ID: 1014096192

View in Genome Browser
Species Human (GRCh38)
Location 6:117464787-117464809
Sequence GTGAACATACAGAAGAACAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 0, 3: 42, 4: 297}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014096188_1014096192 18 Left 1014096188 6:117464746-117464768 CCACAGAGCGAATTAAGAGGGTT 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1014096192 6:117464787-117464809 GTGAACATACAGAAGAACAAGGG 0: 1
1: 0
2: 0
3: 42
4: 297
1014096187_1014096192 19 Left 1014096187 6:117464745-117464767 CCCACAGAGCGAATTAAGAGGGT 0: 1
1: 0
2: 0
3: 5
4: 42
Right 1014096192 6:117464787-117464809 GTGAACATACAGAAGAACAAGGG 0: 1
1: 0
2: 0
3: 42
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014096192 Original CRISPR GTGAACATACAGAAGAACAA GGG Intronic
905213517 1:36390833-36390855 GGGAACATCAAGATGAACAAGGG - Intergenic
907172355 1:52480174-52480196 ATGTACATACACAAGAAAAAAGG + Intronic
908471383 1:64447292-64447314 GAGAAAATAAAGAAGAAAAATGG - Intergenic
908685171 1:66709625-66709647 GTGAGAATACAGAGGAAAAAGGG - Intronic
909221714 1:72971504-72971526 GAGAACATACTTAAGAACATGGG + Intergenic
909288351 1:73849990-73850012 GTTAATACAGAGAAGAACAATGG + Intergenic
909837732 1:80277663-80277685 GTGAAAAGACAATAGAACAAGGG + Intergenic
910097284 1:83538211-83538233 GTGTAGATACAGAAGAAAAGAGG + Intergenic
910097516 1:83540303-83540325 GTGTAGATACAGAAGAAAAGAGG - Intergenic
910135607 1:83965369-83965391 CAGAAGAGACAGAAGAACAAAGG - Intronic
910763966 1:90762135-90762157 GTGGCCAAACAGCAGAACAATGG + Intergenic
911951457 1:104178095-104178117 CTGAATATTCACAAGAACAATGG - Intergenic
915694912 1:157730099-157730121 GAGAACATACAGAAGAAGAGTGG + Intergenic
917554946 1:176075219-176075241 GCCAACATACAGAAAAATAAAGG + Intronic
918539323 1:185611525-185611547 GTAAACATATAGAAGAAAACTGG - Intergenic
918678354 1:187319204-187319226 GTAAACATTCAGAAGAAAACTGG - Intergenic
918734789 1:188046726-188046748 TTGAACCTAAAGAAGAAAAAGGG + Intergenic
919061258 1:192635678-192635700 GTTAACAAACTGTAGAACAACGG + Intergenic
920272151 1:204773760-204773782 CCGAACATTCAGAACAACAAAGG - Intergenic
923937558 1:238780185-238780207 GTGAACACACAGTAGAGAAAAGG + Intergenic
924160808 1:241229855-241229877 CTGAACATAAAGAATAGCAATGG + Intronic
924574476 1:245267281-245267303 GTATACATTCAGAATAACAAAGG + Intronic
924872607 1:248064993-248065015 GTGGTCATTAAGAAGAACAACGG + Intronic
1062887477 10:1028673-1028695 GTGATGATAGAGAAGAAAAAGGG - Intergenic
1062987187 10:1779911-1779933 CTGAACATTGAGAAGAACAGAGG + Intergenic
1063230114 10:4057626-4057648 GTGTACACACAGACAAACAAAGG + Intergenic
1063642044 10:7839609-7839631 GGGCACAGATAGAAGAACAAAGG + Intronic
1064937443 10:20693795-20693817 GTAAAGAAACAGAAGAAAAAGGG - Intergenic
1066082248 10:31943028-31943050 GCAAACATACAGGAGAACGAAGG - Intergenic
1066141913 10:32512705-32512727 GTGCTCATACAGTAGAAAAAAGG + Intronic
1068227056 10:54118865-54118887 GTGAACTTTAAGAAGAAAAACGG + Intronic
1068291378 10:55005644-55005666 ATGAACTTACAGAAGAATAGAGG - Intronic
