ID: 1014100522

View in Genome Browser
Species Human (GRCh38)
Location 6:117506580-117506602
Sequence GAGGATGTTCAAACAGACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 156}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014100522_1014100531 29 Left 1014100522 6:117506580-117506602 CCCTGGTCTGTTTGAACATCCTC 0: 1
1: 0
2: 1
3: 15
4: 156
Right 1014100531 6:117506632-117506654 GTGCTTTGTCTTTCAGTGGCTGG No data
1014100522_1014100526 -5 Left 1014100522 6:117506580-117506602 CCCTGGTCTGTTTGAACATCCTC 0: 1
1: 0
2: 1
3: 15
4: 156
Right 1014100526 6:117506598-117506620 TCCTCCAGGAATGCAGAAGGAGG No data
1014100522_1014100528 -2 Left 1014100522 6:117506580-117506602 CCCTGGTCTGTTTGAACATCCTC 0: 1
1: 0
2: 1
3: 15
4: 156
Right 1014100528 6:117506601-117506623 TCCAGGAATGCAGAAGGAGGAGG 0: 1
1: 1
2: 5
3: 53
4: 468
1014100522_1014100525 -8 Left 1014100522 6:117506580-117506602 CCCTGGTCTGTTTGAACATCCTC 0: 1
1: 0
2: 1
3: 15
4: 156
Right 1014100525 6:117506595-117506617 ACATCCTCCAGGAATGCAGAAGG 0: 1
1: 0
2: 3
3: 10
4: 236
1014100522_1014100530 25 Left 1014100522 6:117506580-117506602 CCCTGGTCTGTTTGAACATCCTC 0: 1
1: 0
2: 1
3: 15
4: 156
Right 1014100530 6:117506628-117506650 AGAAGTGCTTTGTCTTTCAGTGG 0: 1
1: 0
2: 4
3: 37
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014100522 Original CRISPR GAGGATGTTCAAACAGACCA GGG (reversed) Intronic
900978881 1:6035098-6035120 GAGCATGCTCAGGCAGACCACGG + Intronic
901809840 1:11761521-11761543 GAGGAGGTCCACACATACCATGG + Intergenic
902989305 1:20175092-20175114 GAGGAGGGTCAAACACATCACGG - Exonic
904134999 1:28305358-28305380 GTGGATGGTTAAACAAACCATGG - Intergenic
904288130 1:29466673-29466695 GTGAATGTTAAATCAGACCAAGG - Intergenic
907049988 1:51323478-51323500 GAGAGTGTTCCAACAGACCTGGG - Intronic
907527233 1:55060991-55061013 GAGGTGGTTCAGACAGACCCCGG + Intronic
909885163 1:80932386-80932408 GAGGATGTTGAAGCAGATAAAGG + Intergenic
917753698 1:178078129-178078151 GAGGATATTCAAACCAAGCAAGG + Intergenic
918122810 1:181554650-181554672 CAGGATGATCAAACAGTGCATGG - Intronic
918497829 1:185159040-185159062 GAGGACACTCAAACAGCCCATGG - Intronic
918653447 1:186994881-186994903 TAGTATGTTTAAACATACCATGG + Intergenic
1064374462 10:14783066-14783088 GAGGATGTGAAATCAGACAATGG - Intergenic
1064783458 10:18868073-18868095 GAGGATCTACAAACAGGCCATGG - Intergenic
1065092641 10:22250909-22250931 GATGGGGTTCTAACAGACCATGG + Intergenic
1068049545 10:51931957-51931979 CAGGATTTTCAAACATATCAAGG - Intronic
1068049955 10:51937436-51937458 GAGCATATTGAAACAGGCCATGG + Intronic
1068812709 10:61274677-61274699 GAGGATATTCAATGATACCAAGG + Intergenic
1069678399 10:70266192-70266214 GAGCACGATGAAACAGACCAGGG + Exonic
