ID: 1014098182

View in Genome Browser
Species Human (GRCh38)
Location 6:117482597-117482619
Sequence CGGGCGGGAGACGCCCCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 115}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014098161_1014098182 30 Left 1014098161 6:117482544-117482566 CCTGGGAACGCGACTTCCTCCTC 0: 1
1: 0
2: 0
3: 8
4: 104
Right 1014098182 6:117482597-117482619 CGGGCGGGAGACGCCCCCGCAGG 0: 1
1: 0
2: 0
3: 10
4: 115
1014098168_1014098182 11 Left 1014098168 6:117482563-117482585 CCTCTAGGGGCCGACGTGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1014098182 6:117482597-117482619 CGGGCGGGAGACGCCCCCGCAGG 0: 1
1: 0
2: 0
3: 10
4: 115
1014098175_1014098182 1 Left 1014098175 6:117482573-117482595 CCGACGTGCGGGGCGGGGCGGGG 0: 1
1: 0
2: 10
3: 75
4: 382
Right 1014098182 6:117482597-117482619 CGGGCGGGAGACGCCCCCGCAGG 0: 1
1: 0
2: 0
3: 10
4: 115
1014098165_1014098182 14 Left 1014098165 6:117482560-117482582 CCTCCTCTAGGGGCCGACGTGCG 0: 1
1: 0
2: 1
3: 3
4: 26
Right 1014098182 6:117482597-117482619 CGGGCGGGAGACGCCCCCGCAGG 0: 1
1: 0
2: 0
3: 10
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014098182 Original CRISPR CGGGCGGGAGACGCCCCCGC AGG Intronic
900055967 1:630921-630943 AAGGCGGGAGAAGCCCCGGCAGG + Intergenic
900269138 1:1778307-1778329 CGGCATGTAGACGCCCCCGCAGG - Intronic
900582413 1:3415658-3415680 CGGGCGGGAGAGGCCCACCCAGG + Intronic
901242644 1:7704269-7704291 CGGGCGCGGGGCGGCCCCGCGGG + Intronic
903496823 1:23774394-23774416 AGGGCTGGAGAAGCCCCGGCTGG - Intergenic
911116013 1:94247494-94247516 CGGGCTGGGGTCGCCCGCGCGGG - Intronic
912492262 1:110069000-110069022 CGGGCAGGAGCCACCCCCCCAGG - Intronic
914678660 1:149923607-149923629 GTGGAGGGAGAGGCCCCCGCTGG + Exonic
915238644 1:154503148-154503170 CGAGCGAGCGACGGCCCCGCGGG - Intronic
916786767 1:168092262-168092284 CTGGCAGGAGATGCCCCCACAGG - Intronic
921023654 1:211259073-211259095 CGGGCGGGAGATGCACACGAGGG - Intronic
921206998 1:212858016-212858038 TGGGCGGGAGGCGGCCCCGCGGG - Intergenic
1077059520 11:611741-611763 CGGGGAGGAGCCGCCCACGCAGG + Exonic
1077076879 11:706060-706082 TGGGATGGAGGCGCCCCCGCCGG - Intronic
1081863554 11:46347610-46347632 CCCGCGGGAGACGCCCATGCCGG - Intronic
1084603418 11:70159685-70159707 AGGGCAGGGGACGCGCCCGCTGG + Intronic
1089814196 11:121158004-121158026 GGTGCGGAAGACGCCGCCGCCGG - Exonic
1092256367 12:6928414-6928436 CGGGCGGGACAGAACCCCGCGGG - Intronic
1095261778 12:40106077-40106099 CGGGCGGGAGGCGGGACCGCGGG + Intronic
1096178348 12:49537927-49537949 CGGGCGGCAGCCGCGCTCGCTGG + Intergenic
1096627307 12:52903771-52903793 CGGGCGTGGGACGCCCCGCCCGG - Intronic
1097848635 12:64390484-64390506 CGGGCGGCAGATGCCGCCGCAGG + Exonic
1100340761 12:93677534-93677556 CGGGGCGGGGAAGCCCCCGCAGG - Intronic
1103407455 12:120686353-120686375 CTGGCGGGAGTCGCCGCCGGCGG - Intergenic
1103854266 12:123954837-123954859 CGGGCGGCAGACCCCACCCCAGG + Intronic
1104390702 12:128388636-128388658 CGGGTGAGAGAGGGCCCCGCAGG + Intronic
1104602339 12:130162291-130162313 CGGGGGGGATCGGCCCCCGCGGG + Intergenic
1107787057 13:43968374-43968396 CCCGCGGGAGACGCCCATGCCGG - Intergenic
1108689348 13:52847652-52847674 CTGGCGGAAGACGCGCCCGTGGG - Exonic
1114474087 14:22981977-22981999 CGGGTGGGCGGCGGCCCCGCGGG + Exonic
