ID: 1014118448

View in Genome Browser
Species Human (GRCh38)
Location 6:117694125-117694147
Sequence CTGTGGGTCTCTTTTGCTTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 2, 1: 2, 2: 4, 3: 20, 4: 272}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014118448 Original CRISPR CTGTGGGTCTCTTTTGCTTC TGG (reversed) Exonic
903404599 1:23085783-23085805 CTGTGGCTGTTTTTTGCTTTTGG - Exonic
903430656 1:23296283-23296305 CTGTATGTCTGTTTTTCTTCAGG + Intergenic
904862460 1:33549070-33549092 CTTTGGGACTCTTTTCTTTCTGG + Intronic
906262464 1:44404916-44404938 CTCTTGGTCCCTTTTGGTTCAGG + Intergenic
907300013 1:53481235-53481257 CTTTGGGGCTCTCTGGCTTCTGG - Intergenic
907320298 1:53597708-53597730 CTGGGGGTCTGTTTTTCTTTAGG + Intronic
907559990 1:55379449-55379471 CTGTGGGTCTCTTCAGCTGGTGG + Intergenic
907772198 1:57476641-57476663 CTGTTCCTCTCTTTTGCTTTAGG - Intronic
908648150 1:66302147-66302169 CAGTGGGTCACTTCTGCTTCAGG - Intronic
908678645 1:66634177-66634199 CTGTGTCTCTTCTTTGCTTCCGG + Intronic
909190535 1:72543306-72543328 CTCTGGGTCTCTTCATCTTCTGG - Intergenic
910897587 1:92084717-92084739 CTCTGGGTCTCTTCAGCCTCTGG + Intronic
912582173 1:110730439-110730461 CTGTGGCTCTCTTTGTCTTGTGG + Intergenic
912926035 1:113913698-113913720 TTTTGGTTCTCTTTAGCTTCTGG + Exonic
913283256 1:117205528-117205550 TTGTTGGTCTGTGTTGCTTCAGG - Intronic
914247734 1:145898223-145898245 CTGTGACTCTGTTTTCCTTCAGG - Exonic
918400756 1:184160631-184160653 CTCTGACTCTCTTTTGCTACTGG - Intergenic
918798781 1:188942804-188942826 ATGTGGGTCACTTTTACTACAGG + Intergenic
923486640 1:234438683-234438705 CTGTCTTTCTCTTTTCCTTCTGG - Intronic
1063325468 10:5096660-5096682 TTGTGGGTGAATTTTGCTTCTGG + Intronic
1063724213 10:8619416-8619438 GTGTGGGTTTGTTCTGCTTCAGG + Intergenic
1064122136 10:12629012-12629034 CTGGGGGACTGTGTTGCTTCCGG + Intronic
1065145673 10:22765334-22765356 CTGAGGTTCTGTTTTCCTTCTGG + Intergenic
1065278693 10:24112996-24113018 CTGTGCTCCTCTCTTGCTTCTGG - Intronic
1065558891 10:26943092-26943114 CTGTGGTTCCCTTTTCCTTGAGG + Intergenic
1069043989 10:63723400-63723422 TAGTGGGTCTCTTTGGCTTCAGG + Intergenic
1069744415 10:70706113-70706135 CTGTGGGTCCCTCATCCTTCAGG - Intronic
1072152913 10:92697346-92697368 CTGTGTGTGTGTTTCGCTTCTGG + Intergenic
1072263202 10:93702338-93702360 CTGTGGGTATATTTGGCATCAGG - Intronic
1073167974 10:101474603-101474625 CTGTGGTTCTCTTTCATTTCTGG + Intronic
1073223629 10:101897322-101897344 CTGTAAGTAGCTTTTGCTTCTGG + Intronic
1073972803 10:109063682-109063704 CTGTTACTCTCTTTTGCTTATGG - Intergenic
1074123565 10:110510862-110510884 ATGTCTGTCTCTGTTGCTTCGGG + Exonic
