ID: 1014094526

View in Genome Browser
Species Human (GRCh38)
Location 6:117445686-117445708
Sequence CCAACCAGCCAGACTCCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 148}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014094522_1014094526 -1 Left 1014094522 6:117445664-117445686 CCTTCTTCTCTTACATCACCCTC 0: 1
1: 0
2: 5
3: 43
4: 514
Right 1014094526 6:117445686-117445708 CCAACCAGCCAGACTCCTTCTGG 0: 1
1: 0
2: 2
3: 18
4: 148
1014094519_1014094526 14 Left 1014094519 6:117445649-117445671 CCTCTCCCTCTCTGACCTTCTTC 0: 1
1: 0
2: 6
3: 120
4: 1188
Right 1014094526 6:117445686-117445708 CCAACCAGCCAGACTCCTTCTGG 0: 1
1: 0
2: 2
3: 18
4: 148
1014094516_1014094526 26 Left 1014094516 6:117445637-117445659 CCACCTGGTCACCCTCTCCCTCT 0: 1
1: 0
2: 96
3: 701
4: 1429
Right 1014094526 6:117445686-117445708 CCAACCAGCCAGACTCCTTCTGG 0: 1
1: 0
2: 2
3: 18
4: 148
1014094518_1014094526 15 Left 1014094518 6:117445648-117445670 CCCTCTCCCTCTCTGACCTTCTT 0: 1
1: 1
2: 15
3: 182
4: 1812
Right 1014094526 6:117445686-117445708 CCAACCAGCCAGACTCCTTCTGG 0: 1
1: 0
2: 2
3: 18
4: 148
1014094520_1014094526 9 Left 1014094520 6:117445654-117445676 CCCTCTCTGACCTTCTTCTCTTA 0: 1
1: 0
2: 5
3: 52
4: 704
Right 1014094526 6:117445686-117445708 CCAACCAGCCAGACTCCTTCTGG 0: 1
1: 0
2: 2
3: 18
4: 148
1014094517_1014094526 23 Left 1014094517 6:117445640-117445662 CCTGGTCACCCTCTCCCTCTCTG 0: 1
1: 0
2: 10
3: 82
4: 973
Right 1014094526 6:117445686-117445708 CCAACCAGCCAGACTCCTTCTGG 0: 1
1: 0
2: 2
3: 18
4: 148
1014094515_1014094526 27 Left 1014094515 6:117445636-117445658 CCCACCTGGTCACCCTCTCCCTC 0: 1
1: 0
2: 3
3: 52
4: 598
Right 1014094526 6:117445686-117445708 CCAACCAGCCAGACTCCTTCTGG 0: 1
1: 0
2: 2
3: 18
4: 148
1014094521_1014094526 8 Left 1014094521 6:117445655-117445677 CCTCTCTGACCTTCTTCTCTTAC 0: 1
1: 0
2: 3
3: 52
4: 538
Right 1014094526 6:117445686-117445708 CCAACCAGCCAGACTCCTTCTGG 0: 1
1: 0
2: 2
3: 18
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014094526 Original CRISPR CCAACCAGCCAGACTCCTTC TGG Intronic
900290410 1:1921336-1921358 CCAACAAGCCAGACTCCAGAGGG + Intergenic
900309707 1:2027824-2027846 CCCACAAGCCAGACTGCTCCAGG - Intronic
901050326 1:6423013-6423035 CCAACCTCTCAGACTCCTTTCGG - Intronic
903265217 1:22154003-22154025 CAAACCAGCCAGGCTCATTCTGG - Intergenic
903468441 1:23568382-23568404 CCGAACAGCCACATTCCTTCGGG - Intergenic
903672359 1:25044102-25044124 CCAATCAGACAAACTCCATCAGG + Intergenic
909121211 1:71606422-71606444 CCATCCAGCCAAACTGCTCCTGG + Intronic
909880219 1:80866193-80866215 CCAACCTGCCAGAGTCCTTATGG - Intergenic
912757369 1:112335540-112335562 CCAAGCACCCAGTCTCCCTCAGG - Intergenic
915249422 1:154577768-154577790 CCCACCCGCTAGACTCCCTCTGG - Exonic