1070755480 10:78989449-78989471 GAGGAAGTTCAAGTAGCCCATGG - Intergenic
1070951449 10:80434627-80434649 GAGGAGGTTCAAATAGAACTAGG + Exonic
1071167924 10:82828409-82828431 GAGGATGAGGAAACAGGCCAGGG + Intronic
1072643728 10:97234836-97234858 GAGGAAGTTGAGACAGACTAGGG - Intronic
1074431177 10:113396078-113396100 GAGGATGGGCTAATAGACCAGGG + Intergenic
1075725698 10:124609868-124609890 GAGGATGGGAAAACAGACCACGG - Intronic
1077677611 11:4210420-4210442 AAGAATGTTAAAACAGGCCATGG - Intergenic
1077719809 11:4616735-4616757 AAGGATTTTCATACACACCAGGG - Intergenic
1078031591 11:7757500-7757522 GAGTCTGTTGATACAGACCATGG - Intergenic
1079779150 11:24576677-24576699 GTAGTTGTCCAAACAGACCAAGG + Intronic
1087419095 11:97897858-97897880 GAGGATGTTAAATCAGTTCAGGG - Intergenic
1090238715 11:125166938-125166960 GATGGTGTTCAAACATAACACGG + Intronic
1091132880 11:133161108-133161130 GAGGATGTTCAGACAAGCCAGGG + Intronic
1092822791 12:12368754-12368776 GATGATGGACAAACAGAACAAGG - Intronic
1095265731 12:40155040-40155062 CAGGATTTTCAAAAAGAACAAGG - Intergenic
1097455181 12:59791628-59791650 AAGGATGAACAAACAGATCAAGG - Intergenic
1098400504 12:70070338-70070360 GAGGATGTGCAAAGAGAAGAGGG - Intergenic
1100142777 12:91638927-91638949 GAGAATGTTCAAACTGACATGGG - Intergenic
1100535484 12:95504983-95505005 GGGGATGGTCAGACAGACCTGGG - Intronic
1103022892 12:117550618-117550640 GATGAGGTTCAAAGAGAACAGGG + Intronic
1105291944 13:19058853-19058875 GAGGATGCTCAATGAGGCCAGGG + Intergenic
1107101367 13:36597223-36597245 GAGAATGTTTAGACAGACGAGGG + Intergenic
1108205039 13:48079805-48079827 GAGTGTTTTCAAACAGATCAGGG - Intronic
1110141660 13:72138156-72138178 GAGGCTGTTCAAACTGTCCTGGG + Intergenic
1116684461 14:48019630-48019652 GAGGATGTTCGAACTCACTAGGG + Intergenic
1116840020 14:49810499-49810521 GAGGATGGACAAATAGATCAAGG - Intronic
1117453270 14:55872844-55872866 GAGGATGCTGAAAGAGAACAAGG - Intergenic
1119457074 14:74764622-74764644 GAGGATGGTCAAAGAAACCAAGG - Intronic
1121304115 14:92894768-92894790 CAGGATGCTCAAGCAGCCCATGG + Intergenic
1123929634 15:25158508-25158530 GAGAAAGTTCAAATAGACCTTGG + Intergenic
1126328944 15:47511265-47511287 GGTGATCTTCAAACAGAACAAGG - Intronic
1126898052 15:53281085-53281107 GAGGATATTCAGAAAGACCAGGG + Intergenic
1130747747 15:86674313-86674335 GAGGAGGCCCAAACAGAACATGG - Exonic
1131290460 15:91102299-91102321 GTGGATGCTCAAACAGACCTAGG + Intronic
1133410031 16:5560529-5560551 CAGGAGATTCAAACAGACAAAGG - Intergenic
1135121350 16:19769090-19769112 GAGGATACTCAAGCAGCCCATGG - Intronic
1139115409 16:63945569-63945591 GAAGATGTTAAAATAAACCATGG + Intergenic
1141572745 16:84944070-84944092 GAGGATGCTCAGACAGCCCATGG + Intergenic