1075823779 10:125336391-125336413 ATGTGGGTCTCTGTGGCTGCAGG - Intergenic
1076411373 10:130253754-130253776 CTGTGGCTCTCTTGGGATTCCGG - Intergenic
1076843706 10:133058776-133058798 CTGTGGGTTTTGTTTGCTTGGGG + Intergenic
1078093822 11:8284169-8284191 CTGTGGGTGGCTGTGGCTTCAGG - Intergenic
1081267629 11:41045811-41045833 CTGTGGGTATCTTTTGCCCTGGG + Intronic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1084553054 11:69860286-69860308 CAGTGCGTCTCTCCTGCTTCTGG + Intergenic
1085736450 11:79043297-79043319 GTCTGGTTCTCTTCTGCTTCTGG + Intronic
1086511997 11:87568854-87568876 CTGTGTGTCGCATTTGCTTTTGG - Intergenic
1087227282 11:95615245-95615267 CTGTGGATCTGTTGTGATTCTGG - Intergenic
1087620871 11:100540253-100540275 CTGTAGATCTCTGTTACTTCTGG + Intergenic
1089311747 11:117562521-117562543 ATGTGGGTCTCCTTGGCTGCAGG + Intronic
1089499234 11:118922886-118922908 TTGTGGGCCTCTTCTGATTCTGG + Intronic
1089584027 11:119498562-119498584 CTGTGTGCCTCTCTTCCTTCTGG - Intergenic
1090682119 11:129072173-129072195 GTGTTGGTCTCATTTGCTTCAGG + Intronic
1090707667 11:129354034-129354056 CTGTGGGCCTCTTTGGATTCTGG + Intergenic
1092534722 12:9377187-9377209 CTGTGGTTCTCTAGTCCTTCTGG + Intergenic
1093438603 12:19166434-19166456 CTGTGGCTGTCTTTTCCTGCGGG + Intronic
1096828932 12:54299912-54299934 CTGTGTGTCTCTCTCTCTTCGGG - Intronic
1099437060 12:82657869-82657891 CTATGGGTCTCTTATGCCTGCGG + Intergenic
1101028012 12:100632863-100632885 CTTTGGGTCTCTTGGGCTACAGG - Intergenic
1101156212 12:101930034-101930056 CTCCTGGTATCTTTTGCTTCTGG + Intronic
1101322495 12:103685234-103685256 CTGTGGGTCACGTTTTCTACAGG + Intronic
1102533707 12:113565637-113565659 CTGGGGGTTTGTTTTTCTTCTGG + Intergenic
1104951583 12:132443102-132443124 CTGTGGGTTTTTTTTTTTTCGGG - Intergenic
1105698673 13:22916284-22916306 CTGTGGGTCTCCTTTGCTTCTGG - Intergenic
1105850378 13:24328833-24328855 CTTTGGGTCTCCTTTGCTTCTGG - Intergenic
1106381793 13:29246370-29246392 CCATGGGCCTCTTCTGCTTCTGG - Intronic
1107649476 13:42529771-42529793 CTGTGGCTCTGTTTTGCATTTGG + Intergenic
1107821564 13:44290412-44290434 CTGAGGGTCTCTAATGCATCAGG + Intergenic
1109988951 13:70028466-70028488 CCGTGGGTCTCTTTTAATCCAGG - Intronic
1111977190 13:94978485-94978507 CTGTTTCTCTCTTCTGCTTCAGG - Intergenic
1112348201 13:98610513-98610535 CTGTGGGTCACTTTTGCTTCTGG + Intergenic
1113078297 13:106490428-106490450 CTGTGCGTCTGTTTTGTGTCTGG - Exonic
1113593377 13:111515606-111515628 CTGAGGGACTCCTTTGCTTTCGG + Intergenic
1114033837 14:18601881-18601903 CTGTGGGTCTCATTTGGCTGTGG + Exonic
1114078629 14:19181055-19181077 CTGTGGGTCTCATTTGGCTGTGG + Intergenic
1114124810 14:19713130-19713152 CTGTGGGTCTCATTTGGCTGTGG - Intergenic