1070777473 10:79118258-79118280 GTGAACAAACAGAAAAACATGGG - Intronic
1071173966 10:82901575-82901597 GTGATCCTCCAGAAGAATAATGG + Intronic
1071998014 10:91165182-91165204 GTTAACCTACAGCACAACAAGGG + Intronic
1073417412 10:103396035-103396057 ATGGACATACAGAAGAAAAGAGG + Intronic
1076565961 10:131399489-131399511 GTGAAGGTACAGGAGAACAAAGG + Intergenic
1077127332 11:946906-946928 GTGAAGAAATAAAAGAACAACGG + Intronic
1077986232 11:7354100-7354122 GTGAACATAAAGATGGACACAGG - Intronic
1080300039 11:30773978-30774000 ATGAATATACAGAAGAGCCAAGG - Intergenic
1080694983 11:34595649-34595671 GTGTACACACAGAAGAAGGAAGG - Intergenic
1080971354 11:37280781-37280803 GTGAAGATACAGAAGAGAGAAGG - Intergenic
1080999164 11:37646128-37646150 ATGAACATAGAGAAAAACATTGG + Intergenic
1082128568 11:48459835-48459857 GGGAAAATACATAAGGACAAGGG - Intergenic
1085169945 11:74441277-74441299 ATAAACATGCAGAAAAACAAAGG + Intergenic
1085200271 11:74697646-74697668 GAGAACAGACAGAAGAAAACAGG - Intronic
1087882706 11:103437361-103437383 ATGAAAAGACAGAAGAACAAGGG - Intronic
1088463810 11:110112001-110112023 GTGAACATACACAAGCATAGAGG + Intronic
1089963081 11:122633250-122633272 GTGTACATACAGAAGACAATGGG - Intergenic
1095480328 12:42628310-42628332 TTGATCGTACAGAAAAACAATGG - Intergenic
1096887218 12:54730135-54730157 GTCAACATACTGAACAACAATGG - Intergenic
1096887502 12:54732306-54732328 CTGAACATGCAGAAAAATAATGG - Intergenic
1098024082 12:66184579-66184601 GTGCAGATAGAGAAGAACCATGG + Intergenic
1098990013 12:77055470-77055492 CTGAACATATATAAGAATAATGG + Intronic
1099675913 12:85759920-85759942 GAGAACCAACAGAAGAAAAATGG + Intergenic
1099718852 12:86335381-86335403 GTAAACATAAAGAAAAATAATGG + Intronic
1100541194 12:95559125-95559147 TTGATAATACAGAAGAAAAAAGG - Intergenic
1103735320 12:123057439-123057461 AGGAACATTCAGAAGAACTAAGG + Intronic
1104576390 12:129970367-129970389 GTTAACATCCAGAATAAAAAAGG + Intergenic
1106389135 13:29318431-29318453 CTGAACATAAACAAGAATAACGG - Intronic
1106428201 13:29654107-29654129 GTGAGCAGACAGAAGAGGAATGG + Intergenic
1106866309 13:33967994-33968016 GTGAATTTACAGAAAGACAAAGG + Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107027138 13:35813778-35813800 GTGAACATAAAGAGGTTCAAGGG + Intronic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107729372 13:43332838-43332860 ATGTATATACAGAAGAAAAAAGG + Intronic
1108173091 13:47763829-47763851 ATGAACCTACAGAAGAAGAATGG + Intergenic
1108337344 13:49458585-49458607 GAGAACATACAGAATAAGAAGGG - Intronic
1109805234 13:67430925-67430947 GTCAACATCAAGAATAACAAAGG - Intergenic
1110050049 13:70885529-70885551 GTAAACTTACAAAAGAAAAAGGG + Intergenic
1110775356 13:79403028-79403050 AGGAACATACAGAGGACCAAGGG - Intronic
1112347738 13:98604978-98605000 GTGAAAATACAGAAGAAAATGGG + Intergenic
1113019947 13:105873742-105873764 ATAAACATACAGATAAACAAAGG + Intergenic
1114731827 14:25001042-25001064 GTGAACCTTCAGAGGAAAAAGGG + Intronic
1115984133 14:39086003-39086025 CTGAACACACAGCAGACCAATGG + Intronic
1118235718 14:64003619-64003641 GTAAACACACAGAAGGACAAGGG - Intronic