1118350950 14:64972202-64972224 CGGGCGGGCGAGGCAGCCGCGGG - Intronic
1118610173 14:67533466-67533488 CGCGCGGGGGACGGCCCCTCGGG + Intronic
1122486642 14:102086701-102086723 CGGGCGGGGGACCCCCGCGGCGG + Intronic
1126738156 15:51751925-51751947 CGGGCGGGAGGCGCCCGCCGGGG + Intronic
1132752393 16:1464813-1464835 CCGGCGGGAGATGCCCCCGAGGG + Intronic
1132870438 16:2113372-2113394 CGGGCTGGAGAGTCCCACGCGGG + Intronic
1132889530 16:2196874-2196896 CGGGCTGGGGACGCGGCCGCCGG + Intergenic
1134709771 16:16322204-16322226 CGGGCTGGAGAGTCCCACGCGGG - Intergenic
1134949832 16:18346441-18346463 CGGGCTGGAGAGTCCCACGCGGG + Intergenic
1137665396 16:50246356-50246378 CGGGCAGGAGCCGCCACCGCCGG - Intronic
1140393296 16:74606796-74606818 CGGGCCGGAGGCCCACCCGCCGG + Exonic
1142194086 16:88731633-88731655 CAGGCGGGAAACACCCCCACGGG + Intronic
1142223028 16:88864623-88864645 CGGGCGGGAGCCCCCTCTGCAGG - Intronic
1142864185 17:2780326-2780348 CAGGCGGGAGCCGCCGCCTCTGG + Intronic
1144340881 17:14309551-14309573 CGGGCGCGCCCCGCCCCCGCCGG + Intronic
1147511151 17:41069877-41069899 CTGGCAGGAGACGCCCTCTCTGG - Intergenic
1147584921 17:41648529-41648551 CAGGAGGGAGAGGTCCCCGCGGG - Intergenic
1147612879 17:41811987-41812009 CGGGCGGGCGGCGCGCCCGCTGG + Exonic
1148157760 17:45433108-45433130 AGGGCGGGAGCCTCCCCCGCAGG + Intronic
1150675814 17:67245277-67245299 CGGGCGGGAGGCGCGGCCGGAGG - Intronic
1150790674 17:68198442-68198464 CGGGCGGGAGGCGTCCAGGCGGG + Intergenic
1151657794 17:75503798-75503820 CGGGCGGGGGAGGGCCCAGCAGG - Intronic
1151697973 17:75727701-75727723 CGGGCCGCAGACGGACCCGCAGG - Exonic
1152428951 17:80236814-80236836 GAGGCAGGAGACGCCCCCACCGG - Intronic
1152654831 17:81514664-81514686 CGGGGAGGGGACGCCGCCGCGGG + Intronic
1152729674 17:81963273-81963295 CCGGCGGGAGAGGCCTCCTCCGG - Intergenic
1152744016 17:82031047-82031069 CGAGGGGGAGACGCGCCCGCGGG - Exonic
1153515381 18:5896119-5896141 CGGAGTGGAGCCGCCCCCGCCGG + Intergenic
1153935236 18:9914626-9914648 CGCCCAGGAGGCGCCCCCGCGGG - Intronic
1155928850 18:31685238-31685260 CCGGGGTGAGGCGCCCCCGCCGG + Intronic
1159578294 18:70206069-70206091 CGGGCTGCAGAGGCCCCAGCAGG + Intergenic
1160782702 19:884887-884909 CCGGCGGGAGACTCACCCACGGG + Exonic
1160991942 19:1863682-1863704 CGGGCTGTGGCCGCCCCCGCGGG - Intergenic
1161172425 19:2819746-2819768 CGGGCGGGCGGCGTCTCCGCAGG - Intergenic
1161222199 19:3122934-3122956 CTGGCGGGATACCCCCCCCCCGG + Exonic
1161581189 19:5082005-5082027 CCGGCTGGAGACACCCCCACGGG + Intronic
1162395554 19:10416594-10416616 CGAGCCGGGGAAGCCCCCGCGGG + Intronic
1163441327 19:17323909-17323931 CGGGGGGATGCCGCCCCCGCCGG + Intronic
1164834753 19:31349887-31349909 CGGGGGCGCGGCGCCCCCGCGGG - Intergenic
927684511 2:25161307-25161329 CGGGAGGGAGATGGCCCCGACGG - Exonic
927714155 2:25341740-25341762 CGGGCGGGGGGCGCCGCGGCTGG - Intronic
929537613 2:42793172-42793194 CGGCCGGCAGACTCCGCCGCGGG + Intergenic
940558529 2:155263895-155263917 AAGGTGGGAGAAGCCCCCGCAGG - Intergenic
946242952 2:218367932-218367954 CCGGAGGGAGACGCCCGCTCGGG + Exonic
1169832466 20:9839191-9839213 CGTGCAGGAGCTGCCCCCGCCGG - Intergenic
1174506781 20:51022556-51022578 CAGCCGGGATGCGCCCCCGCCGG + Intronic
1175036411 20:56004900-56004922 CAGGCAGGAGAGGACCCCGCCGG - Exonic
1176698679 21:10014869-10014891 AAGGCGGGAGAAGCCCCGGCAGG + Intergenic