915897345 1:159822555-159822577 CCTTCCATCCAGACTCCTGCAGG + Intergenic
916074413 1:161192073-161192095 GCAAGCAGTCAGGCTCCTTCAGG - Exonic
917846956 1:179027081-179027103 CCACCCAGCCAGCTTCCCTCTGG + Intronic
918047535 1:180950575-180950597 CCAACCACCCTGAGTGCTTCAGG - Exonic
922339954 1:224647393-224647415 CAAGCAAGCCAGACTACTTCAGG - Intronic
924639159 1:245816898-245816920 GCAATCAGCGAGACTCCGTCGGG - Intronic
1066266685 10:33782872-33782894 CCAACCAGATAGGCTGCTTCTGG + Intergenic
1071566535 10:86674126-86674148 CCAGCCAGCCTCACACCTTCTGG + Intronic
1071569302 10:86687727-86687749 CCAACCATCCACACTACTGCTGG + Intronic
1072615500 10:97046692-97046714 CCAACCAGCTGGAGTCCATCCGG - Exonic
1077368581 11:2171250-2171272 CCAACCAGCCTGCCTGCTTGGGG - Intronic
1077888686 11:6403812-6403834 CCCACCTGGCAGATTCCTTCTGG - Exonic
1079162949 11:18011836-18011858 CCAGCCAGCCAGACTACCGCAGG + Intronic
1080388340 11:31823416-31823438 CCAAAAAGCCAGCCTCCTTTGGG - Intronic
1081726774 11:45335533-45335555 CCAACCAGTTACACTCATTCAGG + Intergenic
1083629444 11:64088175-64088197 CAAAGCAGCCAGACTCCTCCAGG + Intronic
1084144307 11:67256006-67256028 CCTCCCAGCCAGGCTCCTCCAGG + Exonic
1084166563 11:67377558-67377580 CCAGCCAGCCACACTTCTTGAGG - Intronic
1085345925 11:75768294-75768316 TCAACCACCCAAACTGCTTCTGG - Intronic
1088786970 11:113190891-113190913 CCAAGCAGCCATTCTCCTTAAGG - Intronic
1089149099 11:116351078-116351100 CCACCCAGCGAGCCACCTTCTGG + Intergenic
1092553282 12:9527189-9527211 GCAACCAGCGAGACTCCGTGGGG + Intergenic
1094185613 12:27639510-27639532 CCAAATAGCCAGACACCTTCGGG - Intronic
1094518824 12:31163437-31163459 GCAACCAGCGAGACTCCGTGGGG - Intergenic
1096699483 12:53372700-53372722 ACAACCAGCCTTTCTCCTTCAGG + Intergenic
1097329385 12:58317055-58317077 CCAGCCAGCCACACTGCTCCTGG - Intergenic
1097688531 12:62713134-62713156 CCAACCATCCAAACGCTTTCTGG - Intronic
1098471439 12:70849276-70849298 CAAAGCAGCCAGTCTACTTCTGG - Intronic
1099939085 12:89163602-89163624 CAAATCAGCCTGACTTCTTCGGG + Intergenic
1100665363 12:96746308-96746330 CCTTCCAGCCAGACTCCTTAAGG + Intronic
1101662039 12:106774594-106774616 CCAACCCGCCAGCCTCCGCCCGG - Intronic
1104892555 12:132147528-132147550 CCCCCCAGGCAGACTCCTCCTGG - Intronic
1109128397 13:58547814-58547836 CCTAACATCCAGAATCCTTCTGG + Intergenic
1111038505 13:82711529-82711551 CCAACCAGGTAGACTCTTTGTGG + Intergenic
1113634497 13:111910329-111910351 CCAGCCAGCCAGACGCCTGCAGG + Intergenic
1113699728 13:112375581-112375603 CCAACCAGAGTGACTCCTTTGGG + Intergenic
1120025981 14:79584707-79584729 CAAGCCAGCCAGTCACCTTCAGG - Intronic
1121210856 14:92207221-92207243 CCCTCCAGCCAAACTCCCTCAGG - Intergenic
1122392455 14:101399604-101399626 CCAACCAACCAGAGTTCTTTGGG - Intergenic
1124141315 15:27079615-27079637 GCTTCCTGCCAGACTCCTTCAGG - Intronic