1119931225 14:78549345-78549367 GTGAACAAAGAGAAGGAGAAGGG - Intronic
1120003471 14:79330198-79330220 GTTAATAGACAGATGAACAAGGG + Intronic
1120655700 14:87187429-87187451 GTGAACAAATGGAAGAAGAAAGG + Intergenic
1121613302 14:95295632-95295654 GAAAACATACACAAAAACAAAGG + Intronic
1121862311 14:97329850-97329872 GTCAACAAACAGAAAAAGAATGG - Intergenic
1122255589 14:100473434-100473456 GTGAACAAACAGGGAAACAATGG + Intronic
1122656389 14:103263305-103263327 ATGAACACACAGAAATACAAAGG - Intergenic
1124185059 15:27517664-27517686 GCTAACATACAGAAAAACAAAGG - Intronic
1124219719 15:27839203-27839225 GTGAAAAAGCATAAGAACAAAGG + Intronic
1124604290 15:31159494-31159516 GTGAACTTACACAAGAACATGGG + Intronic
1125003947 15:34797231-34797253 GTGAAAATATAGAAAAACCAAGG + Intergenic
1126718028 15:51542969-51542991 ATGAAAATACAGAATAACAAGGG + Intronic
1127001418 15:54512052-54512074 GCGCACACACAGAAGACCAAAGG - Intronic
1127453010 15:59134768-59134790 AAGAACATACAGAAGATCAAGGG - Exonic
1127666364 15:61151395-61151417 GAGAAGGTACTGAAGAACAAAGG - Intronic
1128785685 15:70395236-70395258 GGGAACAGACAGAAGGACACAGG + Intergenic
1130288306 15:82573403-82573425 GTGAACATAGAGAAGCAGGAGGG - Intronic
1130635768 15:85618468-85618490 GTGAAGAAACAAAAGAAAAAGGG - Intronic
1130649949 15:85756760-85756782 GTGATGATCCAGAAGAACCAAGG + Intergenic
1131394559 15:92076378-92076400 CTGAACATGCAGCAGAACATAGG - Intronic
1136645861 16:31614282-31614304 GTGAACAAACATACGAAAAAAGG + Intergenic
1137256989 16:46783888-46783910 CTGACCATACAGAAACACAAAGG + Intronic
1138817400 16:60218159-60218181 GGGCACATAGAGAAGAAAAAGGG - Intergenic
1141256322 16:82405631-82405653 GTTAACATACAGAACAAAGAAGG - Intergenic
1141937454 16:87250926-87250948 GTGAACACACAGAAGTGCCAAGG + Intronic
1143531790 17:7509357-7509379 GAGAACATTCAGAAGAGAAAGGG - Intronic
1143812779 17:9485927-9485949 GAGAAAATACAGAAAAACAGAGG + Intronic
1144278592 17:13701169-13701191 GGGAACATACAGGAGAAAAATGG - Intergenic
1144624255 17:16836741-16836763 GTGAGCATAGAGAAGCCCAATGG + Intergenic
1145113636 17:20187863-20187885 GTGAAGATTTAGAAGACCAATGG + Intronic
1145994749 17:29098917-29098939 AAGAACATCAAGAAGAACAAAGG - Exonic
1148565942 17:48633149-48633171 GGGAACAAACAGAGGAAGAATGG + Intronic
1148880893 17:50726110-50726132 ATGAAAATACACAAGAACCAAGG - Intronic
1149952896 17:61010185-61010207 GTGAACAGAGAAAATAACAATGG - Intronic
1150357911 17:64504288-64504310 GGAAACATACAGAAGAAGCAAGG - Exonic
1151058766 17:71065775-71065797 GTCAACATAAAGAAGAAAACTGG - Intergenic
1151091749 17:71447879-71447901 GTCAACAAACAGAAGCAAAAAGG - Intergenic
1151103479 17:71583844-71583866 GTGAACATATATAAGAAGTAAGG + Intergenic
1153434570 18:5055680-5055702 ATGAACATACGGAAAAACACAGG - Intergenic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1155776189 18:29765099-29765121 CTGAACGTGCAGAAGAGCAAGGG - Intergenic
1156501587 18:37563469-37563491 GAGGACATTCAGAATAACAAAGG + Intronic
1156966075 18:43094182-43094204 TGGAAGATACAGAAGATCAAGGG + Intronic