1114168207 14:20243541-20243563 CTGTGGTTCTCATTTGGTTGTGG + Exonic
1115192560 14:30761248-30761270 CTGTTGGTCTCTCTGCCTTCTGG - Intergenic
1116111652 14:40592539-40592561 CTGTGGGTTTCTGAAGCTTCAGG + Intergenic
1116338235 14:43687205-43687227 CTCTTGGTCTCTTGTGCTTCTGG + Intergenic
1116869235 14:50055872-50055894 CTGTGGGCTTCTTTTCCTTTTGG + Intergenic
1117657705 14:57973496-57973518 CTGTGGTTCTGTTTTCCTGCTGG + Intronic
1119465832 14:74857549-74857571 CTGAGGGCCTCTTTTACTTTGGG - Intronic
1119830398 14:77697033-77697055 CTGGAGGTCTCTTTGGCTTTGGG - Intronic
1120165332 14:81192839-81192861 ATGTGGTTTTCTTTTGCTTTAGG - Exonic
1120503300 14:85323645-85323667 CTGTGGGGCTTTTCTCCTTCTGG - Intergenic
1120515142 14:85461730-85461752 CCTTGGGTCTTTTTTGCTCCTGG - Intergenic
1120760200 14:88278021-88278043 CTGAGGGCCTATTGTGCTTCAGG + Intronic
1123568272 15:21574419-21574441 CTGTGGGTCTCATTTGGCTGTGG - Intergenic
1123604380 15:22009741-22009763 CTGTGGGTCTCATTTGGCTGTGG - Intergenic
1125672375 15:41483412-41483434 CTGTTTGTCTGTCTTGCTTCTGG + Exonic
1127190427 15:56524965-56524987 CTATGGGTCTCCTTTCCCTCAGG - Intergenic
1128695621 15:69760022-69760044 CTGTGGGTCTCTCATGGTTAGGG - Intergenic
1130295981 15:82647420-82647442 CTGCGGGTCTCTTTAGCACCCGG - Intronic
1130695410 15:86126428-86126450 CTGTGGGTCTTTGTTGCTCCAGG + Intergenic
1202976629 15_KI270727v1_random:301507-301529 CTGTGGGTCTCATTTGGCTGTGG - Intergenic
1133287140 16:4695866-4695888 CTGTGTGTTTGTTTTGGTTCTGG + Intergenic
1135883849 16:26286002-26286024 CTGTGGCTCTATTTGGGTTCAGG + Intergenic
1135954635 16:26945946-26945968 GACTGGGTCTCTATTGCTTCGGG - Intergenic
1137661474 16:50210439-50210461 ATGTGTGTGTCTTTTGTTTCTGG + Intronic
1138268596 16:55678552-55678574 CTGTGGGGCTGCTTGGCTTCAGG - Intronic
1139263528 16:65618454-65618476 CTGTGGGTTTCTGGTGCATCCGG + Intergenic
1141337778 16:83173442-83173464 CCGTGGGTCTCTTTTTATTAAGG + Intronic
1142651945 17:1359306-1359328 CTGTGGGTAACTTTTTTTTCCGG - Intronic
1143317112 17:6041100-6041122 CTCTGGCTCTCTTCTGCTCCAGG - Intronic
1145217220 17:21061364-21061386 GGGTGGGGCTCTTCTGCTTCTGG + Intergenic
1146978635 17:37138830-37138852 CTCTGGCTCTCTTTTTCTTCTGG + Intronic
1149125112 17:53220364-53220386 GTGTGTGTGTCTTTTGCTTACGG - Intergenic
1151654030 17:75487191-75487213 CAGTGGCTCCCTTTTGCTTATGG + Intronic
1151837856 17:76595591-76595613 CTGTTGGTTTCTTTTCTTTCAGG + Intergenic
1152299622 17:79487412-79487434 CTGTGCGTGTCCCTTGCTTCTGG - Intronic
1152435531 17:80274026-80274048 CTGTGGGTCTCTTTGCATTGAGG + Intronic
1153322367 18:3785749-3785771 CTGTGGTTCTCTTTGGGGTCTGG + Intronic
1153349084 18:4058966-4058988 CTGTGGGTCTCTTGAGCCTTTGG - Intronic