1125792188 15:42375356-42375378 CTGAGCAGCCAGACTCCTTACGG + Intronic
1130046773 15:80451772-80451794 CCAACCAACCAAAATCCTGCAGG + Intronic
1132552235 16:558309-558331 CCTCCCTGCCAGAGTCCTTCCGG + Intergenic
1133446057 16:5862152-5862174 ACGACCTGCTAGACTCCTTCAGG + Intergenic
1133921130 16:10154184-10154206 ACAACCAGCCATGCTCCATCTGG + Intronic
1134462602 16:14442559-14442581 CCAAGTAACCAGTCTCCTTCAGG - Intronic
1138335029 16:56246213-56246235 CCAAGCACCCAGACTGCTTAGGG + Intronic
1140444315 16:75012569-75012591 CCACCCAGTCAGCCTCCTTGTGG + Intronic
1142075569 16:88115715-88115737 CCTTCCAGCCGTACTCCTTCTGG + Intronic
1142075579 16:88115749-88115771 CCTTCCAGCCATACTCCCTCCGG + Intronic
1142196598 16:88742009-88742031 CCAACCAGCAAGCCTCCCTTGGG - Intronic
1142270654 16:89087742-89087764 CCACCCAGCCAGGCTGCTTCTGG - Intergenic
1146696779 17:34914734-34914756 CCAAGTTGCCAGACTCTTTCAGG + Intergenic
1147245349 17:39116653-39116675 CCAACAAGGCAGATACCTTCGGG + Intronic
1147553072 17:41458577-41458599 CCAGCCAGCAAGACCCCTTGAGG + Intergenic
1150624271 17:66831608-66831630 CCAGCCAGGCAGCCTCCTTCTGG - Intergenic
1152193735 17:78903856-78903878 CCAACCACCCAGACTAGGTCAGG - Intronic
1153525014 18:5986680-5986702 CCAACCAGACAGACTCACTCAGG - Intronic
1154341075 18:13502849-13502871 GCTGCCAGCCAGACTGCTTCAGG - Intronic
1154416319 18:14177822-14177844 CCAACCAGCCCTACTGCTGCTGG - Intergenic
1156473188 18:37390218-37390240 ACACGCAGCCACACTCCTTCAGG - Intronic
1161203912 19:3030342-3030364 ACATCCAGCCAGCATCCTTCAGG + Intronic
1162641017 19:12010429-12010451 GCAATCAGCGAGACTCCATCGGG + Intergenic
1162992386 19:14312078-14312100 CCAACACGCCAGGCTCCTTGGGG - Intergenic
1164889985 19:31814975-31814997 CCAATCAATCAGAGTCCTTCTGG + Intergenic
1165244967 19:34493514-34493536 CCTACCACCCAGGCTGCTTCCGG + Exonic
1166158480 19:40933770-40933792 GCAACCACCCTGCCTCCTTCTGG - Intergenic
1166219616 19:41356010-41356032 CCCACCAGGCACACTCCGTCTGG - Intronic
1167548378 19:50142881-50142903 CCAGCCAGCCCCACTCCTCCAGG + Intergenic
1168002836 19:53463238-53463260 CGAAGCACCCAGATTCCTTCTGG + Intergenic
925310105 2:2875979-2876001 CCAACCAGCAAGAATCCAGCAGG + Intergenic
925417371 2:3680082-3680104 CCTACCACCCAGACAGCTTCAGG + Intronic
925535119 2:4908616-4908638 CCAGCCTGCCAGCCTCCTCCAGG - Intergenic
928065543 2:28161112-28161134 TAAACCAGCCAGACGTCTTCAGG + Intronic
931844447 2:66188565-66188587 CCAACCAGGAAGACTACTTTTGG + Intergenic
932803949 2:74767230-74767252 CCAACCAACCTGGCTCCCTCTGG - Intergenic
939899431 2:147833787-147833809 GCAGCCAGCCAGCCACCTTCTGG - Intergenic
940488301 2:154324795-154324817 CCAAGCAACCACACTCCTGCCGG - Intronic
942228425 2:173837141-173837163 GAAACCAGCCAGGCTCATTCGGG + Intergenic
942299994 2:174552015-174552037 CAAAACAGCAAGACTCCGTCTGG - Intergenic