1157319749 18:46624812-46624834 GAGAAAAGACAGAAGAAGAAAGG - Intronic
1158053415 18:53251194-53251216 GTGAACAGACAGAATCACAGAGG - Intronic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158324538 18:56299886-56299908 TTGAACATAGAGTAGTACAAAGG - Intergenic
1158487272 18:57878687-57878709 ATGAAGACACAGAGGAACAATGG + Intergenic
1158886884 18:61836767-61836789 GGAAACATACAGAAAAAGAAGGG + Intronic
1159794642 18:72827192-72827214 TTAAACATACAGAATAAAAAAGG - Intronic
1160439857 18:78881348-78881370 TTGAATATAGAGAAGTACAAAGG - Intergenic
1160611965 18:80095867-80095889 GTGAATATACAAATGAACAATGG + Exonic
1162260251 19:9527427-9527449 GTGAAAATAGAGGAGAAAAAAGG - Intergenic
1164024280 19:21336529-21336551 GTGCTCATTCAGAAGAACAATGG + Intergenic
1165009847 19:32836901-32836923 ATGAATATACAGAAAAACAGGGG - Intronic
1165650252 19:37481581-37481603 TTGAAAATACAGAATAACCAGGG - Intronic
925682923 2:6442042-6442064 GTGAACAGACAGAAGGGGAATGG - Intergenic
926553735 2:14332197-14332219 ATGAACAGAGAGAAGAAGAATGG - Intergenic
927439686 2:23104543-23104565 GTGAACATCCTGAAGATCCAGGG - Intergenic
927670585 2:25065708-25065730 GTGAATTTCCAGAAGAAAAATGG - Intronic
928582135 2:32719523-32719545 GTGGTCATAAAGAAGAACATTGG + Intronic
928680632 2:33699066-33699088 GTAAACAGACAGAAGAGAAAAGG + Intergenic
929183670 2:39070455-39070477 GTGAACATACAAGAGTAGAAGGG - Intronic
929318776 2:40514360-40514382 GTGGGCAAACAGAAGGACAAAGG + Intronic
930821027 2:55647165-55647187 GTGAACATGCAGAGGAGGAAGGG + Intronic
931078025 2:58738253-58738275 GTGTACATACAGAATGACAAAGG - Intergenic
931789090 2:65647530-65647552 GTGAACAATCAGAATAACAGTGG + Intergenic
932438094 2:71715059-71715081 GTGGACATCCAGGGGAACAATGG - Intergenic
932816287 2:74864805-74864827 GTGAACATATAGAAACACACAGG - Intronic
932971587 2:76549776-76549798 CTGAATATACAAACGAACAATGG - Intergenic
933061022 2:77736489-77736511 TTGAACATACAGAAGAAAATAGG - Intergenic
933522865 2:83394800-83394822 TTGAACATACAAAAGGGCAATGG + Intergenic
933527621 2:83463391-83463413 TTGGACATACAGAACAACTATGG - Intergenic
933849898 2:86357688-86357710 GTGAACATAAAGGTGTACAAAGG + Intergenic
934776265 2:96939517-96939539 ATGAACAAACAAAAAAACAAAGG + Intronic
935543095 2:104372743-104372765 GACTACATACAGATGAACAAAGG - Intergenic
935801919 2:106706322-106706344 GTGAACCTTCAGAGGAAGAATGG - Intergenic
935930432 2:108118201-108118223 CTGAATATACATATGAACAAGGG - Intergenic
935984312 2:108658060-108658082 GTGAAAATTCAGGAGAACATTGG + Intronic
936022855 2:109008197-109008219 GTGAAAATACAGAAGCACATAGG - Intergenic
936136750 2:109901708-109901730 GTGAAAATTCAGGAGAACATTGG + Intergenic
936207947 2:110469777-110469799 GTGAAAATTCAGGAGAACATTGG - Intronic
936699920 2:114999128-114999150 CTGAAGATACAGCAAAACAAAGG - Intronic
937511386 2:122599082-122599104 GTGAACCTTCAGAGGACCAATGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
937946011 2:127337737-127337759 TTGAACATAGAGGAGAAAAAAGG - Exonic
939318548 2:140584637-140584659 GTGTTCTTACAGAAGAATAATGG - Intronic
939988189 2:148852831-148852853 GTGAACAGTCAGAAGAGTAAAGG - Intergenic