1154940721 18:21111093-21111115 CTGTGGGTCGCTGTTGCCCCCGG - Exonic
1156116856 18:33795994-33796016 GTGTTGGTCTCTTTTGCTGATGG + Intergenic
1156206279 18:34889487-34889509 CTGTGATTCACTTTTGCTTCTGG + Intronic
1156902634 18:42319379-42319401 CTTTTAGTCTCTTTTGCTTATGG + Intergenic
1158189124 18:54805343-54805365 GTCTGGATCTCTTTTCCTTCTGG + Intronic
1158945490 18:62443920-62443942 CCGTGGGTCTCTTCTGATTTAGG - Intergenic
1159724697 18:71942353-71942375 CTGTGGTGCTCATTTGCCTCAGG + Intergenic
1160414345 18:78697580-78697602 CTGTGATTCTCTTGTTCTTCCGG + Intergenic
1163212615 19:15852337-15852359 CTGGGGGCCTCTTGAGCTTCAGG - Intergenic
1165222292 19:34326170-34326192 CTGTGAGACTCTTAGGCTTCAGG + Intronic
1165574394 19:36801552-36801574 CTGTGCGTCTCTTCTGATGCAGG + Intergenic
1167213692 19:48149862-48149884 CAGTGGGTCTTTTCTCCTTCCGG + Intronic
1167484105 19:49750581-49750603 CTCTGGGTCTCTTTTCCTTCAGG - Intronic
1167820178 19:51920700-51920722 CTGGGGGTCTGTTTTTATTCAGG - Intronic
1168592205 19:57646710-57646732 TATTGGGTCTCTTTTGCTCCTGG + Intergenic
927043979 2:19258484-19258506 GGGTAGGTCTCTTTTGCTTTAGG - Intergenic
927698894 2:25255181-25255203 CTTGGGGTCTCTTCTGCTTTGGG - Intronic
928361874 2:30669932-30669954 CCCTGGCTCTCTTTTTCTTCTGG + Intergenic
928843944 2:35645861-35645883 CTGTGTATCTATTTGGCTTCTGG - Intergenic
929248794 2:39730570-39730592 CTGTGGGTCTCCTTTCTTACAGG - Intergenic
929624038 2:43387935-43387957 CTGTGTGTCAATTTTACTTCAGG + Intronic
930992194 2:57669845-57669867 CTGTGGTTATCTTCTGATTCTGG - Intergenic
932075970 2:68663281-68663303 CTGTTGGTCTCTTTGGGTCCTGG + Intergenic
932713201 2:74082807-74082829 CTGTGGGTCACTTTCCCTGCAGG - Intronic
935079940 2:99782833-99782855 ATTTGTGTCTTTTTTGCTTCTGG - Intronic
936049459 2:109212147-109212169 CTGTGGTTTTGTTTGGCTTCTGG + Intronic
936632132 2:114215048-114215070 ATGTGGGTTTATTTTGCTGCAGG - Intergenic
937312353 2:120910057-120910079 CTGTGGGTCCCATTTCCCTCTGG + Intronic
937832627 2:126440230-126440252 CAGTGTGTCACTTTTGCCTCGGG - Intergenic
937984674 2:127633148-127633170 CTGGGGTTTTCTTTTGTTTCTGG + Intronic
938133864 2:128737813-128737835 CTGTGCCTCTCTTAGGCTTCTGG + Intergenic
938170562 2:129071799-129071821 CTGTGGGTCTCCTAGGTTTCAGG + Intergenic
940434495 2:153634923-153634945 CTGTGGTTCTCTCTTACCTCTGG + Intergenic
940994355 2:160131799-160131821 CAGTGCGTCTCTTTTGAATCAGG - Intronic
941007686 2:160264415-160264437 ATGTGGTTCCCTTTTGCTTCTGG + Intronic
941850512 2:170175540-170175562 CTATGAGATTCTTTTGCTTCCGG + Intergenic
942446011 2:176079703-176079725 TTGTGGTTCTCCGTTGCTTCGGG + Exonic
943437492 2:187885017-187885039 TTGTGGTCCTATTTTGCTTCTGG + Intergenic