945974102 2:216257586-216257608 CCTAGCAGACAGAGTCCTTCAGG - Intergenic
948355033 2:237371275-237371297 CCCACCAGCCAGACCCCACCAGG - Intronic
948674221 2:239587669-239587691 CCACCCAGCCTGACTCTCTCAGG - Intergenic
949017824 2:241723413-241723435 CCAGCCAGCCACACTCCTTGAGG - Intronic
1173171092 20:40724521-40724543 CCAGCCAGCCAGACATCTCCAGG - Intergenic
1173462014 20:43250762-43250784 CCAACAAGCCAGAATCATTGTGG + Intergenic
1174706840 20:52664978-52665000 CCAAGGAGCCCGACTACTTCTGG - Intergenic
1175205214 20:57306002-57306024 CCAACAAGTCAGGCTCCTTTGGG + Intergenic
1175230498 20:57470746-57470768 ACAACCAGCCAGGCTCCTTCAGG + Intergenic
1175332929 20:58177288-58177310 CCAACCAGCCTGTGTCCTGCAGG + Intergenic
1175642847 20:60645665-60645687 CAAAGCAGCCAGAATCCTTTTGG - Intergenic
1175865765 20:62175505-62175527 CCAGCCACCGAGCCTCCTTCAGG - Intronic
1176234298 20:64047218-64047240 CCAACCTGCCAGCCTCCCTCAGG + Intronic
1176857019 21:13981468-13981490 CCAACCAGCCCTACTGCTGCTGG + Intergenic
1176867578 21:14062755-14062777 CCAACCAGCCCTACTGCTGCTGG - Intergenic
1178122432 21:29482695-29482717 CTTACCAACCAGACGCCTTCAGG + Intronic
1179492060 21:41747012-41747034 CCAAACACACTGACTCCTTCTGG - Intronic
1181636407 22:24176782-24176804 CCAACCAGCCAGACCCCTTGGGG + Intronic
1182267043 22:29125187-29125209 CCACCCTGCCAGGCTCCTTCAGG + Intronic
1182282280 22:29224530-29224552 CCAGGCAGCCAGCCTCCCTCTGG + Intronic
1184302675 22:43571599-43571621 CGAGCCAGCCAGCCTCCTCCAGG - Intronic
950482209 3:13251100-13251122 CCAACAAGCCAGGCACCTGCAGG + Intergenic
953270218 3:41435222-41435244 CCAACCAGCCATGCTCCTGATGG + Intronic
954417351 3:50399795-50399817 CCAACCAGCCAGGCCCCACCTGG - Intronic
954937648 3:54341498-54341520 CCAACCTTCCTGACCCCTTCAGG - Intronic
956322325 3:68010401-68010423 CCAGCCAGCCAGGGTCCTTTAGG + Intronic
960318770 3:116209040-116209062 GCAATCAGCGAGACTCCTTGGGG + Intronic
960547299 3:118930317-118930339 CCAACAGTCCAAACTCCTTCAGG + Intronic
963001730 3:140687981-140688003 CCACCTGGCCAGTCTCCTTCAGG - Exonic
969328254 4:6456622-6456644 CCAGCCAGCCTGTCTGCTTCGGG - Intronic
969437105 4:7194482-7194504 CCAACCAGCCAGCATCTATCAGG + Intronic
975688046 4:76937388-76937410 TCAACCACCCAAACTCCTCCAGG - Intergenic
976812231 4:89110208-89110230 CCAACAAGCCAGTCCCTTTCTGG - Intronic
977709610 4:100110116-100110138 CCAACCAGCCAGATTCTCTCTGG + Intergenic
978275387 4:106943001-106943023 CTAGTCAGCCATACTCCTTCAGG + Intronic
980651264 4:135718116-135718138 CAAACCACCCAGACTCCATATGG + Intergenic
982326804 4:154136931-154136953 CAACCCAGCCAGACTCCTCTCGG + Intergenic
982361636 4:154524951-154524973 CCCAGCATCCAGCCTCCTTCAGG - Intergenic
983918167 4:173314604-173314626 CCAACCAGTCTGAGTGCTTCAGG + Intronic