1141698147 16:85630130-85630152 GAGGATGCTCAAGCAGGTCATGG - Intronic
1143933754 17:10460337-10460359 GAGAATGGTGAAACTGACCATGG + Intronic
1148662100 17:49342847-49342869 GAAGATGTTCAAATATACAAAGG + Intronic
1149361688 17:55901909-55901931 GAGGCTGTTGAAACAGAGTACGG + Intergenic
1149718148 17:58814635-58814657 GGTGGTGTTCACACAGACCAGGG + Intronic
1150237019 17:63601328-63601350 GCGGATGTTCAAACAGAGTTTGG - Exonic
1152116456 17:78390594-78390616 GAGGATGCTCAAACATCCCAAGG - Intronic
1156235076 18:35195257-35195279 CAGGATGTACTCACAGACCAGGG + Intergenic
1157479759 18:48045886-48045908 GAGGATGCTCAAGCAGCCCTAGG + Intronic
1157648723 18:49304874-49304896 GAGGAAGTGCAAGCAGATCAAGG - Intronic
1158285661 18:55878818-55878840 TAGAATGTTCAAAGAGATCAAGG + Intergenic
1158684264 18:59598790-59598812 GAGGGTTTTCAAAAAGATCATGG - Intronic
1160627679 18:80223790-80223812 CAGGATGTTCCAAGGGACCAAGG + Intronic
1162132802 19:8537202-8537224 GTGGAGGTGCACACAGACCAGGG - Intronic
925348313 2:3185215-3185237 GAGGATTTTGAAACAGGCTAGGG - Intergenic
925468605 2:4134875-4134897 GAAGATGATCCAAAAGACCAAGG - Intergenic
926290379 2:11524565-11524587 GAGGATGTTCAGACAGGACGTGG - Intergenic
926555181 2:14349351-14349373 GAGGATGCTATAAAAGACCAAGG + Intergenic
927747636 2:25635920-25635942 AAGGATAGACAAACAGACCAGGG + Intronic
928118425 2:28564532-28564554 GAGTATCTTCAAGGAGACCAGGG - Intronic
928323738 2:30303572-30303594 CAGGACCTTCAACCAGACCAGGG - Intronic
929139462 2:38654430-38654452 TGGGCTGTTCCAACAGACCACGG + Intergenic
933438661 2:82281963-82281985 GTGGATGTTCAAACAGGCATGGG + Intergenic
933651313 2:84852472-84852494 GAGGATGGCCAAAATGACCATGG + Intronic
933789746 2:85874282-85874304 GAGAATGTTCATATAGTCCAAGG - Intronic
941169464 2:162119142-162119164 GAGGAATTTTAAACAGTCCATGG - Intergenic
942433933 2:175950122-175950144 GAGGGTGTTAAAACATACTACGG - Intronic
1170072870 20:12387829-12387851 GAGGAGTTTCAAACTGACCATGG + Intergenic
1170233373 20:14074671-14074693 AAGCATGTTCAAACAGAACAGGG - Intronic
1170749834 20:19135833-19135855 GAACATGTTAAAACACACCATGG - Intergenic
1173025137 20:39300528-39300550 GAGGGTGTGCAAACCCACCAGGG - Intergenic
1174339525 20:49887187-49887209 GAGGAATTTCAGACATACCAGGG + Intronic
1175436610 20:58956138-58956160 GAACATGTTAAAACACACCATGG + Intergenic
1178101602 21:29274762-29274784 GAGGATTCTCAAGCAGCCCATGG + Intronic
1179044203 21:37830358-37830380 GAGGAAGGCCAAACAGACCCAGG - Intronic
1183191147 22:36322730-36322752 AAGTAAGTTCAAACTGACCAAGG - Intronic
1183750526 22:39717722-39717744 GAGCGTGTTCAAATAGAACAGGG + Intergenic
953805532 3:46064599-46064621 GAGAATGTTCCAAGAGACCCAGG - Intergenic
954015839 3:47690049-47690071 GATGAAGTTCAAAAAGAACATGG + Intronic