940176121 2:150879297-150879319 CTGAACATTCAGAAGTGCAAAGG + Intergenic
940262763 2:151799889-151799911 ATGAAGATACAGGAGAGCAAAGG + Exonic
940390146 2:153123010-153123032 GTGAAGATACAGAAGACCCAGGG + Intergenic
940390153 2:153123044-153123066 GTGAAGATACAGAAGACACAGGG + Intergenic
941248292 2:163129193-163129215 GAGAACATACTGAGGAACCATGG + Intergenic
942718453 2:178921862-178921884 CTGAACAGACAGAAGAAGAAAGG - Intronic
942993220 2:182228269-182228291 ATTAACAAACAGAAGGACAATGG + Intronic
943481367 2:188422834-188422856 GTGACCATACATGAGAACAGTGG + Intronic
943527413 2:189034413-189034435 GGGAAGCTGCAGAAGAACAAAGG - Intronic
944016535 2:195046337-195046359 CTTAACATATAGAAGCACAATGG - Intergenic
944225033 2:197341148-197341170 GACAAAATACAGAAGGACAAAGG - Intergenic
945289951 2:208117040-208117062 GTGTACACACAGATGATCAAGGG + Intergenic
945731613 2:213544144-213544166 GGGACCATATAGAAGAAAAAAGG - Intronic
945744524 2:213704048-213704070 GAGAACAGCCAGAAGAACAAGGG - Intronic
945805449 2:214484547-214484569 GTGATCATACGGCAGAACAATGG + Intronic
948164664 2:235851694-235851716 ATGAACAGAAAGAAGAAGAAGGG + Intronic
1170016587 20:11788735-11788757 GTGAAACTACAGCAGACCAAAGG - Intergenic
1170319610 20:15080562-15080584 GCGAAGATACAGAAGAAAAAGGG - Intronic
1170479427 20:16751227-16751249 GTTACCTTACAGAAGAGCAAGGG + Exonic
1171127985 20:22621270-22621292 GGGAAAATACAGAAGTTCAAAGG - Intergenic
1173415010 20:42847391-42847413 CTGGCCATACAGAAGACCAAGGG + Intronic
1173791382 20:45829905-45829927 TTGAATAAACAAAAGAACAAAGG - Intronic
1174545811 20:51324362-51324384 GTGCACACACAGAAAAACAATGG + Intergenic
1175018401 20:55817073-55817095 TTTAAGATCCAGAAGAACAATGG + Intergenic
1176927025 21:14762992-14763014 GTAAACATAGAGAGGAAGAAAGG - Intergenic
1178332826 21:31714593-31714615 GTGAAGATAAAGAAGAACGAGGG + Intronic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1182087649 22:27572501-27572523 GTGAAGATCCAGAAGAACTGAGG + Intergenic
949309509 3:2680798-2680820 GTAAAAATACAGAGGAATAAAGG + Intronic
949947166 3:9199463-9199485 GTGAACAAAGAAAAAAACAAAGG - Intronic
951097953 3:18653505-18653527 GTGAACCTGCAGAAGAACTTGGG - Intergenic
951589631 3:24249413-24249435 GTGAAAATACTAGAGAACAAGGG - Intronic
953376054 3:42429445-42429467 GTGAACACCCAGGAGAACAGCGG - Intergenic
954605194 3:51904154-51904176 ATGAATATAAAGAAGAAAAAAGG + Intergenic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956265339 3:67390229-67390251 GTGACCATTCAGAAGATCCAGGG + Intronic
957558527 3:81792052-81792074 GTGGAAATACAGCAGAAAAAGGG - Intergenic
958050489 3:88337875-88337897 GTGAAAATACAGGATAAAAAGGG + Intergenic
960726157 3:120672418-120672440 GACAAAATACAGAAGGACAACGG + Intronic
962995198 3:140620463-140620485 GTGAACATACATAATCAGAAAGG + Intergenic
964154407 3:153566700-153566722 GTGAAAATACAAAACAACAAAGG - Intergenic
964873426 3:161338327-161338349 GTGACCAGACAGAATAAAAAGGG - Intergenic
965247482 3:166292166-166292188 CTGAACATCCAGAGGAACAGAGG - Intergenic
965380275 3:167979950-167979972 GTAAACATGGAGATGAACAAAGG - Intergenic
