ID: 1014119977

View in Genome Browser
Species Human (GRCh38)
Location 6:117713333-117713355
Sequence TTGTGGTTTTGGAAGAGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014119973_1014119977 0 Left 1014119973 6:117713310-117713332 CCTGGCTTTTTTTTTTTTTTTTT 0: 1995
1: 9557
2: 31894
3: 88055
4: 225639
Right 1014119977 6:117713333-117713355 TTGTGGTTTTGGAAGAGACAGGG No data
1014119970_1014119977 18 Left 1014119970 6:117713292-117713314 CCGCAAGACAACACCATGCCTGG No data
Right 1014119977 6:117713333-117713355 TTGTGGTTTTGGAAGAGACAGGG No data
1014119968_1014119977 27 Left 1014119968 6:117713283-117713305 CCTGACTTCCCGCAAGACAACAC No data
Right 1014119977 6:117713333-117713355 TTGTGGTTTTGGAAGAGACAGGG No data
1014119969_1014119977 19 Left 1014119969 6:117713291-117713313 CCCGCAAGACAACACCATGCCTG No data
Right 1014119977 6:117713333-117713355 TTGTGGTTTTGGAAGAGACAGGG No data
1014119972_1014119977 5 Left 1014119972 6:117713305-117713327 CCATGCCTGGCTTTTTTTTTTTT 0: 416
1: 1570
2: 7108
3: 24502
4: 98839
Right 1014119977 6:117713333-117713355 TTGTGGTTTTGGAAGAGACAGGG No data
1014119967_1014119977 28 Left 1014119967 6:117713282-117713304 CCCTGACTTCCCGCAAGACAACA No data
Right 1014119977 6:117713333-117713355 TTGTGGTTTTGGAAGAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014119977 Original CRISPR TTGTGGTTTTGGAAGAGACA GGG Intergenic
No off target data available for this crispr