ID: 1014116758

View in Genome Browser
Species Human (GRCh38)
Location 6:117675495-117675517
Sequence GGAGGAGGAAGATGGCGGCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1050
Summary {0: 2, 1: 1, 2: 8, 3: 95, 4: 944}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014116748_1014116758 7 Left 1014116748 6:117675465-117675487 CCATGTACTACTGGGGGCGGGGC 0: 1
1: 0
2: 0
3: 9
4: 83
Right 1014116758 6:117675495-117675517 GGAGGAGGAAGATGGCGGCGGGG 0: 2
1: 1
2: 8
3: 95
4: 944
1014116739_1014116758 30 Left 1014116739 6:117675442-117675464 CCACGCTGGCCAATCGGAACTGT 0: 1
1: 0
2: 2
3: 9
4: 180
Right 1014116758 6:117675495-117675517 GGAGGAGGAAGATGGCGGCGGGG 0: 2
1: 1
2: 8
3: 95
4: 944
1014116740_1014116758 21 Left 1014116740 6:117675451-117675473 CCAATCGGAACTGTCCATGTACT 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1014116758 6:117675495-117675517 GGAGGAGGAAGATGGCGGCGGGG 0: 2
1: 1
2: 8
3: 95
4: 944

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014116758 Original CRISPR GGAGGAGGAAGATGGCGGCG GGG Exonic