965516516 3:169627754-169627776 GTTAAAATTAAGAAGAACAAAGG - Intronic
966455675 3:180113318-180113340 ATGAACAGACATTAGAACAAGGG - Intergenic
968791820 4:2670159-2670181 GTGAACTTGAAGAAGAGCAATGG - Intronic
969161664 4:5264957-5264979 ATGAACATAAAGAAGAAAAATGG - Intronic
969963123 4:10966478-10966500 GACAACATCCAGAAGAAAAAAGG + Intergenic
970438631 4:16060166-16060188 CTGAAAATTCAGAAGTACAAAGG - Intronic
970759304 4:19465057-19465079 GAGAACATACCCATGAACAATGG + Intergenic
974300201 4:60054910-60054932 GTATAAATACAGAAGAAAAAGGG + Intergenic
975616209 4:76250321-76250343 GTGAACAAACATATGAAAAAAGG - Intronic
978180556 4:105789903-105789925 GAGAAAATTCAAAAGAACAATGG - Intronic
978568247 4:110107965-110107987 GTAAACTTTCAGAAGAAAAAGGG + Intronic
979003271 4:115255201-115255223 GTGAACAAATAGAAAAGCAAGGG - Intergenic
979865729 4:125750916-125750938 GTGAACATATAAGAGAAGAAAGG + Intergenic
980477847 4:133342634-133342656 TTGAACATCCAGTAGATCAAAGG - Intergenic
981008867 4:139903946-139903968 GTGAAAACACAGAAGAGCAAAGG + Intronic
981124434 4:141089665-141089687 GTGAAGGTACAGAAGACCACTGG + Intronic
981175160 4:141674098-141674120 GTAAGCATACAAAAGCACAAGGG - Intronic
981949183 4:150385583-150385605 ATGAACAGACAGAGGAAGAAGGG + Intronic
983139608 4:164133431-164133453 GTGAACTTGCACAAGAAAAATGG + Intronic
984438689 4:179737451-179737473 GAGAAAATTCTGAAGAACAATGG - Intergenic
985184331 4:187299272-187299294 TTAAACATACAGAGAAACAAAGG + Intergenic
986144304 5:5063079-5063101 GTGCACATACAGAGGCACACGGG + Intergenic
986309256 5:6539498-6539520 GAGAACAAATAAAAGAACAAGGG - Intergenic
986542697 5:8863758-8863780 GCAAACAAACAGAAGAACAGAGG + Intergenic
986949389 5:13063498-13063520 ATGAGCCTACAGAAGAGCAAAGG + Intergenic
987063107 5:14261470-14261492 GCTAACATTCAGAAGAACAAAGG + Intronic
987119872 5:14756885-14756907 GGGAACTTACAGAAGAAACATGG + Intronic
987567248 5:19606562-19606584 CTGAACAAACAGCAGAAGAAAGG + Intronic
988123036 5:26992413-26992435 GTGAAGACACAGCAGAACAATGG + Intronic
988436856 5:31186031-31186053 GTGAACATGCAGAGGAGTAATGG + Intergenic
988961038 5:36372038-36372060 GTGAACCTACAGCAGATAAAAGG - Intergenic
989238836 5:39180314-39180336 GTGAAAATGGAAAAGAACAAAGG - Intronic
990272735 5:54161968-54161990 GTGTAAGTAAAGAAGAACAAAGG - Intronic
990598669 5:57335770-57335792 GTGAATTTACAGAGAAACAAAGG + Intergenic
992853535 5:80836491-80836513 GAGAACACACAGAGGAATAAAGG + Intronic
994379248 5:99051683-99051705 GTGAACACATTCAAGAACAAGGG - Intergenic
994898463 5:105737958-105737980 GTGATCATACAGCAGAAACAGGG + Intergenic
995747192 5:115416253-115416275 GTGTCCATACAGAGGACCAAGGG - Intergenic
996245016 5:121252161-121252183 GTAAGAATACAAAAGAACAAAGG + Intergenic
997306365 5:132839847-132839869 GTGAAAATAAACAAGAACAAAGG - Intergenic
998674512 5:144391996-144392018 GTGAATTTACAGAGGAAGAAAGG + Intronic
1002758886 6:186562-186584 CTGAAAACACAGAAGTACAAAGG + Intergenic
1003215358 6:4104479-4104501 ATGATAACACAGAAGAACAAAGG + Intronic
1005839702 6:29734507-29734529 TTCTACTTACAGAAGAACAAGGG + Intronic
