ID: 1014122752

View in Genome Browser
Species Human (GRCh38)
Location 6:117745341-117745363
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014122751_1014122752 3 Left 1014122751 6:117745315-117745337 CCAAGAACACACAATGGGGAAAA No data
Right 1014122752 6:117745341-117745363 AGTCTGTCCAAAGAATGACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014122752 Original CRISPR AGTCTGTCCAAAGAATGACG TGG Intergenic