAAGG + Intergenic
1200718198 Y:6574331-6574353 ATAAATGTGTAGCAGATGGTGGG - Intergenic
1201928182 Y:19312898-19312920 ATTAATTTTTATAAGGTGTAAGG + Intergenic