944051808 2:195478551-195478573 CTGTGAATCTCTGTTGCTTTTGG - Intergenic
944292663 2:198024949-198024971 CTGTGGTTCTTTTTTTCCTCAGG + Intronic
945050076 2:205815386-205815408 CTATGTGTCTCTTCTGTTTCTGG - Intergenic
945598550 2:211828332-211828354 TTGTGGGTTTATTTTTCTTCTGG - Intronic
947709620 2:232304712-232304734 GTGTGTGTGTCTTTTCCTTCTGG + Intronic
947828097 2:233120058-233120080 CTGTGGGTCTTGTTTCCTACAGG + Intronic
948762696 2:240202666-240202688 CTATGGGTCTCTTGTTATTCTGG - Intergenic
948914542 2:241026406-241026428 CTTTGTGTCTCCTTTCCTTCTGG + Intronic
1170067264 20:12326468-12326490 CTCTGGGTCTGTTTTGCTCCAGG + Intergenic
1170518173 20:17153496-17153518 CTGTGGGTGGCTTTTGCATATGG - Intergenic
1172876326 20:38166477-38166499 CTCTTGGTCTCCTGTGCTTCCGG + Intronic
1174763722 20:53231694-53231716 CTGTGAGTCTCCTTTCCTTGTGG - Intronic
1174974700 20:55319098-55319120 CTGTGTTGCTCTTTTGATTCTGG - Intergenic
1176051417 20:63121479-63121501 CTGGGGGTCCCTTTCGTTTCAGG - Intergenic
1176788550 21:13290003-13290025 CTATGTCTCTCTCTTGCTTCAGG - Intergenic
1177708735 21:24742513-24742535 CTGTGTGTCTCTTTTTGTACTGG + Intergenic
1177853662 21:26377765-26377787 CAGTGGTTCTCTTTTTCTCCAGG + Intergenic
1178865121 21:36320507-36320529 TTGTGTTTCTGTTTTGCTTCGGG + Intronic
1180457954 22:15528923-15528945 CTGTGGGTCTCATTTGGCTGTGG + Exonic
1181466375 22:23112778-23112800 CTGAGGGTCTTCTGTGCTTCAGG - Intronic
1183399620 22:37594655-37594677 CTGTGGGTCTCTTTTTCTGCTGG - Intergenic
1185016392 22:48345682-48345704 CTGTCGGTCTCTCTTGTCTCAGG - Intergenic
949492644 3:4604462-4604484 CTATGTGTCTCCTTTGCTTAGGG + Intronic
949963097 3:9330677-9330699 CTGTGGGTCTGCTGTGATTCTGG - Intronic
949994174 3:9603168-9603190 CTGTCTGTCTCTGTTGCTTCAGG + Intergenic
950234116 3:11303735-11303757 CTGTGGGTTTCTTTCCCTTGAGG + Intronic
951647889 3:24913998-24914020 CTGTGGCTACCTTTTGCATCTGG - Intergenic
952389632 3:32869144-32869166 TTCTGGGCCTCATTTGCTTCTGG + Intronic
952969535 3:38641992-38642014 CTCTGGGTCTCTGTGGTTTCAGG - Intronic
953618261 3:44510909-44510931 CTGGAGGCCTCTTTTCCTTCAGG + Intergenic
954827628 3:53388865-53388887 CTTTGGTCTTCTTTTGCTTCAGG - Intergenic
956107326 3:65833469-65833491 CTGTTGGTCTCTGATGCTACTGG - Intronic
957602288 3:82353243-82353265 ATGTTGATCTCTCTTGCTTCTGG + Intergenic
958531194 3:95333013-95333035 CTGTGGGTCTCTTGTGGCCCAGG + Intergenic
960555207 3:119020629-119020651 CTGAGGGTTTATTATGCTTCAGG - Intronic
960635394 3:119780164-119780186 CTTTGGGTCTCTTTTCCTTTGGG - Intergenic
961515337 3:127428891-127428913 CTGTAGCTCACTTTTGCCTCTGG + Intergenic
961645621 3:128391351-128391373 GTGTGGGGCTCTTCTGCCTCTGG - Intronic