955607287 3:60719366-60719388 GAGAATGTGCAAACAGACAGAGG - Intronic
955898751 3:63728927-63728949 GAGGATATTTAAGCAGACCTAGG + Intergenic
958936121 3:100257773-100257795 GAGGATGTTCAAGCAGCCCATGG + Intergenic
959003396 3:100991058-100991080 GAGGATGCTCAAAGGGAACAGGG - Intronic
960931888 3:122860158-122860180 GATGCTGTTCAAACAGGTCAGGG - Exonic
962107702 3:132409301-132409323 CAGGCTGTTCTAACAGAGCAGGG + Intergenic
964909788 3:161766162-161766184 GAGAATGTTCAAACAAATCTTGG - Intergenic
966065189 3:175812780-175812802 GAGTGTGTCCATACAGACCATGG + Intergenic
973585181 4:52383596-52383618 GAAGAGGATAAAACAGACCAGGG + Intergenic
976129483 4:81869797-81869819 GAGAATGGTAAAACATACCATGG + Intronic
982277206 4:153648288-153648310 AAGGATGTTCAAAAAAACCAGGG + Intergenic
985877371 5:2610167-2610189 GAGGATGCTCAAGCAGCCCTGGG - Intergenic
986808772 5:11333794-11333816 AAGGACGTCCAAACAGCCCATGG - Intronic
987173389 5:15282135-15282157 GAGGGGGTTCACACAGAGCAGGG + Intergenic
990555929 5:56935691-56935713 GAAGATGTTGAAACAGACAGTGG - Exonic
993634352 5:90326167-90326189 GAGGATGTTCAGCCAGATAATGG + Intergenic
994469863 5:100189406-100189428 AAGGATAGTCAAATAGACCAGGG - Intergenic
995786821 5:115839711-115839733 AAGATTGTTGAAACAGACCAAGG - Intronic
996221823 5:120942135-120942157 GAGGCTGTTCAATCAGAACAGGG + Intergenic
997311362 5:132886354-132886376 GAGGCTGTTCAAACTGAAGAAGG - Exonic
997639641 5:135440235-135440257 GAGGATGTTAAACCATTCCATGG - Intergenic
998489029 5:142529786-142529808 CAGGTTGTTCAACAAGACCAAGG + Intergenic
999777126 5:154820396-154820418 CACCATGTTCAAGCAGACCAAGG - Exonic
999965704 5:156807072-156807094 GAGGATGTTCAAACCCATCGTGG + Intergenic
1000529742 5:162404885-162404907 GAGGGTGTTGGAACTGACCAGGG - Intergenic
1001827643 5:174758767-174758789 GAGGATGCTCAAGCAGCCCTAGG + Intergenic
1002522339 5:179798703-179798725 CAGGCTGTGCAAAGAGACCAGGG + Intronic
1003461852 6:6336411-6336433 GAGTGTGTTCAGACAGAACAGGG - Intergenic
1005682721 6:28222901-28222923 GATGATGGTGAAACAGAACATGG - Intergenic
1009842893 6:69099551-69099573 GAAGATGTTGAAAAGGACCAAGG - Intronic
1010405715 6:75503730-75503752 GAGAATGTTCCATCAGAGCAAGG + Intergenic
1014100522 6:117506580-117506602 GAGGATGTTCAAACAGACCAGGG - Intronic
1014593518 6:123303485-123303507 AAACATGTGCAAACAGACCAAGG + Intronic
1016869497 6:148802725-148802747 GAAGAAATTCAAAGAGACCAAGG + Intronic
1016921242 6:149296195-149296217 GAGGCAGTTCAAACTGACTAGGG + Intronic
1022289468 7:28987118-28987140 GTGGATGTTCTCACAGACCAGGG + Intergenic
1023271693 7:38470029-38470051 CAGGATGTTCAACCTGATCAAGG - Intronic
1024007713 7:45239578-45239600 GAGGAGGCTCAACCAGGCCAGGG - Intergenic