986389444 5:7270087-7270109 CCACACAGCCAGAAGCCTTCTGG - Intergenic
986600967 5:9472571-9472593 CCAACCCCCAAGCCTCCTTCAGG - Intronic
994054795 5:95402975-95402997 CCAACCTGCCAAGCTGCTTCTGG + Intronic
994452086 5:99955828-99955850 ACACCCAGCCAGACTCCTCCTGG + Intergenic
996578033 5:124998334-124998356 CCATCCAGCTAGATTCCTTTTGG + Intergenic
996815269 5:127567075-127567097 TCTACCAGCCTGGCTCCTTCCGG - Intergenic
996920852 5:128765847-128765869 CCAGCCACCCAGACTCCTGCTGG + Intronic
998741279 5:145204981-145205003 CCACACAGCCAGGCTCCTCCTGG - Intergenic
1000005656 5:157181787-157181809 CAAAGCAGCCATACTCCTTCTGG - Intronic
1000960719 5:167597584-167597606 CCCACCACCCTGACTCCTTATGG - Intronic
1001737660 5:174020026-174020048 GCAATCAGCGAGACTCCTTGGGG + Intergenic
1002136688 5:177112139-177112161 ACCACCAGCCAGGGTCCTTCAGG - Intergenic
1002931205 6:1636571-1636593 CCAACCTTCCAGGCACCTTCAGG - Intronic
1003042424 6:2700461-2700483 CTTACCAGCCAGGCTCCCTCTGG + Intronic
1004469227 6:15914146-15914168 CCACCCAGCCATTCTGCTTCTGG + Intergenic
1005740339 6:28785412-28785434 CAACACAGCAAGACTCCTTCTGG - Intergenic
1014094526 6:117445686-117445708 CCAACCAGCCAGACTCCTTCTGG + Intronic
1019120156 6:169795764-169795786 CCAACTAGACAGACTCCCACTGG - Intergenic
1022812344 7:33882222-33882244 CCAACATGCCAGAATCCTTTTGG - Intergenic
1028821795 7:95220193-95220215 CCAACCATCCAGAGGCCTTTCGG - Intronic
1029243556 7:99182029-99182051 CCATCCAGACAGCCTCTTTCTGG + Exonic
1029493348 7:100884160-100884182 CAAACCAGCCAGTCTCCATGAGG - Exonic
1031631309 7:124046561-124046583 CCATCCACCCATATTCCTTCTGG + Intergenic
1034266857 7:149785301-149785323 CCCACCACCCCGACCCCTTCTGG - Intergenic
1035977594 8:4330247-4330269 ACAACCAGACAGAGTCCTACTGG - Intronic
1036649720 8:10634639-10634661 CCAATCACCCAGGCTCCTGCTGG + Intronic
1038111597 8:24505823-24505845 CTAACCAGCCACATTCCTTTGGG - Intronic
1044177767 8:89151303-89151325 CCAGCCACACAGACTTCTTCAGG - Intergenic
1045423761 8:102042672-102042694 ACTACCAACCAGACTCCTTGGGG + Intronic
1049021074 8:139958039-139958061 CAAACCAGCCAGACCCCTTGTGG + Intronic
1050414568 9:5402506-5402528 CCTACCCTCCAGACTCCTGCTGG + Intronic
1057794072 9:98143230-98143252 CCCACCCGCCTGACTCCTCCTGG - Intronic
1060997350 9:127882722-127882744 CCCACCAGCCAGGCTCCCTGGGG - Intergenic
1062479416 9:136744500-136744522 TCAGCCTGCCTGACTCCTTCAGG + Intronic
1062591522 9:137276801-137276823 CCAACCAGACAGGCTCCATCAGG - Intergenic
1187823004 X:23308331-23308353 CCATCCAGCCACACTCCTCTGGG - Intergenic
1189376979 X:40474158-40474180 CCATGCAGCCAGGCTCCTGCTGG + Intergenic
1193883801 X:86960321-86960343 CCCACCAGCCCTGCTCCTTCTGG - Intergenic
1197588102 X:128374361-128374383 CCAAACATACAGACTCTTTCTGG + Intergenic
1199013831 X:142789472-142789494 CAAACGTGCCATACTCCTTCAGG - Intergenic