1179931162 21:44571934-44571956 CGTGCGGGCGAGGCCCCCGGAGG + Intronic
1180177771 21:46098575-46098597 CGCGGGGAAGACGCCCCGGCTGG + Intronic
1180483369 22:15775344-15775366 CAGGCTGGAGAGGCCCCCCCAGG - Intergenic
1181038230 22:20179979-20180001 TGGGCGTGAGATGCCCCAGCTGG - Intergenic
1181586903 22:23857585-23857607 TGGGGGGGAGTCGCCGCCGCGGG - Intronic
1184035204 22:41914849-41914871 CGGGCGGAGGACGCGCCCACCGG - Intergenic
1184264886 22:43341721-43341743 TGGGCTGGAGACTCCCCTGCAGG + Intronic
954093271 3:48301735-48301757 CTGGCGGGCATCGCCCCCGCCGG - Intergenic
956836059 3:73096958-73096980 CGGGCGTGAGCCACCCCGGCCGG - Intergenic
961754878 3:129121718-129121740 CGGGGGGGAGCCGAACCCGCGGG - Exonic
961820706 3:129574371-129574393 TGGGCTGCAGAGGCCCCCGCAGG + Exonic
968481853 4:836790-836812 GGGGCCGGAGCAGCCCCCGCCGG - Intergenic
968879857 4:3293230-3293252 CGGGCGGGCGGCGACCCCGAGGG - Intronic
969619113 4:8270029-8270051 CGCGCGGGACACGGCGCCGCAGG - Exonic
972765957 4:42152322-42152344 CGGGCGGCAGCCCCCCGCGCGGG - Exonic
973635934 4:52862188-52862210 CGCGCGCGCGACGCCCCCGGAGG - Intergenic
984964332 4:185127723-185127745 CGGGCTGCAGAGGCCCCGGCAGG + Intergenic
985593593 5:777858-777880 CGGAAGGGCGCCGCCCCCGCCGG - Intergenic
985749674 5:1667163-1667185 AGGGCGGGAGACGCAGCCCCGGG - Intergenic
995018563 5:107341560-107341582 CAGGAGGGAGACTCCTCCGCTGG - Intergenic
1000463302 5:161547784-161547806 CGGGTGGGACGCGCCCCGGCCGG + Intronic
1004044617 6:12012216-12012238 CGGGCGGGGGCCGCAGCCGCCGG - Intronic
1006259261 6:32854266-32854288 CGGGCGGGAGAAGTCCACACCGG + Exonic
1010216201 6:73404095-73404117 CAGGCGTGAGCCGCCGCCGCCGG + Intronic
1014098182 6:117482597-117482619 CGGGCGGGAGACGCCCCCGCAGG + Intronic
1017929515 6:158939648-158939670 CGGGCGGGGAACGTCCGCGCAGG + Intergenic
1019142862 6:169959391-169959413 CGGGAGGGGGACCACCCCGCAGG - Intergenic
1019601616 7:1886541-1886563 CGGGCGGGAGAGGGCCCACCTGG + Intronic
1019636236 7:2077482-2077504 CTGGGGGGAGACGCCCCAGTCGG + Intronic
1020224948 7:6272560-6272582 CGGGCTGGGGACGCCGCCGGAGG + Exonic
1020238454 7:6374440-6374462 CGGGCGGGAGCGGCCCCGCCCGG + Intergenic
1024226142 7:47328104-47328126 TGGGTGGGGGACGCCACCGCTGG - Intronic
1030121102 7:106111945-106111967 CGGGGCGGAGACGCCGCGGCGGG - Intronic
1033099777 7:138460384-138460406 CGGGCGGGGGAAGCCTCCTCAGG - Exonic
1033406371 7:141074019-141074041 GGGGCGGGAGGCGGCCGCGCTGG + Intergenic
1035598743 8:882397-882419 CGCGCAGGAGAGGCCTCCGCAGG - Intergenic
1035598825 8:882709-882731 CGCGCAGGAGAGGCCTCCGCAGG - Intergenic
1039554350 8:38466259-38466281 GGGGCGCGTGACGCCACCGCGGG + Intronic
1043502976 8:80874387-80874409 CGGCCGGGAGAGGCGCGCGCGGG - Intronic
1048368041 8:133755691-133755713 CTGGCGGGAGAAGCCCCAGTAGG + Intergenic
1050377258 9:4985570-4985592 CGGGTAGGAGCCGCCCCTGCGGG + Exonic
1057199933 9:93134421-93134443 CGGGCCTGAGACGGTCCCGCGGG + Intergenic
1058619155 9:106864376-106864398 CAGGAGTGAGACGCCCCCCCAGG - Intronic
1060484952 9:124041032-124041054 CGGGCTGGGGGCGCCCCCGCAGG - Intergenic
1061095943 9:128456754-128456776 CGGGCGGGACCCCCCCCCGCCGG - Intronic
1202629617 M:5751-5773 AAGGCGGGAGAAGCCCCGGCAGG + Intergenic
1185479458 X:435173-435195 CAGGCCGGAGAGGCTCCCGCAGG - Intergenic
1199681240 X:150225933-150225955 CGGGCGGGAGAAGACCCACCTGG - Intergenic