1025093777 7:56082604-56082626 GAGGAAGTCCAAAGAGACAATGG + Intronic
1028230734 7:88303716-88303738 GAGGATCTTTAAACAGCACAAGG + Intronic
1034294793 7:149962785-149962807 GAGGATGTGCACACAAAGCAAGG - Intergenic
1034811269 7:154134167-154134189 GAGGATGTGCACACAAAGCAAGG + Intronic
1035241778 7:157536708-157536730 GAGGCTGTGAAAACACACCAAGG - Intergenic
1036683236 8:10891415-10891437 GAAGATGGACAAACAGACCAGGG + Intergenic
1038442080 8:27577874-27577896 GAGTATGTACAAATACACCATGG - Intergenic
1039428649 8:37507379-37507401 GAATAAGTACAAACAGACCAGGG - Intergenic
1040695987 8:49999554-49999576 GAGAATGTTCAAAAAGAATAGGG - Intronic
1041354849 8:56989620-56989642 GAGACTGTTAAAACAGGCCATGG - Intronic
1043959976 8:86406175-86406197 GAGGATGTTCAATTTGTCCAAGG - Intronic
1044061468 8:87641501-87641523 GAGGATAGTCACACAGACAAAGG + Intergenic
1044819705 8:96147308-96147330 CAAGACCTTCAAACAGACCAGGG + Intronic
1046893669 8:119450075-119450097 TAGGAGGTTCAAACAGAAAAGGG - Intergenic
1048775282 8:137939109-137939131 GATGATGTTCAACCAGACTCAGG + Intergenic
1049381409 8:142318203-142318225 GAGGATGGTGAAACAAACAATGG + Intronic
1050222726 9:3412310-3412332 ATGGATATTCAAACAGATCATGG - Intronic
1052136858 9:24922689-24922711 GAGGATGTTAATACATGCCAGGG + Intergenic
1052353945 9:27485008-27485030 CAGTATTTTTAAACAGACCACGG + Intronic
1055037105 9:71829428-71829450 GAGGGTGGTCAGACACACCAAGG + Intergenic
1057091338 9:92260900-92260922 GTGGATGATCAAACAAACCATGG + Intronic
1057397202 9:94690737-94690759 GAGGGTGTTCCAAGAGACCCAGG + Intergenic
1060922988 9:127435706-127435728 AAGGATGTTTAAAAAGACCTTGG + Intronic
1061674680 9:132209059-132209081 GAGAATGGGTAAACAGACCACGG - Intronic
1186118458 X:6330934-6330956 GAAGATGGACAAACAGATCAAGG + Intergenic
1186867170 X:13732310-13732332 GAGGATGTTTAAACGGAGTAGGG + Intronic
1189525464 X:41815177-41815199 GAGGCTGGTCAAAAAGAGCAGGG + Intronic
1190102934 X:47536641-47536663 GTGGATGGTTAAACAAACCATGG + Intergenic
1192272791 X:69599126-69599148 GTGAATGTTTAAACAAACCACGG + Intergenic
1195866757 X:109440588-109440610 GAGTATCTTCAAACAAAACAAGG + Intronic
1195904591 X:109830850-109830872 AAAAATGTTCAAAGAGACCAGGG - Intergenic
1200689778 Y:6295331-6295353 GAAGATGTTCAAACAAAGAACGG + Intergenic
1200916711 Y:8577655-8577677 GAAGATGTTGAGACAGACCCAGG - Intergenic
1200985143 Y:9295877-9295899 GAAGATGGTGAACCAGACCAAGG + Intergenic
1201045494 Y:9879389-9879411 GAAGATGTTCAAACAAAGAACGG - Intergenic
1201428247 Y:13878100-13878122 AAGGAGGTCCAAAGAGACCATGG + Intergenic
1201922206 Y:19245689-19245711 GAGGAAGTTCAAACTGGACAGGG + Intergenic
1202125304 Y:21564308-21564330 GAAGATGGTGAACCAGACCAAGG - Intergenic
1202153704 Y:21865084-21865106 GAAGATGGTGAACCAGACCAAGG + Intergenic