1006286369 6:33097499-33097521 GTGAACAGACCGAAGACCACTGG - Intergenic
1008541125 6:52547224-52547246 TTGGACATGCAGAAAAACAAGGG + Intronic
1008596310 6:53045309-53045331 TTGAAGATAAAGAAGAAAAAGGG - Intronic
1008842631 6:55921992-55922014 AGGAGCATACAGAAGAACTAGGG + Intergenic
1008875163 6:56318211-56318233 GAGAATATAAAGAAGAAGAAAGG - Intronic
1008879911 6:56371526-56371548 GTGAACAGGCAGAAGAGGAAAGG - Intronic
1009504200 6:64454152-64454174 GCCAAAATACAGAAGAACAAAGG - Intronic
1010541657 6:77099329-77099351 GTGTACATACTGAAGACAAATGG - Intergenic
1012140425 6:95620119-95620141 AAGAATATACTGAAGAACAAAGG + Intergenic
1012914684 6:105156769-105156791 GTGTAGATTCAGAAGAAAAATGG - Intergenic
1014096192 6:117464787-117464809 GTGAACATACAGAAGAACAAGGG + Intronic
1014488553 6:122033001-122033023 GTGAAAATAAATAGGAACAAAGG - Intergenic
1015114225 6:129629372-129629394 GAGAAAATCCAGAAGAGCAAAGG - Exonic
1015716039 6:136192877-136192899 GAAAACATACAGATGAACATGGG - Exonic
1015725786 6:136297981-136298003 TAGAAAATACAGAAGAGCAAAGG - Intergenic
1016458562 6:144258056-144258078 GTGAACAGAGACAAGTACAAAGG + Intergenic
1016778441 6:147932182-147932204 GTAAACAAACTGAAGTACAAAGG + Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017209394 6:151838186-151838208 GTGATGGTACAGAAAAACAAAGG + Intronic
1017381186 6:153831951-153831973 ATGAACAGACAGAAAAACAATGG - Intergenic
1017628069 6:156368253-156368275 GGGAACATAAAGGACAACAAAGG + Intergenic
1018870944 6:167781669-167781691 GTGAACATCCAGAAGAGAGAAGG + Intergenic
1019972592 7:4553412-4553434 GTAAACATCCAGAAGCTCAAAGG + Intergenic
1021118386 7:16769743-16769765 GTGTAAATACAAAATAACAATGG - Intronic
1021674936 7:23070832-23070854 GTGAACTGACAGTAGTACAATGG + Intergenic
1021736639 7:23645761-23645783 GAGAATATAGAGAAGCACAATGG + Intergenic
1021809667 7:24391134-24391156 GTGAAGATAGAGAAGAAAAGAGG - Intergenic
1022213313 7:28233254-28233276 GTGCAAATTTAGAAGAACAAGGG - Intergenic
1023140381 7:37096042-37096064 GAGTACATACAGAAAAAGAAAGG - Intronic
1023322611 7:39014393-39014415 GTGAACATACTGAAAAAGAAGGG + Intronic
1024324128 7:48095481-48095503 GGGAAGTTACAGAGGAACAAAGG - Intronic
1024923084 7:54581500-54581522 GTGAAAAAACAGAAAAAAAAAGG + Intergenic
1027550854 7:79593051-79593073 GTGAAACTGCAGAATAACAAAGG - Intergenic
1027795825 7:82691991-82692013 GTGAAAATACAGGAGAATGAAGG + Intergenic
1028580763 7:92407765-92407787 GTGAGCATGCAGAAGAAAAAGGG - Intergenic
1030634675 7:111935430-111935452 GTGAATAGACAGAAAAACAAAGG + Intronic
1030826058 7:114159749-114159771 GTGAACCTTCAGAAGGCCAAGGG - Intronic
1031200688 7:118681204-118681226 GTGAAAAACCAGAAGAAAAAAGG + Intergenic
1033222456 7:139537468-139537490 GGAAACATATAGAGGAACAATGG + Intronic
1033621499 7:143065844-143065866 GTGGACATATAGAAGAACAGAGG - Intergenic
1033662311 7:143410565-143410587 TTGAACATACAGAAACAAAATGG + Intergenic
1036059024 8:5294257-5294279 CTGAAGATTCAGGAGAACAAGGG - Intergenic
1036078977 8:5532228-5532250 GTGAACAAACAGAAGAAATGAGG - Intergenic
1036114045 8:5939032-5939054 GTGAGTAAACAGAAAAACAAAGG + Intergenic
