ID: 1014109792

View in Genome Browser
Species Human (GRCh38)
Location 6:117607779-117607801
Sequence CATGGTGAGCAGAGGGAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014109785_1014109792 21 Left 1014109785 6:117607735-117607757 CCAGATGATTGTAACTCACTCAG No data
Right 1014109792 6:117607779-117607801 CATGGTGAGCAGAGGGAGTTAGG No data
1014109784_1014109792 22 Left 1014109784 6:117607734-117607756 CCCAGATGATTGTAACTCACTCA No data
Right 1014109792 6:117607779-117607801 CATGGTGAGCAGAGGGAGTTAGG No data
1014109783_1014109792 23 Left 1014109783 6:117607733-117607755 CCCCAGATGATTGTAACTCACTC No data
Right 1014109792 6:117607779-117607801 CATGGTGAGCAGAGGGAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014109792 Original CRISPR CATGGTGAGCAGAGGGAGTT AGG Intergenic
No off target data available for this crispr