961918636 3:130403341-130403363 CTGTGGGTCTCATCTGCTGGTGG + Intronic
962533339 3:136304052-136304074 GTCTGTGTCTCTTTGGCTTCTGG + Intronic
962918814 3:139933639-139933661 ATGTGGGGCTCTTTACCTTCAGG - Intergenic
963316329 3:143762741-143762763 TTGTGGGACTCTTGTTCTTCAGG - Intronic
965084053 3:164071423-164071445 CTATGGTTCTTTTTTTCTTCTGG - Intergenic
966124384 3:176558699-176558721 CTGTGGGGCTCTGTTTCTGCAGG + Intergenic
968577531 4:1374864-1374886 CTGTGCGTCTCTTCTCCTTGAGG + Intronic
969388990 4:6876704-6876726 CTGGGTGTCTCTTTAGCATCTGG - Exonic
969655305 4:8493956-8493978 CTGTGGATCTCGTATGCTTAGGG + Intergenic
970569410 4:17365097-17365119 CTGGGGGTCTCTATTGCTGCTGG - Intergenic
974517033 4:62930031-62930053 CTGTGTCTCTCTCTTGTTTCAGG + Intergenic
978326426 4:107562227-107562249 TTGTGGATTTCTTTTGATTCTGG + Intergenic
980481942 4:133398714-133398736 CTGTGAGTCTCTCTTGCTGAGGG + Intergenic
981226781 4:142305740-142305762 CTGTTGGTCTCTTTTCTTTTAGG - Intronic
982387713 4:154830035-154830057 CTAAGTGTCTCTTTTTCTTCTGG - Intergenic
984047792 4:174823179-174823201 CTGTGGCTTTATTTTGCTTGGGG - Intronic
985313419 4:188629044-188629066 CTGTGGGTTTATTTTTCTCCCGG - Intergenic
985593384 5:776640-776662 GTGAGGGTGGCTTTTGCTTCTGG - Intergenic
986001405 5:3633684-3633706 CTGTGGCTCTCTCTGGCTACAGG + Intergenic
986179598 5:5381457-5381479 CTGTGAGTCTCATTTGATTATGG + Intergenic
986317445 5:6599978-6600000 CTGTTGGCCTCTTCTGCATCTGG + Exonic
986420793 5:7579408-7579430 CTGTGGATCTCTTTTTTTTAGGG - Intronic
987410130 5:17606571-17606593 ATGGGGGTATCTTTGGCTTCAGG - Intergenic
987410787 5:17612777-17612799 ATGGGGGTATCTTTGGCTTCAGG - Intergenic
987413343 5:17636248-17636270 ATGGGGGTATCTTTGGCTTCAGG - Intergenic
987967718 5:24897093-24897115 CTGTTGATCTCTGTTGCTGCTGG - Intergenic
989120299 5:37998152-37998174 CTGTGTGTCTCTTGAGCTTAGGG + Intergenic
989672683 5:43936750-43936772 CTGTGTGTGTCCTTTGCTTCAGG - Intergenic
989738769 5:44742986-44743008 CTTTGGGTTGCTTTTGCTTTGGG - Intergenic
992045009 5:72879110-72879132 CTGTGTGTTTCCTTTGGTTCTGG + Intronic
993133183 5:83924686-83924708 CTGAGGATATCTTTTGCTTAAGG - Intergenic
993916675 5:93752080-93752102 CTCTGGGTCTCTTTCTCATCTGG - Intronic
994753090 5:103763475-103763497 CTGTGCTTGGCTTTTGCTTCTGG + Intergenic
995426876 5:112034327-112034349 CTGTTGGTCACAATTGCTTCTGG + Intergenic
997591903 5:135079145-135079167 CTGTGGTTTGCTTTTGCTTCTGG + Intronic
998096224 5:139396844-139396866 CTGAGGCTTTCTTATGCTTCTGG + Exonic
999456965 5:151724803-151724825 CTGTGAGTCTCCTTTTCTTCAGG - Intergenic
999667006 5:153923023-153923045 CTGTTCTTCTCTTTGGCTTCAGG - Intergenic
1000939360 5:167341660-167341682 CTGTAGATCTCTTTTTCTTTTGG + Intronic