1037446313 8:18969611-18969633 ATGAACATTCAAAAGATCAAGGG - Intronic
1038690309 8:29755596-29755618 GTGAAACTCCAGAAGAACAAGGG + Intergenic
1040601453 8:48888405-48888427 GTGAAAAAACAGAAGAACAGAGG - Intergenic
1040968241 8:53106167-53106189 GTGAACATACAGAATATACAGGG - Intergenic
1043998273 8:86845455-86845477 GTGAGCACACAGAAAAACACAGG + Intergenic
1044261824 8:90133940-90133962 ATCATCATACAGAATAACAATGG + Intergenic
1045028420 8:98111912-98111934 GAATACATAAAGAAGAACAATGG - Intronic
1045444255 8:102243490-102243512 TTGAACATACACAAAAATAATGG - Intergenic
1049841441 8:144775509-144775531 GTGTTCATACAATAGAACAATGG + Intronic
1050379597 9:5013062-5013084 GTGAAAAAAGAGAAGAATAAAGG + Intronic
1050713002 9:8487427-8487449 GTTAACAGAAAGAAGAAGAAAGG + Intronic
1050860109 9:10418138-10418160 GTGAAAATAAAGAAGCATAATGG + Intronic
1050980266 9:12002533-12002555 CTGAAAATACAGAAGAATAGTGG + Intergenic
1051439025 9:17063256-17063278 GTGAGCATATAGCAGAAAAAGGG + Intergenic
1052044583 9:23779307-23779329 GTGGGCAGACAGAGGAACAAAGG + Intronic
1053224596 9:36342699-36342721 GTCCACATACAAAAGAATAAAGG + Intronic
1053325876 9:37150458-37150480 GTCACCATAGAAAAGAACAATGG - Intronic
1053349710 9:37405158-37405180 GTGAACCTTCAGAAGGAAAAGGG - Intergenic
1055531001 9:77183715-77183737 GTAAACATGTAGAAGCACAATGG - Intronic
1056210776 9:84363179-84363201 ATGTAAATAAAGAAGAACAAGGG + Intergenic
1056911993 9:90709492-90709514 GTGAAACAACAGGAGAACAAAGG + Intergenic
1058204246 9:102083435-102083457 TTGATCACACAGTAGAACAAGGG - Intergenic
1059621939 9:116015447-116015469 GTGAACATTCAGAATGATAATGG - Intergenic
1060424237 9:123491573-123491595 GTCAACAGAAAGAAGAAGAAGGG + Intronic
1060540625 9:124427828-124427850 GTTAAGATAGAGAAGAAGAAAGG - Intergenic
1187848651 X:23567708-23567730 GTGATCATAGTGAAGAACCATGG + Intergenic
1187878927 X:23828371-23828393 GAGAACACATAGAAGAACAAGGG - Intergenic
1188295408 X:28441198-28441220 TTGAATATACAAAGGAACAAGGG - Intergenic
1188437903 X:30183822-30183844 GTGAACTTGCAGAAGTACCATGG - Intergenic
1189279919 X:39813828-39813850 GTGGACTTACAGCAGAACACTGG - Intergenic
1190210959 X:48447494-48447516 CTGAAAATACAGAAAAAAAATGG - Intergenic
1190231901 X:48588654-48588676 GTGAAACGACAGAAAAACAAAGG - Intergenic
1190754596 X:53390687-53390709 GTGAGCATCAAGAAGAAAAATGG + Intronic
1192555470 X:72085661-72085683 GTGATCATACAGAAAATCAGAGG - Intergenic
1194911807 X:99654683-99654705 GTGAACAAACAATAGAAAAAAGG - Intergenic
1195343870 X:103929043-103929065 GGGAAGATTCAGAATAACAAAGG - Intronic
1195453271 X:105039568-105039590 GAGAACATACAGAAAAAGAGAGG + Intronic
1196314381 X:114205397-114205419 TTGAACCTACAGAGGACCAAGGG + Intergenic
1197014720 X:121609613-121609635 GTAAATATAAACAAGAACAAAGG + Intergenic
1197332031 X:125164982-125165004 GAAAACATCCAGAAGGACAAAGG + Intergenic
1201650666 Y:16282339-16282361 GTGAGGAGACAGAAGAAAAATGG - Intergenic
1201691948 Y:16777190-16777212 GTGAGGAGACAGAAGAAAAAGGG - Intergenic
1201945982 Y:19510491-19510513 CTGAACAAACAGAACAAAAAAGG + Intergenic