1001044020 5:168357397-168357419 CTGTGGGTTTCTTTTCCGTGTGG + Intronic
1005015548 6:21371850-21371872 CTGTGGGAGACTTTTACTTCTGG + Intergenic
1005160885 6:22862166-22862188 ATGTGGGTCTCTTTTTCTAAAGG - Intergenic
1005327307 6:24715280-24715302 CTGTGGGGATCTCTTGGTTCAGG + Intronic
1005918992 6:30382031-30382053 CTCTGTGTTTGTTTTGCTTCTGG - Intergenic
1008231684 6:48990731-48990753 CTTTGGGTCTCTGTGGTTTCTGG + Intergenic
1010363912 6:75027721-75027743 ATGTGGGTCTTTTTTTATTCTGG + Intergenic
1012524758 6:100164144-100164166 CTTTGGGTCTTTTTTGTTTATGG - Intergenic
1014049301 6:116933578-116933600 CTCTGGGTCTCATTTGCACCTGG + Intergenic
1014118448 6:117694125-117694147 CTGTGGGTCTCTTTTGCTTCTGG - Exonic
1014391791 6:120873185-120873207 CTGTGGGGCTCTGTGGCTCCTGG + Intergenic
1017491517 6:154949893-154949915 CTGGGACTGTCTTTTGCTTCAGG + Intronic
1017658993 6:156655734-156655756 CTGTGGCTCTCTTTCTCTCCAGG - Intergenic
1020150361 7:5677258-5677280 CTGCTGTTGTCTTTTGCTTCTGG + Intronic
1021056498 7:16053908-16053930 CAGTGGCTAACTTTTGCTTCTGG + Intergenic
1021946375 7:25731921-25731943 CTTCGGGTCTCCTTTGTTTCAGG + Intergenic
1022491128 7:30819112-30819134 CTGTTGTTCTCTTTTGCTGGGGG + Intronic
1022545398 7:31183195-31183217 CTGTGAATCTGTTTTGGTTCTGG + Intergenic
1023252725 7:38282903-38282925 CTCTTTGTCTCTTTTGTTTCAGG + Intergenic
1025898598 7:65725865-65725887 CTGTGGGTTCCTATTCCTTCTGG + Intergenic
1027787465 7:82598396-82598418 ATGTCTGTCTCTTCTGCTTCTGG - Intergenic
1028286573 7:89010446-89010468 CTCTCTGTCTCTTTTACTTCTGG + Intronic
1028723837 7:94064726-94064748 CTTTTGGTCTCTGTTCCTTCTGG - Intergenic
1030331934 7:108280108-108280130 CTGTTGGTGTCTTTTTATTCTGG - Intronic
1032394868 7:131581995-131582017 GTCTGGGACTCATTTGCTTCCGG + Intergenic
1032717160 7:134519201-134519223 CAGTGGGTCTATTTGGCTTTTGG - Intergenic
1033226558 7:139567639-139567661 CTGTCTGTGTCTTTTCCTTCTGG - Exonic
1033605360 7:142923801-142923823 CTGTGTGTCTCTTTCTCTTTGGG - Intronic
1033906372 7:146209425-146209447 CTTTAGGACTCTTATGCTTCAGG - Intronic
1034831527 7:154312315-154312337 CTGTGGGTCCCCTTTGATCCTGG + Intronic
1036479135 8:9122347-9122369 GTGTGGGTCTCTGATGCTTGAGG + Intergenic
1037550479 8:19966253-19966275 CAGTGCGTCTCTTTTGTTCCTGG + Exonic
1037567044 8:20126781-20126803 CTCTGCATCTCTTTTGTTTCAGG - Intergenic
1037777145 8:21842965-21842987 GTGGGGGTCTCATTTGGTTCAGG - Intergenic
1038296417 8:26294912-26294934 CAGTCAGTCTCTTTTGTTTCTGG - Intronic
1038573823 8:28686763-28686785 CTTTGGGTCTCCATTGCTACCGG - Intronic
1039276990 8:35943979-35944001 CTCTGTCTCTTTTTTGCTTCAGG - Intergenic
1039412930 8:37370712-37370734 CTTGGGATCTCTTTTCCTTCAGG - Intergenic
1039855352 8:41407261-41407283 CTGTGGGACTGTTGTGCTTGAGG + Intergenic
1040290488 8:46121610-46121632 CTGCGGTCCTCTTTTGCTTGTGG + Intergenic
1040340337 8:46437332-46437354 CTGAGGCCCTGTTTTGCTTCTGG + Intergenic
1040469308 8:47724124-47724146 CTGTGGGCCTCTTCTGCTTCCGG + Intronic
1042023212 8:64393675-64393697 CTCAGTGTCTCTTTTGCTTGTGG + Intergenic
1042472190 8:69203458-69203480 TTGTGGGTTTTTTTTGCTTATGG + Intergenic
1043564624 8:81534351-81534373 TTGTGGGACTCTTTGGCTTATGG - Intergenic
1043980672 8:86635245-86635267 CTGTGGGTCTCTTTAAATTAAGG + Intronic
1044788483 8:95822194-95822216 TTGTGGTTCTTTTTTTCTTCTGG + Intergenic
1045403372 8:101841261-101841283 CTGTGAGTCTCACTGGCTTCAGG - Intronic
1047073225 8:121371111-121371133 CTGTGGGTCTCATGTGCCCCAGG - Intergenic
1047930484 8:129723700-129723722 CTCTGGGTCTCTTTTTATTTTGG - Intergenic
1050184212 9:2955563-2955585 CTGGGGGTTTCTTCTGCTCCTGG - Intergenic
1050504569 9:6334237-6334259 CTGTCTCTCTCTTTTCCTTCTGG - Intergenic
1050850079 9:10274059-10274081 CTGTGGGTTTCTGTTTCTTCAGG + Intronic
1051224379 9:14883557-14883579 CTGTTGTTCTGTTTTTCTTCTGG - Intronic
1056667642 9:88593766-88593788 CCGTGGTTCTCTTTTGCCCCTGG + Intergenic
1057174505 9:92986184-92986206 CTATGGGTCTCTTGTGCCTATGG + Intronic
1057367471 9:94436485-94436507 CTGTGGGTAAGTTTAGCTTCAGG - Intronic
1057655857 9:96951568-96951590 CTGTGGGTAAGTTTAGCTTCAGG + Intronic
1059561182 9:115335922-115335944 CTCTGGGACTTTTATGCTTCTGG - Intronic
1060736940 9:126072023-126072045 ATGTGGGTCTGTTTGGCTCCAGG + Intergenic
1060908482 9:127329543-127329565 CTGAGGACCTCTTCTGCTTCAGG - Intronic
1186321258 X:8428125-8428147 CAGTGGGTCACCTTTGCTTCTGG - Intergenic
1190099648 X:47512826-47512848 CTGTGGGTCTCTTTTGCTTCTGG + Intergenic
1191831542 X:65420614-65420636 CTGTAGGTCTCTGTTTCTTTAGG - Intronic
1192387521 X:70686907-70686929 CTATGGGTCTCTTTTTATTAAGG - Intronic
1193194019 X:78608585-78608607 CTGTGGTTCTGTTTTTCTTCAGG + Intergenic
1194606383 X:95984120-95984142 CTGTGGGTTTCTTTTGGAGCTGG + Intergenic
1194723579 X:97368864-97368886 CTGTTGGTTTAGTTTGCTTCAGG - Intronic
1194764142 X:97829598-97829620 ATGTTGCTCTGTTTTGCTTCTGG - Intergenic
1195120391 X:101744470-101744492 CTGGGTGTTTCTTTTGCTTCAGG - Intergenic
1196241559 X:113347939-113347961 CTGTGGCTCTATGTTGCTCCTGG + Intergenic
1196890625 X:120287500-120287522 CTCTGGTTTTCTTTTACTTCTGG + Intronic
1199500095 X:148499282-148499304 CTTAGGGTCTCTGTTTCTTCAGG + Intergenic
1200307237 X:155039538-155039560 ATGAGGGTCTCTTTTGCATGTGG + Intronic
1200839895 Y:7770589-7770611 CTGTGGCTCTCATTTGCTCTGGG - Intergenic
1201488937 Y:14521277-14521299 CTGTGGGTTGCTTTTCCTTGTGG - Intergenic